Anauxetic dysplasia

Summary

Anauxetic dysplasia (MONDO:0011773) is a disease with 5 cohort genes.

At a glance

• Prevalence: <1 / 1 000 000 (Worldwide) [Orphanet-validated]
• Cohort genes: 5
• ClinVar variants: 750

Clinical features

Epidemiology

Prevalence records

2 prevalence record(s), Orphanet:

Type	Class	Value	Geography	Validation
Cases/families		10	Worldwide	Validated
Point prevalence	<1 / 1 000 000		Worldwide	Validated

Identifiers

Disease identifiers

Field	Value
Canonical name	anauxetic dysplasia
Mondo ID	MONDO:0011773
MeSH	C538256
OMIM	607095
Orphanet	93347
DOID	DOID:0080942
ICD-11	1897630209
UMLS	C1846796
MedGen	375972
GARD	0009657
Is cancer (heuristic)	no

Also known as: anauxetic dysplasia · anauxetic dysplasia type 1 · ANXD1 · spondyloepimetaphyseal dysplasia, anauxetic type · spondyloepimetaphyseal dysplasia, Menger type · spondylometaepiphyseal dysplasia anauxetic type · spondylometaepiphyseal dysplasia Menger type · spondylometaepiphyseal dysplasia, Menger type

Data availability: 750 ClinVar variants · 2 GenCC gene-disease records.

Disease family

An umbrella term covering 3 Mondo subtypes.

Classification path: disease › human disease › disease by body system or component › musculoskeletal system disorder › skeletal system disorder › bone disorder › bone development disease › osteochondrodysplasia › spondyloepiphyseal dysplasia › anauxetic dysplasia

Related subtypes (43): hip dysplasia, Beukes type, spondyloepiphyseal dysplasia with congenital joint dislocations, Marshall syndrome, metatropic dysplasia, spondyloepiphyseal dysplasia with punctate corneal dystrophy, spondyloepiphyseal dysplasia, MacDermot type, progressive pseudorheumatoid arthropathy of childhood, otospondylomegaepiphyseal dysplasia, Dyggve-Melchior-Clausen disease, dyssegmental dysplasia, Rolland-Desbuquois type, Silverman-Handmaker type dyssegmental dysplasia, Wolcott-Rallison syndrome, Schimke immuno-osseous dysplasia, Richieri Costa-da Silva syndrome, Schwartz-Jampel syndrome, X-linked spondyloepimetaphyseal dysplasia, CODAS syndrome, spondyloepiphyseal dysplasia, Reardon type, brachyolmia-amelogenesis imperfecta syndrome, spondyloepiphyseal dysplasia with coronal craniosynostosis, cataracts, cleft palate, and intellectual disability, spondyloepiphyseal dysplasia, Kimberley type, spondyloepiphyseal dysplasia, Cantu type, Ehlers-Danlos syndrome, spondylocheirodysplastic type, spondylo-megaepiphyseal-metaphyseal dysplasia, brachydactylous dwarfism, Mseleni type, TMEM165-congenital disorder of glycosylation, Steel syndrome, cataract-growth hormone deficiency-sensory neuropathy-sensorineural hearing loss-skeletal dysplasia syndrome, Roifman syndrome, progressive spondyloepimetaphyseal dysplasia-short stature-short fourth metatarsals-intellectual disability syndrome, even-plus syndrome, Smith-McCort dysplasia, cono-spondylar dysplasia, X-linked intellectual disability-cerebellar hypoplasia-spondylo-epiphyseal dysplasia syndrome, Stickler syndrome, spondyloepiphyseal dysplasia tarda, spondyloepiphyseal dysplasia, kondo-fu type, spondyloepiphyseal dysplasia, nishimura type, immunoskeletal dysplasia with neurodevelopmental abnormalities, COL2A1-related spondyloepiphyseal dysplasia, MIR140-related spondyloepiphyseal dysplasia, MGP-related spondyloepiphyseal dysplasia, spondyloepiphyseal dysplasia, Holling type

Subtypes (3): anauxetic dysplasia 3, anauxetic dysplasia 1, anauxetic dysplasia 2

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

600 retrieved; paginated sample, class counts are floors:

367 uncertain significance, 118 pathogenic, 52 pathogenic/likely pathogenic, 30 likely pathogenic, 16 conflicting classifications of pathogenicity, 8 benign, 6 likely benign, 3 benign/likely benign

