Atopic conjunctivitis
diseaseOn this page
Also known as allergic conjunctivitisallergic conjunctivitis (disease)allergic form of conjunctivitis (disease)
Summary
Atopic conjunctivitis (MONDO:0005642) is a disease with 35 GWAS associations across 7 studies and 139 clinical trials. Top therapeutic interventions include olopatadine, ketotifen, and bepotastine. A subtype of chronic conjunctivitis — broader associated-gene and molecular evidence is on the parent page (see Disease family below).
At a glance
- GWAS associations: 35
- Clinical trials: 139
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | atopic conjunctivitis |
| Mondo ID | MONDO:0005642 |
| EFO | EFO:0007141 |
| DOID | DOID:11204 |
| NCIT | C34506 |
| SNOMED CT | 473460002 |
| UMLS | C0009766 |
| MedGen | 3590 |
| Is cancer (heuristic) | no |
Also known as: allergic conjunctivitis · allergic conjunctivitis (disease) · allergic form of conjunctivitis (disease) · Atopic conjunctivitis
Data availability: 35 GWAS associations (7 studies) · 1 HPO phenotype.
Disease family
This is a subtype of chronic conjunctivitis. Genetic, therapeutic, and trial evidence is largely curated at the broader-term level — see the parent page for the associated-gene cohort and molecular evidence.
Classification path: disease › human disease › disease by body system or component › disorder of orbital region › eye adnexa disorder › conjunctival disorder › conjunctivitis › chronic conjunctivitis › atopic conjunctivitis
Related subtypes (4): chronic follicular conjunctivitis, parasitic conjunctivitis, vernal conjunctivitis, simple chronic conjunctivitis
Subtypes (1): Angelucci syndrome
Genetics & variants
GWAS landscape
35 GWAS associations across 7 studies. Top hits map to 24 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|---|---|---|---|
| rs5743618 | 2e-25 | TLR1 | A | 0.91 |
| rs72823641 | 4e-22 | IL18R1, IL1RL1 | A | 0.91 |
| rs7936312 | 4e-16 | EMSY - LINC02757 | T | 1.06 |
| rs62404084 | 2e-15 | HLA-DQA1 | T | 0.93 |
| rs2508569 | 2e-15 | DDX6 - COX7CP3 | G | 1.06 |
| rs891058 | 3e-15 | LINC00299 | A | 0.94 |
| rs7688384 | 4e-15 | BLTP1 | T | 0.94 |
| rs79881201 | 3e-14 | TSLP - WDR36 | T | 1.06 |
| rs73390208 | 1e-12 | HLA-B | T | 0.94 |
| rs9923856 | 2e-12 | CLEC16A | C | 0.95 |
| rs13279820 | 3e-12 | MYC - PVT1 | C | 0.95 |
| rs7714574 | 4e-12 | RNU1-150P - TTC33 | T | 1.05 |
| rs34290285 | 5e-11 | D2HGDH | A | 0.95 |
| rs12645469 | 6e-11 | NFKB1 - MANBA | A | 0.95 |
| rs12440045 | 7e-11 | RTF1 - ITPKA | C | 1.05 |
| rs7624084 | 9e-11 | ZBTB38 | C | 1.05 |
| rs6881706 | 1e-10 | IL7R | T | 0.95 |
| rs9378774 | 1e-10 | DUSP22 - IRF4 | G | 1.04 |
| rs6691738 | 2e-10 | TNFSF4 | G | 1.05 |
| rs558269137 | 8e-10 | CCDST, FLG | C | 1.21 |
| rs4031435 | 1e-09 | IQGAP1 | C | 0.96 |
| rs190653364 | 2e-09 | OR9K2 - OR9R1P | A | 1.33 |
| rs151077709 | 5e-09 | RANBP6 - GTF3AP1 | TAAAC | 1.06 |
| rs36005199 | 8e-09 | RNU7-97P - ATP6V0A1 | G | 0.96 |
| rs13272105 | 1e-08 | RPL13AP18 - RNU6-1213P | A | 0.95 |
| rs61839660 | 1e-08 | IL2RA | T | 1.09 |
| rs9911533 | 1e-08 | CCR7 - SMARCE1 | T | 1.04 |
| rs10714023 | 1e-08 | NFAT5 | G | 0.96 |
| rs79279599 | 2e-08 | CIR1P2 - RN7SL808P | ? | |
| rs2614276 | 2e-08 | AHI1 | C | 0.96 |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|---|---|---|---|---|
| GCST90832981 | Koskimaki F | 2025 | 45,734 | 1,084,159 | Characterization of genetic loci associated with allergic conjunctivitis. |
