Charcot-Marie-Tooth disease axonal type 2CC

Summary

Charcot-Marie-Tooth disease axonal type 2CC (MONDO:0014836) is a disease caused by NEFH (GenCC Definitive), with 1 cohort gene.

At a glance

• Causal gene: NEFH (GenCC Definitive)
• Cohort genes: 1
• ClinVar variants: 35

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	Charcot-Marie-Tooth disease axonal type 2CC
Mondo ID	MONDO:0014836
OMIM	616924
DOID	DOID:0110180
UMLS	C4310790
MedGen	934757
GARD	0025022
Is cancer (heuristic)	no

Also known as: Charcot-Marie-Tooth disease axonal type 2CC · Charcot-Marie-Tooth disease caused by mutation in NEFH · Charcot-Marie-Tooth disease, axonal, type 2cc · CMT2CC · NEFH Charcot-Marie-Tooth disease

Data availability: 35 ClinVar variants · 3 GenCC gene-disease records.

Disease family

Classification path: disease › human disease › disease by body system or component › nervous system disorder › peripheral nervous system disorder › peripheral neuropathy › hereditary peripheral neuropathy › Charcot-Marie-Tooth disease › Charcot-Marie-Tooth disease type 2 › Charcot-Marie-Tooth disease axonal type 2CC

Related subtypes (37): Charcot-Marie-Tooth disease type 2A1, Charcot-Marie-Tooth disease type 2B, Charcot-Marie-Tooth disease type 2D, Charcot-Marie-Tooth disease type 2B1, Charcot-Marie-Tooth disease type 2B2, Charcot-Marie-Tooth disease axonal type 2C, Charcot-Marie-Tooth disease axonal type 2F, Charcot-Marie-Tooth disease type 2I, Charcot-Marie-Tooth disease type 2E, Charcot-Marie-Tooth disease axonal type 2H, Charcot-Marie-Tooth disease type 2J, Charcot-Marie-Tooth disease axonal type 2K, Charcot-Marie-Tooth disease axonal type 2L, Charcot-Marie-Tooth disease type 2A2, giant axonal neuropathy 2, Charcot-Marie-Tooth disease axonal type 2N, Charcot-Marie-Tooth disease axonal type 2O, Charcot-Marie-Tooth disease axonal type 2P, Charcot-Marie-Tooth disease axonal type 2Q, Charcot-Marie-Tooth disease type 2R, Charcot-Marie-Tooth disease axonal type 2S, Charcot-Marie-Tooth disease axonal type 2U, Charcot-Marie-Tooth disease axonal type 2V, autosomal dominant Charcot-Marie-Tooth disease type 2W, Charcot-Marie-Tooth disease axonal type 2X, Charcot-Marie-Tooth disease type 2Y, Charcot-Marie-Tooth disease axonal type 2Z, autosomal dominant Charcot-Marie-Tooth disease type 2M, Charcot-Marie-Tooth disease type 2B5, autosomal dominant Charcot-Marie-Tooth disease type 2 due to KIF5A mutation, autosomal dominant Charcot-Marie-Tooth disease type 2 due to TFG mutation, autosomal dominant Charcot-Marie-Tooth disease type 2K, Charcot-Marie-Tooth disease, axonal, type 2EE, autosomal dominant charcot-marie-tooth disease type 2 due to DGAT2 mutation, Charcot-Marie-Tooth disease type 2T, MME-related autosomal dominant Charcot Marie Tooth disease type 2, Charcot-Marie-tooth disease, axonal, type 2DD

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

35 retrieved; paginated sample, class counts are floors:

20 uncertain significance, 6 conflicting classifications of pathogenicity, 5 benign, 2 likely pathogenic, 1 pathogenic/likely pathogenic, 1 pathogenic

