Cartilage-hair hypoplasia

Summary

Cartilage-hair hypoplasia (MONDO:0009595) is a disease caused by RMRP (GenCC Definitive), with 2 cohort genes and 2 clinical trials.

At a glance

• Prevalence: >1 / 1000 (Specific population) [Orphanet-validated]
• Causal gene: RMRP (GenCC Definitive)
• Cohort genes: 2
• ClinVar variants: 393
• Phenotypes (HPO): 79
• Clinical trials: 2

Clinical features

Epidemiology

Prevalence records

2 prevalence record(s), Orphanet:

Type	Class	Value	Geography	Validation
Point prevalence	>1 / 1000	150	Specific population	Validated
Prevalence at birth	1-9 / 100 000	4.34	Finland	Validated

Signs & symptoms

Clinical features (HPO)

79 HPO clinical features (Orphanet curated; top 50 by frequency):

HPO ID	Term	Frequency
HP:0000444	Convex nasal ridge	Very frequent (80-99%)
HP:0000470	Short neck	Very frequent (80-99%)
HP:0000486	Strabismus	Very frequent (80-99%)
HP:0000505	Visual impairment	Very frequent (80-99%)
HP:0000592	Blue sclerae	Very frequent (80-99%)
HP:0000940	Abnormal diaphysis morphology	Very frequent (80-99%)
HP:0000944	Abnormal metaphysis morphology	Very frequent (80-99%)
HP:0001252	Hypotonia	Very frequent (80-99%)
HP:0001377	Limited elbow extension	Very frequent (80-99%)
HP:0001508	Failure to thrive	Very frequent (80-99%)
HP:0001638	Cardiomyopathy	Very frequent (80-99%)
HP:0001671	Abnormal cardiac septum morphology	Very frequent (80-99%)
HP:0001732	Abnormality of the pancreas	Very frequent (80-99%)
HP:0001875	Decreased total neutrophil count	Very frequent (80-99%)
HP:0002093	Respiratory insufficiency	Very frequent (80-99%)
HP:0002353	EEG abnormality	Very frequent (80-99%)
HP:0002650	Scoliosis	Very frequent (80-99%)
HP:0002652	Skeletal dysplasia	Very frequent (80-99%)
HP:0002777	Tracheal stenosis	Very frequent (80-99%)
HP:0002901	Hypocalcemia	Very frequent (80-99%)
HP:0002982	Tibial bowing	Very frequent (80-99%)
HP:0002983	Micromelia	Very frequent (80-99%)
HP:0003027	Mesomelia	Very frequent (80-99%)
HP:0003307	Hyperlordosis	Very frequent (80-99%)
HP:0003312	Abnormal form of the vertebral bodies	Very frequent (80-99%)
HP:0004279	Short palm	Very frequent (80-99%)
HP:0004625	Biconvex vertebral bodies	Very frequent (80-99%)
HP:0005019	Diaphyseal thickening	Very frequent (80-99%)
HP:0005871	Metaphyseal chondrodysplasia	Very frequent (80-99%)
HP:0005930	Abnormality of epiphysis morphology	Very frequent (80-99%)
HP:0006487	Bowing of the long bones	Very frequent (80-99%)
HP:0007703	Abnormality of retinal pigmentation	Very frequent (80-99%)
HP:0008070	Sparse hair	Very frequent (80-99%)
HP:0008499	High hypermetropia	Very frequent (80-99%)
HP:0008873	Disproportionate short-limb short stature	Very frequent (80-99%)
HP:0008905	Rhizomelia	Very frequent (80-99%)
HP:0009832	Abnormal distal phalanx morphology of finger	Very frequent (80-99%)
HP:0010301	Spinal dysraphism	Very frequent (80-99%)
HP:0011849	Abnormal bone ossification	Very frequent (80-99%)
HP:0045075	Sparse eyebrow	Very frequent (80-99%)
HP:0100255	Metaphyseal dysplasia	Very frequent (80-99%)
HP:0100569	Abnormally ossified vertebrae	Very frequent (80-99%)
HP:0100729	Large face	Very frequent (80-99%)
HP:0000174	Abnormal palate morphology	Frequent (30-79%)
HP:0000212	Gingival overgrowth	Frequent (30-79%)
HP:0000545	Myopia	Frequent (30-79%)
HP:0000774	Narrow chest	Frequent (30-79%)
HP:0001315	Reduced tendon reflexes	Frequent (30-79%)
HP:0002024	Malabsorption	Frequent (30-79%)
HP:0003272	Abnormality of the hip bone	Frequent (30-79%)