| GCST90477740 | Verma A | 2024 | 8,602 | 429,569 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90477739 | Verma A | 2024 | 3,646 | 113,405 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90481126 | Verma A | 2024 | 3,646 | 113,405 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90651540 | Liu TY | 2025 | 1,708 | 217,632 | Diversity and longitudinal records: Genetic architecture of disease associations and polygenic risk in the Taiwanese Han population. |
| GCST90477738 | Verma A | 2024 | 1,530 | 56,069 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90481928 | Verma A | 2024 | 232 | 6,321 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|---|
| Tier 1: coding | 2 |
| Tier 2: splice/UTR | 2 |
| Tier 3: regulatory | 4 |
| Tier 4: intronic/intergenic | 27 |
MAF distribution
| Bucket | Variants |
|---|---|
| common (>=0.05) | 31 |
| low_freq (0.01-0.05) | 2 |
| rare (<0.01) | 1 |
| unknown | 1 |
Functional consequences
| Consequence | Count |
|---|---|
| intron_variant | 19 |
| intergenic_variant | 6 |
| regulatory_region_variant | 4 |
| 3_prime_UTR_variant | 2 |
| missense_variant | 1 |
| synonymous_variant | 1 |
| non_coding_transcript_exon_variant | 1 |
| frameshift_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|---|---|---|---|---|---|---|---|
| rs5743618 | 4 | 38797027 | C>A,G | 0.153 | missense_variant | TLR1 | 2e-25 | Tier 1: coding |
| rs72823641 | 2 | 102319699 | T>A,C | 0.159 | intron_variant | IL18R1, IL1RL1 | 4e-22 | Tier 4: intronic/intergenic |
| rs7936312 | 11 | 76582682 | G>C,T | 0.414 | intergenic_variant | EMSY - LINC02757 | 4e-16 | Tier 4: intronic/intergenic |
| rs62404084 | 6 | 32635544 | C>T | 0.294 | intergenic_variant | HLA-DQA1 | 2e-15 | Tier 4: intronic/intergenic |
| rs2508569 | 11 | 118809336 | C>G | 0.315 | intergenic_variant | DDX6 - COX7CP3 | 2e-15 | Tier 4: intronic/intergenic |
| rs891058 | 2 | 8302417 | G>A | 0.346 | regulatory_region_variant | LINC00299 | 3e-15 | Tier 3: regulatory |
| rs7688384 | 4 | 122307977 | C>G,T | 0.311 | synonymous_variant | BLTP1 | 4e-15 | Tier 4: intronic/intergenic |
| rs79881201 | 5 | 111092097 | C>A,T | 0.311 | non_coding_transcript_exon_variant | TSLP - WDR36 | 3e-14 | Tier 4: intronic/intergenic |
| rs73390208 | 6 | 31358354 | C>A,T | 0.307 | intron_variant | HLA-B | 1e-12 | Tier 4: intronic/intergenic |
| rs9923856 | 16 | 11116558 | T>C | 0.265 | intron_variant | CLEC16A | 2e-12 | Tier 4: intronic/intergenic |
| rs13279820 | 8 | 127765520 | T>A,C,G | 0.271 | intergenic_variant | MYC - PVT1 | 3e-12 | Tier 4: intronic/intergenic |
| rs7714574 | 5 | 40492553 | C>A,G,T | 0.489 | intron_variant | RNU1-150P - TTC33 | 4e-12 | Tier 4: intronic/intergenic |
| rs34290285 | 2 | 241759225 | G>A | 0.216 | intron_variant | D2HGDH | 5e-11 | Tier 4: intronic/intergenic |
| rs12645469 | 4 | 102625698 | G>A,C | 0.298 | regulatory_region_variant | NFKB1 - MANBA | 6e-11 | Tier 3: regulatory |
| rs12440045 | 15 | 41490486 | A>C,G | 0.482 | regulatory_region_variant | RTF1 - ITPKA | 7e-11 | Tier 3: regulatory |
| rs7624084 | 3 | 141374443 | T>C | 0.446 | intron_variant | ZBTB38 | 9e-11 | Tier 4: intronic/intergenic |
| rs6881706 | 5 | 35879054 | G>C,T | 0.331 | 3_prime_UTR_variant | IL7R | 1e-10 | Tier 2: splice/UTR |
| rs9378774 | 6 | 382897 | A>G,T | 0.367 | intron_variant | DUSP22 - IRF4 | 1e-10 | Tier 4: intronic/intergenic |