ClinVar	Variant (HGVS)	Gene	Classification	Review
14208	NR_003051.4(RMRP):n.72A>G	CCDC107	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1065911	NC_000009.12:g.35658022_35658037dup	RMRP	Pathogenic	criteria provided, single submitter
1065953	NR_003051.3(RMRP):n.-20_-5dupCTCTGTGAAGCTGAGG	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1066456	NC_000009.12:g.35658018_35658032dup	RMRP	Pathogenic	criteria provided, single submitter
1066913	NC_000009.12:g.35658022_35658023insTCTCAGCTTCACAGAGACGT	RMRP	Pathogenic	criteria provided, single submitter
1066998	NR_003051.3(RMRP):n.-20_-12dup	RMRP	Pathogenic	criteria provided, single submitter
1067112	NC_000009.12:g.35658025_35658037dup	RMRP	Pathogenic	criteria provided, single submitter
1067134	NC_000009.12:g.35658022_35658023insTCTCAGCTTCACAGAGTAGTAT	RMRP	Pathogenic	criteria provided, single submitter
1067141	NR_003051.3(RMRP):n.-20_-1dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067258	NC_000009.12:g.35657921C>T	RMRP	Pathogenic	criteria provided, multiple submitters, no conflicts
1067265	NR_003051.3(RMRP):n.-10_-9insACTACTCTGTGAAGCACTACTCTGTGAAGC	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067429	NR_003051.4(RMRP):n.129G>A	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067465	NR_003051.3(RMRP):n.-9_-8insACTCTGTGAAGCTACTCTGTGAAGCT	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067503	NR_003051.3(RMRP):n.-15_1dupTGAAGCTGAGGACGTG	RMRP	Pathogenic	criteria provided, multiple submitters, no conflicts
1068099	NR_003051.3(RMRP):n.-21_-1dupACTCTGTGAAGCTGAGGACGT	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1071614	NC_000009.12:g.35658018_35658024dup	RMRP	Pathogenic	criteria provided, single submitter
1299142	NC_000009.12:g.35657756C>G	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1299143	NR_003051.3(RMRP):n.-14_-4dupGAAGCTGAGGA	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1354353	NR_003051.3(RMRP):n.-9_-8insACTCTGTGAAGCTACTCTGTGAAGCTACTCTGTGAAGCT	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1364230	NC_000009.12:g.35658022_35658023insTCTCAGCTTCAC	RMRP	Pathogenic	criteria provided, single submitter
1364444	NC_000009.12:g.35658034_35658048dup	RMRP	Pathogenic	criteria provided, single submitter
1371602	NR_003051.3(RMRP):n.-23_-12dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1373627	NC_000009.12:g.35658017_35658040dup	RMRP	Pathogenic	criteria provided, single submitter
1376080	NC_000009.12:g.35658028GCTTCACAGAGTAGTA[5]	RMRP	Pathogenic	criteria provided, single submitter
1389778	NC_000009.12:g.35658032CACAGAGTAGTAT[3]	RMRP	Pathogenic	criteria provided, single submitter
1397735	NR_003051.3(RMRP):n.-16_-2dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1408689	NC_000009.12:g.35658029_35658042dup	RMRP	Pathogenic	criteria provided, single submitter
1420154	NC_000009.12:g.35658036_35658044dup	RMRP	Pathogenic	criteria provided, single submitter
14209	NR_003051.4(RMRP):n.264G>T	RMRP	Pathogenic	reviewed by expert panel
14210	NR_003051.3(RMRP):n.-22_-13dup10	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 6 · Orphanet: 5 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
POP1	Definitive	Autosomal recessive	anauxetic dysplasia 2	4
RMP64	Strong	Autosomal recessive	anauxetic dysplasia 3	2

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
RMP64	Orphanet:93347	Anauxetic dysplasia
POP1	Orphanet:93347	Anauxetic dysplasia
RMRP	Orphanet:175	Cartilage-hair hypoplasia
RMRP	Orphanet:39041	Omenn syndrome
RMRP	Orphanet:93347	Anauxetic dysplasia