Identifiers

Disease identifiers

Field	Value
Canonical name	cartilage-hair hypoplasia
Mondo ID	MONDO:0009595
MeSH	C535916
OMIM	250250
Orphanet	175
DOID	DOID:14773
ICD-11	469051294
NCIT	C61245
SNOMED CT	7720002
UMLS	C0220748
MedGen	67398
GARD	0006996
MedDRA	10069596
NORD	1414
Is cancer (heuristic)	no

Also known as: autosomal recessive metaphyseal chondrodysplasia · cartilage hair hypoplasia · cartilage hair hypoplasia like syndrome · cartilage-hair hypoplasia · CHH · McKusick Type Metaphyseal Chondrodysplasia · metaphyseal chondrodysplasia McKusick type · metaphyseal chondrodysplasia, McKusick type

Data availability: 393 ClinVar variants · 28 ClinGen variant curations · 4 GenCC gene-disease records · 8 cell lines.

Disease family

An umbrella term covering 1 Mondo subtype.

Classification path: disease › human disease › disease by body system or component › musculoskeletal system disorder › skeletal system disorder › cartilage-hair hypoplasia

Related subtypes (47): symphalangism, cartilage cancer, vertebral column disorder, patellar tendinitis, necrosis of ear ossicle, laryngeal cartilage cancer, ochronosis disorder, chondroma, periodontal disorder, posterior cranial fossa meningioma, anterior cranial fossa meningioma, middle cranial fossa meningioma, bone marrow disorder, cranial nodular fasciitis, flatfoot, bone disorder, skeletal tuberculosis, arthropathy, tooth disorder, primary basilar invagination, Brachymorphism-onychodysplasia-dysphalangism syndrome, cherubism, fibrodysplasia ossificans progressiva, Marfan syndrome, Buschke-Ollendorff syndrome, scalp defects-postaxial polydactyly syndrome, Teebi-Shaltout syndrome, short stature-auditory canal atresia-mandibular hypoplasia-skeletal anomalies syndrome, ossification of the posterior longitudinal ligament of the spine, temtamy preaxial brachydactyly syndrome, metaphyseal undermodeling, spondylar dysplasia, and overgrowth, Al-Gazali syndrome, brachydactyly-syndactyly syndrome, endocrine-cerebro-osteodysplasia syndrome, metaphyseal chondromatosis with D-2-hydroxyglutaric aciduria, multiple congenital anomalies-hypotonia-seizures syndrome 3, Rienhoff syndrome, Coffin-Siris syndrome, microcephaly-brachydactyly-kyphoscoliosis syndrome, cartilage development disorder, syndactyly, polydactyly, brachydactyly, sternal neoplasm, short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis, skeletal ligament disorder, brachydactyly-syndactyly-oligodactyly syndrome

Subtypes (1): metaphyseal dysplasia without hypotrichosis

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

393 retrieved; paginated sample, class counts are floors:

176 uncertain significance, 84 likely pathogenic, 65 pathogenic/likely pathogenic, 38 pathogenic, 15 conflicting classifications of pathogenicity, 7 likely benign, 6 benign, 2 benign/likely benign