| rs6691738 | 1 | 173182897 | T>G | 0.3 | intron_variant | TNFSF4 | 2e-10 | Tier 4: intronic/intergenic |
| rs558269137 | 1 | 152312601 | CACTG>C | 0.014 | frameshift_variant | CCDST, FLG | 8e-10 | Tier 1: coding |
| rs4031435 | 15 | 90472334 | G>A,C | 0.328 | intron_variant | IQGAP1 | 1e-09 | Tier 4: intronic/intergenic |
| rs190653364 | 12 | 55156742 | G>A | 0.006 | intergenic_variant | OR9K2 - OR9R1P | 2e-09 | Tier 4: intronic/intergenic |
| rs151077709 | 9 | 6091478 | TAAACAAAC>T,TAAAC,TAAACAAACAAAC,TAAACAAACAAACAAAC,TAAACAAACAAACAAACAAAC | 0.228 | intergenic_variant | RANBP6 - GTF3AP1 | 5e-09 | Tier 4: intronic/intergenic |
| rs36005199 | 17 | 42445537 | A>G | 0.286 | intron_variant | RNU7-97P - ATP6V0A1 | 8e-09 | Tier 4: intronic/intergenic |
| rs13272105 | 8 | 80384604 | C>A | 0.345 | intron_variant | RPL13AP18 - RNU6-1213P | 1e-08 | Tier 4: intronic/intergenic |
| rs61839660 | 10 | 6052734 | C>T | 0.041 | intron_variant | IL2RA | 1e-08 | Tier 4: intronic/intergenic |
| rs9911533 | 17 | 40619224 | C>A,G,T | 0.394 | regulatory_region_variant | CCR7 - SMARCE1 | 1e-08 | Tier 3: regulatory |
| rs10714023 | 16 | 69702648 | GCC>G,GC | 0.257 | 3_prime_UTR_variant | NFAT5 | 1e-08 | Tier 2: splice/UTR |
| rs79279599 | 4 | 114728111 | C>G,T | intron_variant | CIR1P2 - RN7SL808P | 2e-08 | Tier 4: intronic/intergenic | |
| rs2614276 | 6 | 135360566 | T>A,C,G | 0.386 | intron_variant | AHI1 | 2e-08 | Tier 4: intronic/intergenic |
Genes & proteins
No associated-gene cohort resolved for this disease. Atlas builds the molecular and therapeutic sections — associated genes, protein families, druggability, pathways, interactions, and drug associations — by aggregating over a disease’s associated genes (resolved via GWAS / GenCC / ClinVar / CIViC), and none resolved here. This is expected for antibody-mediated, autoimmune, or otherwise non-gene-defined conditions; the curated evidence for this disease is its clinical features, GWAS susceptibility, and clinical trials (above).
Function
No pathway enrichment — requires an associated-gene cohort.
Therapeutics
Drugs indicated for this disease
8 approved, 12 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
| Drug | Development status |
|---|---|
| Alcaftadine | Approved (phase 4) |
| Dexamethasone | Approved (phase 4) |
| Hydrocortisone | Approved (phase 4) |
| Loteprednol Etabonate | Approved (phase 4) |
| Prednisolone | Approved (phase 4) |
| Prednisolone Acetate | Approved (phase 4) |
| Prednisone | Approved (phase 4) |
| Tobramycin | Approved (phase 4) |
| Bepotastine | Phase 3 (in late-stage trials) |
| Bilastine | Phase 3 (in late-stage trials) |
| Bromfenac | Phase 3 (in late-stage trials) |
| Cetirizine | Phase 3 (in late-stage trials) |
| Cyclosporine | Phase 3 (in late-stage trials) |
| Desloratadine | Phase 3 (in late-stage trials) |
| Glycerin | Phase 3 (in late-stage trials) |
| Isunakinra | Phase 3 (in late-stage trials) |
| Ketotifen | Phase 3 (in late-stage trials) |
| Naphazoline | Phase 3 (in late-stage trials) |
| Olopatadine | Phase 3 (in late-stage trials) |
| Reproxalap | Phase 3 (in late-stage trials) |
Earlier-phase candidates (phase 2, investigational — efficacy not yet established): Aldesleukin, Artesunate, Cholecalciferol, Dupilumab, Lifitegrast, Mapracorat, Pyronaridine, Sodium Chloride, Tacrolimus Anhydrous.
