Annular epidermolytic ichthyosis

Summary

Annular epidermolytic ichthyosis (MONDO:0011870) is a disease caused by variants in KRT1 and KRT10, with 3 cohort genes.

At a glance

• Prevalence: <1 / 1 000 000 (Worldwide) [Orphanet-validated]
• Causal genes: KRT1 (GenCC Definitive), KRT10 (GenCC Definitive)
• Cohort genes: 3
• ClinVar variants: 12

Clinical features

Epidemiology

Prevalence records

2 prevalence record(s), Orphanet:

Type	Class	Value	Geography	Validation
Cases/families		7	Worldwide	Validated
Point prevalence	<1 / 1 000 000		Worldwide	Validated

Identifiers

Disease identifiers

Field	Value
Canonical name	annular epidermolytic ichthyosis
Mondo ID	MONDO:0011870
MeSH	C564367
OMIM	607602
Orphanet	281139
ICD-11	280058464
SNOMED CT	718631006
UMLS	C1843463
MedGen	334410
GARD	0017304
Is cancer (heuristic)	no

Also known as: AEI · ichthyosis, annular epidermolytic

Data availability: 12 ClinVar variants · 6 GenCC gene-disease records.

Disease family

An umbrella term covering 2 Mondo subtypes.

Classification path: disease › human disease › disease by etiologic mechanism › disease of genetic or genomic mechanism › hereditary disease › autosomal genetic disease › autosomal dominant disease › autosomal dominant epidermolytic ichthyosis › annular epidermolytic ichthyosis

Related subtypes (1): epidermolytic hyperkeratosis 2A, autosomal dominant

Subtypes (2): ichthyosis, annular epidermolytic 1, ichthyosis, annular epidermolytic, 2

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

12 retrieved; paginated sample, class counts are floors:

3 likely pathogenic, 2 conflicting classifications of pathogenicity, 2 pathogenic, 2 pathogenic/likely pathogenic, 2 benign/likely benign, 1 benign

ClinVar	Variant (HGVS)	Gene	Classification	Review
15911	NM_006121.4(KRT1):c.1436T>C (p.Ile479Thr)	KRT1	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
432078	NM_006121.4(KRT1):c.1453C>T (p.Leu485Phe)	KRT1	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
14576	NM_000421.5(KRT10):c.466C>T (p.Arg156Cys)	KRT10	Pathogenic	criteria provided, multiple submitters, no conflicts
14580	NM_000421.5(KRT10):c.1264_1265delinsGA (p.Arg422Glu)	KRT10	Pathogenic	no assertion criteria provided
989261	NM_006121.4(KRT1):c.532T>C (p.Ser178Pro)	KRT1	Likely pathogenic	criteria provided, multiple submitters, no conflicts
997963	NM_006121.4(KRT1):c.564C>G (p.Asn188Lys)	KRT1	Likely pathogenic	criteria provided, single submitter
1705574	NM_000421.5(KRT10):c.470T>G (p.Leu157Arg)	KRT10-AS1	Likely pathogenic	criteria provided, single submitter
1049274	NM_000421.5(KRT10):c.1654AGCTCCGGCGGCGGATACGGCGGCGGCAGC[3] (p.556GYGGGSSSGG[3])	KRT10	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1186831	NM_000421.5(KRT10):c.49GGA[9] (p.Gly24dup)	KRT10-AS1	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1300082	NM_000421.5(KRT10):c.1459C>T (p.His487Tyr)	KRT10	Benign	criteria provided, multiple submitters, no conflicts
516735	NM_000421.5(KRT10):c.1654_1683dup (p.Gly556_Gly565dup)	KRT10	Benign/Likely benign	criteria provided, multiple submitters, no conflicts
66171	NM_000421.5(KRT10):c.376G>A (p.Gly126Ser)	KRT10-AS1	Benign/Likely benign	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 33 · Orphanet: 12 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
KRT1	Definitive	Autosomal dominant	annular epidermolytic ichthyosis	18
KRT10	Definitive	Autosomal dominant	annular epidermolytic ichthyosis	15

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
KRT1	Orphanet:2199	Epidermolytic palmoplantar keratoderma
KRT1	Orphanet:281139	Annular epidermolytic ichthyosis
KRT1	Orphanet:281190	Congenital reticular ichthyosiform erythroderma
KRT1	Orphanet:312	Autosomal dominant epidermolytic ichthyosis
KRT1	Orphanet:50942	Striate palmoplantar keratoderma
KRT1	Orphanet:530838	KRT1-related diffuse nonepidermolytic keratoderma
KRT1	Orphanet:538574	Palmoplantar keratoderma-hereditary motor and sensory neuropathy syndrome
KRT1	Orphanet:79503	Ichthyosis hystrix of Curth-Macklin
KRT10	Orphanet:281139	Annular epidermolytic ichthyosis
KRT10	Orphanet:281190	Congenital reticular ichthyosiform erythroderma
KRT10	Orphanet:312	Autosomal dominant epidermolytic ichthyosis
KRT10	Orphanet:512103	Autosomal recessive epidermolytic ichthyosis