Cohort genes → proteins

5 cohort genes, 4 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	5

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
RMP64	HGNC:24496	ENSG00000163608	Q6NW34	Ribonuclease MRP subunit P64	gencc
POP1	HGNC:30129	ENSG00000104356	Q99575	Ribonucleases P/MRP protein subunit POP1	gencc
RMRP	HGNC:10031	ENSG00000277027		RNA component of mitochondrial RNA processing endoribonuclease	clinvar
CCDC107	HGNC:28465	ENSG00000159884	Q8WV48	Coiled-coil domain-containing protein 107	clinvar
HRCT1	HGNC:33872	ENSG00000196196	Q6UXD1	Histidine-rich carboxyl terminus protein 1	clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
RMP64	Ribonuclease MRP subunit P64	Specific component of the MRP ribonucleoprotein endoribonuclease, Rnase/Mrp complex, a ribonucleoprotein complex involved in pre-rRNA processing.
POP1	Ribonucleases P/MRP protein subunit POP1	Component of ribonuclease P, a ribonucleoprotein complex that generates mature tRNA molecules by cleaving their 5’-ends.

Protein-family classification

Druggable: 1 · Difficult: 0 · Unknown: 4 · Druggable fraction: 0.2

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Enzyme (other)	1	2.4×	0.353
Other/Unknown	4	1.4×	0.353

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
RMP64	Other/Unknown	no		Nepro_N, Nepro
POP1	Enzyme (other)	yes	3.1.26.5	Pop1_N, POPLD_dom, Pop1
RMRP	Other/Unknown	no
CCDC107	Other/Unknown	no		CCDC107
HRCT1	Other/Unknown	no		HRCT1

Expression context

Cohort genes with no expression data: 0.

4 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	5
unknown	0

Top tissues across cohort

Tissue	Cohort genes
endothelial cell	1
parietal pleura	1
secondary oocyte	1
cortical plate	1
male germ line stem cell (sensu Vertebrata) in testis	1
primordial germ cell in gonad	1
bone marrow cell	1
colonic epithelium	1
corpus callosum	1
aorta	1
popliteal artery	1
tibial artery	1
descending thoracic aorta	1
mucosa of transverse colon	1
right coronary artery	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
RMP64	261	ubiquitous	marker	secondary oocyte, endothelial cell, parietal pleura
POP1	179	ubiquitous	marker	male germ line stem cell (sensu Vertebrata) in testis, primordial germ cell in gonad, cortical plate
RMRP	128	ubiquitous	yes	corpus callosum, colonic epithelium, bone marrow cell
CCDC107	254	ubiquitous	marker	popliteal artery, tibial artery, aorta
HRCT1	162	broad	marker	mucosa of transverse colon, right coronary artery, descending thoracic aorta

Protein interactions among cohort

Intra-cohort edges: 1.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
POP1	1,620
RMP64	1,198
CCDC107	1,093
HRCT1	331
RMRP	0

Intra-cohort edges

A	B	Sources
POP1	RMP64	biogrid_interaction

Structural data

PDB: 2 · AlphaFold-only: 2 · No structure: 1

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
POP1	Q99575	5
RMP64	Q6NW34	3

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
HRCT1	Q6UXD1	62.62
CCDC107	Q8WV48	61.31

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 1. Enrichment computed across 5 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
tRNA processing in the nucleus	1	196.9×	0.005	POP1

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
tRNA decay	1	1685.2×	0.004	POP1
tRNA 5’-leader removal	1	648.1×	0.005	POP1
tRNA processing	1	421.3×	0.005	POP1
positive regulation of Notch signaling pathway	1	175.5×	0.009	RMP64
negative regulation of neuron differentiation	1	135.9×	0.009	RMP64
RNA processing	1	109.4×	0.009	RMP64

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 5

Druggability breadth: 1 of 5 evidence-associated genes (20%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
RMP64	0	0
POP1	0	0
RMRP	0	0
CCDC107	0	0
HRCT1	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 1.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
POP1	1	Binding:1

Cohort enzymes (BRENDA EC)

Symbol	EC numbers	Names
POP1	3.1.26.5	ribonuclease P

Pharmacogenomics

Cohort genes with a PharmGKB record: 5; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	1	POP1
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	4	RMP64, RMRP, CCDC107, HRCT1

Undrugged target profiles

5 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
RMP64	0	—
POP1	1	—
RMRP	0	—
CCDC107	0	—
HRCT1	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.