Clinical trials & evidence
Clinical trials
Clinical trials: 139.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| PHASE3 | 47 |
| PHASE2 | 32 |
| PHASE4 | 30 |
| Not specified | 21 |
| PHASE1 | 5 |
| PHASE2/PHASE3 | 2 |
| PHASE1/PHASE2 | 2 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT00276445 | PHASE4 | TERMINATED | Alleviation of Cedar Pollen Induced Allergic Symptoms by Orally Taken Superfine Beta-1,3-Glucan |
| NCT00389025 | PHASE4 | COMPLETED | Mast-Cell Stabilizing Effects of Olopatadine |
| NCT00489398 | PHASE4 | WITHDRAWN | Comparison of CL Wear Between Two Allergy Drops |
| NCT00534794 | PHASE4 | COMPLETED | Study of Two Marketed Ocular Anti-Allergy Medications in Subjects With Allergic Conjunctivitis |
| NCT00559546 | PHASE4 | COMPLETED | Montelukast as a Controller of Atopic Syndrome |
| NCT00689078 | PHASE4 | COMPLETED | Evaluation of the Efficacy of Topical Ophthalmic Steroids in a Modified Conjunctival Allergen Challenge (CAC) Model |
| NCT00818805 | PHASE4 | COMPLETED | Efficacy Investigation Study of Olopatadine Hydrochloride Ophthalmic Solution Using OHIO Chamber in Patients With Seasonal Allergic Rhinitis (SAR) |
| NCT01109485 | PHASE4 | COMPLETED | Clinical Evaluation of 0.1% Olopatadine Hydrochloride Ophthalmic Solution in Pediatric Patients |
| NCT01119287 | PHASE4 | COMPLETED | Assessing the Efficacy of Maxidex® and Patanol® for the Treatment of Allergic Conjunctivitis |
| NCT01159769 | PHASE4 | COMPLETED | Patient Perceptions and Quality of Life Associated With the Use of Olapatadine 0.2% for the Treatment of Allergic Conjunctivitis |
| NCT01203540 | PHASE4 | COMPLETED | Evaluation of the Effect and Tolerance of Preservative Free NAAGA on the Inflammatory Component and Symptoms of Dry Eye Syndrome in Allergic Conjunctivitis Patients |
| NCT01272089 | PHASE4 | COMPLETED | A Study of Patient Perception and Quality of Life Associated With the Use of Olopatadine 0.2% in Subjects With Allergic Conjunctivitis |
| NCT01282138 | PHASE4 | COMPLETED | Assessment of Alcon’s Ocular Image Quantification System |
| NCT01294969 | PHASE4 | COMPLETED | Patient Perception Study for AL-4943A |
| NCT01337557 | PHASE4 | UNKNOWN | Use of BEPREVE (Bepotastine Besilate Ophthalmic Solution) 1.5% for Allergic Conjunctivitis and Contact Lenses |
| NCT01346371 | PHASE4 | COMPLETED | The Effect of BEPREVE 1.5% on Tear Film Osmolarity and Tear Film Lipid Layer |
| NCT01390961 | PHASE4 | UNKNOWN | Comparison of Tolerability Between Two Allergy Drops |
| NCT01439815 | PHASE4 | COMPLETED | An Allergen BioCube (ABC) Study Evaluating the Efficacy of Fluticasone Propionate Nasal Spray Compared to Placebo |
| NCT01443442 | PHASE4 | COMPLETED | Bepreve vs. Alrex in Subjects With Moderate to Severe Allergic Conjunctivitis |
| NCT01534195 | PHASE4 | COMPLETED | Evaluation of the Efficacy of Topical Ophthalmic Steroids in a Modified Conjunctival Allergen Challenge (CAC) Model |
| NCT01697969 | PHASE4 | COMPLETED | Confocal Analysis of Corneal Structures of Symptomatic Allergic Conjunctivitis Patients |
| NCT01730872 | PHASE4 | COMPLETED | Evaluation of Prednisolone in a Modified Conjunctival Allergen Challenge Model |
| NCT01808768 | PHASE4 | UNKNOWN | Ocular Allergy Treatment Practical Impact Trial |
| NCT02251613 | PHASE4 | COMPLETED | Effectiveness of Olopatadine HCl Ophthalmic Solution for the Treatment of Allergic Conjunctivitis in Japan |