Cohort genes → proteins

3 cohort genes, 3 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	3

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
KRT1	HGNC:6412	ENSG00000167768	P04264	Keratin, type II cytoskeletal 1	gencc,clinvar
KRT10	HGNC:6413	ENSG00000186395	P13645	Keratin, type I cytoskeletal 10	gencc,clinvar
KRT10-AS1	HGNC:28305	ENSG00000167920	Q8N816	Uncharacterized protein KRT10-AS1	clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
KRT1	Keratin, type II cytoskeletal 1	May regulate the activity of kinases such as PKC and SRC via binding to integrin beta-1 (ITB1) and the receptor of activated protein C kinase 1 (RACK1).
KRT10	Keratin, type I cytoskeletal 10	Plays a role in the establishment of the epidermal barrier on plantar skin.

Protein-family classification

Druggable: 0 · Difficult: 0 · Unknown: 3 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Other/Unknown	3	1.8×	0.174

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
KRT1	Other/Unknown	no		Keratin_II, IF_conserved, Keratin_2_head
KRT10	Other/Unknown	no		Keratin_I, IF_conserved, IF_rod_dom
KRT10-AS1	Other/Unknown	no

Expression context

Cohort genes with no expression data: 0.

3 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	3
unknown	0

Top tissues across cohort

Tissue	Cohort genes
mammalian vulva	2
upper leg skin	2
skin of hip	1
penis	1
left testis	1
pancreatic ductal cell	1
right testis	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
KRT1	177	tissue_specific	marker	mammalian vulva, upper leg skin, skin of hip
KRT10	299	broad	marker	upper leg skin, penis, mammalian vulva
KRT10-AS1	234	ubiquitous	marker	left testis, right testis, pancreatic ductal cell

Protein interactions among cohort

Intra-cohort edges: 1.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
KRT1	2,716
KRT10	2,304
KRT10-AS1	2

Intra-cohort edges

A	B	Sources
KRT1	KRT10	biogrid_interaction, intact, string_interaction

Structural data

PDB: 2 · AlphaFold-only: 1 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
KRT10	P13645	6
KRT1	P04264	3

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
KRT10-AS1	Q8N816	46.64

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 10. Enrichment computed across 3 evidence-associated genes (2 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Differentiation of Keratinocytes in Interfollicular Epidermis in Mammalian Skin	2	278.5×	1e-04	KRT1, KRT10
Developmental Cell Lineages	2	223.9×	1e-04	KRT1, KRT10
Formation of the cornified envelope	2	87.8×	4e-04	KRT1, KRT10
Keratinization	2	55.7×	8e-04	KRT1, KRT10
Regulation of FXIIa and plasma kallikrein activity	1	571.0×	0.004	KRT1
Developmental Biology	2	14.5×	0.008	KRT1, KRT10
FXIIa activates plasma kallikrein-kinin system	1	86.5×	0.016	KRT1
Innate Immune System	1	12.8×	0.094	KRT1
Neutrophil degranulation	1	11.5×	0.094	KRT1
Immune System	1	6.5×	0.148	KRT1

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
protein heterotetramerization	2	1053.2×	5e-06	KRT1, KRT10
cornification	2	1053.2×	5e-06	KRT1, KRT10
intermediate filament organization	2	240.7×	7e-05	KRT1, KRT10
positive regulation of epidermis development	1	1685.2×	0.002	KRT10
complement activation, lectin pathway	1	842.6×	0.003	KRT1
fibrinolysis	1	421.3×	0.005	KRT1
establishment of skin barrier	1	227.7×	0.008	KRT1
regulation of angiogenesis	1	210.7×	0.008	KRT1
morphogenesis of an epithelium	1	172.0×	0.008	KRT10
keratinocyte differentiation	1	123.9×	0.010	KRT10
keratinization	1	117.0×	0.010	KRT1
negative regulation of inflammatory response	1	68.5×	0.015	KRT1
response to oxidative stress	1	65.3×	0.015	KRT1

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 3

Druggability breadth: 0 of 3 evidence-associated genes (0%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
KRT1	0	0
KRT10	0	0
KRT10-AS1	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Pharmacogenomics

Cohort genes with a PharmGKB record: 2; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	3	KRT1, KRT10, KRT10-AS1

Undrugged target profiles

3 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
KRT1	0	—
KRT10	0	—
KRT10-AS1	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.