ClinVar	Variant (HGVS)	Gene	Classification	Review
14208	NR_003051.4(RMRP):n.72A>G	CCDC107	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1065953	NR_003051.3(RMRP):n.-20_-5dupCTCTGTGAAGCTGAGG	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1066998	NR_003051.3(RMRP):n.-20_-12dup	RMRP	Pathogenic	criteria provided, single submitter
1067141	NR_003051.3(RMRP):n.-20_-1dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067265	NR_003051.3(RMRP):n.-10_-9insACTACTCTGTGAAGCACTACTCTGTGAAGC	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067429	NR_003051.4(RMRP):n.129G>A	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067465	NR_003051.3(RMRP):n.-9_-8insACTCTGTGAAGCTACTCTGTGAAGCT	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1067503	NR_003051.3(RMRP):n.-15_1dupTGAAGCTGAGGACGTG	RMRP	Pathogenic	criteria provided, multiple submitters, no conflicts
1068099	NR_003051.3(RMRP):n.-21_-1dupACTCTGTGAAGCTGAGGACGT	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1299143	NR_003051.3(RMRP):n.-14_-4dupGAAGCTGAGGA	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1354353	NR_003051.3(RMRP):n.-9_-8insACTCTGTGAAGCTACTCTGTGAAGCTACTCTGTGAAGCT	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1371602	NR_003051.3(RMRP):n.-23_-12dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1397735	NR_003051.3(RMRP):n.-16_-2dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
14209	NR_003051.4(RMRP):n.264G>T	RMRP	Pathogenic	reviewed by expert panel
14210	NR_003051.3(RMRP):n.-22_-13dup10	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
14211	NR_003051.3(RMRP):n.-24_-10dup15	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
14213	NC_000009.12:g.35658028_35658029insGCTCAG	RMRP	Pathogenic	no assertion criteria provided
14214	NR_003051.4(RMRP):n.-18_-2dup	RMRP	Pathogenic	criteria provided, multiple submitters, no conflicts
14219	NR_003051.3(RMRP):n.-8_-7ins17	RMRP	Pathogenic	criteria provided, single submitter
14221	NC_000009.12:g.35658018_35658034dup	RMRP	Pathogenic	reviewed by expert panel
14223	NR_003051.4(RMRP):n.196dup	RMRP	Pathogenic	criteria provided, single submitter
1426407	NR_003051.4(RMRP):n.94dup	RMRP	Pathogenic	criteria provided, multiple submitters, no conflicts
1454053	NR_003051.3(RMRP):n.-22_1dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1454754	NR_003051.4(RMRP):n.-24_-3dup	RMRP	Pathogenic	reviewed by expert panel
1457701	NC_000009.12:g.35658018_35658041dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1458333	NR_003051.3(RMRP):n.-24_-7dupACTACTCTGTGAAGCTGA	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1696063	NC_000009.12:g.35658023CCTCAGCTTCACAGAGT[3]	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1723424	NC_000009.12:g.35658024_35658038dup	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
189086	NR_003051.3(RMRP):n.64C>T	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1919642	NR_003051.3(RMRP):n.-8_-7insTGAAGCTGTGAAGCTG	RMRP	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 4 · Orphanet: 3 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
RMRP	Definitive	Autosomal recessive	cartilage-hair hypoplasia	4

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
RMRP	Orphanet:175	Cartilage-hair hypoplasia
RMRP	Orphanet:39041	Omenn syndrome
RMRP	Orphanet:93347	Anauxetic dysplasia

Cohort genes → proteins

2 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	2

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
RMRP	HGNC:10031	ENSG00000277027		RNA component of mitochondrial RNA processing endoribonuclease	gencc,clinvar
CCDC107	HGNC:28465	ENSG00000159884	Q8WV48	Coiled-coil domain-containing protein 107	clinvar

Protein-family classification

Druggable: 0 · Difficult: 0 · Unknown: 2 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Other/Unknown	2	1.8×	0.312

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
RMRP	Other/Unknown	no
CCDC107	Other/Unknown	no		CCDC107

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	2
unknown	0

Top tissues across cohort

Tissue	Cohort genes
bone marrow cell	1
colonic epithelium	1
corpus callosum	1
aorta	1
popliteal artery	1
tibial artery	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
RMRP	128	ubiquitous	yes	corpus callosum, colonic epithelium, bone marrow cell
CCDC107	254	ubiquitous	marker	popliteal artery, tibial artery, aorta

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
CCDC107	1,093
RMRP	0

Structural data

PDB: 0 · AlphaFold-only: 1 · No structure: 1

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
CCDC107	Q8WV48	61.31

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 0. Enrichment computed across 2 evidence-associated genes (0 with Reactome annotation).

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 2

Druggability breadth: 0 of 2 evidence-associated genes (0%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
RMRP	0	0
CCDC107	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Pharmacogenomics

Cohort genes with a PharmGKB record: 2; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	2	RMRP, CCDC107

Undrugged target profiles

2 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
RMRP	0	—
CCDC107	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 2.

Phase distribution (across all retrieved trials)

Phase	Trials
PHASE4	1
Not specified	1

Top trials by phase / activity

NCT	Phase	Status	Title
NCT02383797	PHASE4	UNKNOWN	Immunodeficiency in Cartilage-hair Hypoplasia: Sub-project on Safety of Vaccination Against Chickenpox
NCT05058781	Not specified	RECRUITING	Minipuberty in Infants Born With Potential Hypogonadism Hypogonadotrope