| NCT02308501 | PHASE4 | COMPLETED | A Single-Center Evaluation of the Anti-Inflammatory Effects of Lastacaft as Measured by In-Vivo Confocal Microscopy |
| NCT03862053 | PHASE4 | WITHDRAWN | Manuka Eye Droops for Treatment of Allergy |
| NCT04776096 | PHASE4 | COMPLETED | Efficacy and Toxicity of Bepotastine 1,5% PF vs Olopatadine 0,2% With BAK on Allergic Conjunctivitis Treatment |
| NCT05265910 | PHASE4 | COMPLETED | A Study Comparing the Efficacy of Pataday® Once Daily Relief Extra Strength to Claritin® Tablets 24-Hour in Subjects With Allergic Conjunctivitis |
| NCT05314621 | PHASE4 | COMPLETED | A Study Comparing the Efficacy of Pataday® Once Daily Relief Extra Strength to Flonase® Allergy Relief in Subjects With Allergic Conjunctivitis |
| NCT06800274 | PHASE4 | COMPLETED | Clinical and Biological Evaluation of NAAGA Versus Azelastine Eye Drops in Allergic Subjects With Tear Film Dysfunction |
| NCT07309432 | PHASE3 | RECRUITING | Study of Bet v1 Antibodies Effect on Eye Allergy Symptoms in Adolescents and Adults With Birch Pollen Allergy |
| NCT00241319 | PHASE3 | COMPLETED | Evaluation of Efficacy of Ophthalmic Solution in Induced Acute Allergic Conjunctivitis |
| NCT00244543 | PHASE3 | COMPLETED | Evaluation of Efficacy of Ophthalmic Solution in Induced Allergic Conjunctivitis |
| NCT00298337 | PHASE2/PHASE3 | UNKNOWN | Use of Probiotic Bacteria in Prevention of Allergic Disease in Children 1999-2008 |
| NCT00331500 | PHASE3 | COMPLETED | Olopatadine 0.2% for the Treatment of Allergic Conjunctivitis |
| NCT00364091 | PHASE3 | COMPLETED | Evaluation of Efficacy of Ophthalmic Solution in Seasonal Allergic Conjunctivitis |
| NCT00423007 | PHASE3 | COMPLETED | Efficacy and Safety of Topical Bromfenac Ophthalmic Solution vs. Placebo in Subjects With Allergic Conjunctivitis |
| NCT00432757 | PHASE3 | COMPLETED | Evaluation of Efficacy and Safety of an Anti-Allergy Drug With a Contact Lens in Allergic Conjunctivitis |
| NCT00445874 | PHASE3 | COMPLETED | Evaluation of Efficacy and Safety of an Anti-Allergy Drug With a Contact Lens in the Treatment of Allergic Conjunctivitis |
| NCT00569777 | PHASE3 | COMPLETED | Safety Study of a Contact Lens With Ketotifen in Healthy, Normal Volunteers |
Drugs tested across these trials (top 30)
| Molecule | Max phase | Trials referencing |
|---|---|---|
| OLOPATADINE | 4 | 49 |
| KETOTIFEN | 4 | 17 |
| BEPOTASTINE | 4 | 7 |
| CETIRIZINE | 4 | 4 |
| AZELASTINE | 4 | 3 |
| BILASTINE | 4 | 3 |
| BRIMONIDINE TARTRATE | 4 | 3 |
| EPINASTINE | 4 | 3 |
| MONTELUKAST | 4 | 3 |
| NAPHAZOLINE | 4 | 3 |
| OXYMETAZOLINE | 4 | 3 |
| PREDNISOLONE | 4 | 3 |
| ALCAFTADINE | 4 | 2 |
| HYPROMELLOSE | 4 | 2 |
| LOTEPREDNOL ETABONATE | 4 | 2 |
| BETAMETHASONE | 4 | 1 |
| BROMFENAC | 4 | 1 |
| DEXAMETHASONE | 4 | 1 |
| DEXAMETHASONE SODIUM PHOSPHATE | 4 | 1 |
| FLUTICASONE PROPIONATE | 4 | 1 |
| LIFITEGRAST | 4 | 1 |
| LORATADINE | 4 | 1 |
| DEXTRAN | 3 | 1 |
| FRENESLERBART | 3 | 1 |
| HONEY | 3 | 1 |
| ISUNAKINRA | 3 | 1 |
| MEVONLERBART | 3 | 1 |
| TRANILAST | 3 | 1 |
| DEXTRAN 1 | 2 | 1 |
| NAVAMEPENT | 2 | 1 |
Related Atlas pages
- Drugs: Olopatadine, Ketotifen, Bepotastine, Cetirizine, Azelastine, Bilastine, Brimonidine Tartrate, Epinastine, Montelukast, Naphazoline, Oxymetazoline, Prednisolone, Alcaftadine, Hypromellose, Loteprednol Etabonate, Betamethasone, Bromfenac, Dexamethasone, Dexamethasone Sodium Phosphate, Fluticasone Propionate, Lifitegrast, Loratadine, Dextran, Freneslerbart, Honey, Isunakinra, Mevonlerbart, Tranilast