ClinVar	Variant (HGVS)	Gene	Classification	Review
225630	NM_021076.4(NEFH):c.3010_3011del (p.Asp1004fs)	NEFH	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
225631	NM_021076.4(NEFH):c.3017_3020dup (p.Pro1008fs)	NEFH	Pathogenic	no assertion criteria provided
2575892	NM_021076.4(NEFH):c.2752del (p.Glu918fs)	NEFH	Likely pathogenic	criteria provided, single submitter
4073457	NM_021076.4(NEFH):c.646_653del (p.Leu216fs)	NEFH	Likely pathogenic	no assertion criteria provided
1033974	NM_021076.4(NEFH):c.2327C>G (p.Ser776Cys)	NEFH	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1334022	NM_021076.4(NEFH):c.406C>T (p.Gln136Ter)	NEFH	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1400458	NM_021076.4(NEFH):c.1684C>G (p.Pro562Ala)	NEFH	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
546912	NM_021076.4(NEFH):c.1169A>C (p.Asn390Thr)	NEFH	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
66736	NM_021076.4(NEFH):c.1989_2006del (p.Glu664_Pro669del)	NEFH	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
809344	NM_021076.4(NEFH):c.1036C>T (p.Arg346Cys)	NEFH	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1033975	NM_021076.4(NEFH):c.25G>C (p.Ala9Pro)	NEFH	Uncertain significance	criteria provided, single submitter
1350059	NM_021076.4(NEFH):c.1346A>G (p.Lys449Arg)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
1382484	NM_021076.4(NEFH):c.760C>T (p.Gln254Ter)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
1424969	NM_021076.4(NEFH):c.764T>C (p.Met255Thr)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
1439890	NM_021076.4(NEFH):c.2891A>T (p.Lys964Met)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
1485781	NM_021076.4(NEFH):c.2396C>T (p.Ala799Val)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
1499447	NM_021076.4(NEFH):c.1209-2A>G	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
1504983	NM_021076.4(NEFH):c.1055G>A (p.Arg352His)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
1806246	NM_021076.4(NEFH):c.1095del (p.Gln365fs)	NEFH	Uncertain significance	criteria provided, single submitter
2175121	NM_021076.4(NEFH):c.1147C>T (p.Arg383Ter)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
2434321	NM_021076.4(NEFH):c.1516G>A (p.Ala506Thr)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
2434322	NM_021076.4(NEFH):c.2048C>T (p.Pro683Leu)	NEFH	Uncertain significance	criteria provided, single submitter
2434323	NM_021076.4(NEFH):c.337del (p.Asp113fs)	NEFH	Uncertain significance	criteria provided, single submitter
2434324	NM_021076.4(NEFH):c.2878G>A (p.Glu960Lys)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
2434325	NM_021076.4(NEFH):c.2369AGG[2] (p.Glu792del)	NEFH	Uncertain significance	criteria provided, multiple submitters, no conflicts
2691786	NM_021076.4(NEFH):c.1337T>C (p.Val446Ala)	NEFH	Uncertain significance	criteria provided, single submitter
3587876	NM_021076.4(NEFH):c.1216C>A (p.Leu406Met)	NEFH	Uncertain significance	criteria provided, single submitter
4073441	NM_021076.4(NEFH):c.884-1G>T	NEFH	Uncertain significance	criteria provided, single submitter
4292242	NM_021076.4(NEFH):c.2814dup (p.Lys939fs)	NEFH	Uncertain significance	criteria provided, single submitter
4687913	NM_021076.4(NEFH):c.2015CAGAAGCAAAGTCCCCTGAGAAGGCCAAGTCCCCAGTGAAGG[3] (p.Lys699_Glu700insAlaGluAlaLysSerProGluLysAlaLysSerProValLys)	NEFH	Uncertain significance	criteria provided, single submitter

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 4 · Orphanet: 1 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
NEFH	Definitive	Autosomal dominant	Charcot-Marie-Tooth disease axonal type 2CC	4

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
NEFH	Orphanet:803	Amyotrophic lateral sclerosis

Cohort genes → proteins

1 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
NEFH	HGNC:7737	ENSG00000100285	P12036	Neurofilament heavy polypeptide	gencc,clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
NEFH	Neurofilament heavy polypeptide	Neurofilaments usually contain three intermediate filament proteins: NEFL, NEFM, and NEFH which are involved in the maintenance of neuronal caliber.

Protein-family classification

Druggable: 0 · Difficult: 0 · Unknown: 1 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Other/Unknown	1	1.8×	0.558

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
NEFH	Other/Unknown	no		DUF1388, IF_conserved, IF_rod_dom

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	1
unknown	0

Top tissues across cohort

Tissue	Cohort genes
dorsal root ganglion	1
lateral nuclear group of thalamus	1
pons	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
NEFH	222	broad	marker	dorsal root ganglion, pons, lateral nuclear group of thalamus

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
NEFH	2,649

Structural data

PDB: 0 · AlphaFold-only: 1 · No structure: 0

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
NEFH	P12036	54.28

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 0. Enrichment computed across 1 evidence-associated genes (0 with Reactome annotation).

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
neurofilament bundle assembly	1	5617.3×	9e-04	NEFH
peripheral nervous system neuron axonogenesis	1	4213.0×	9e-04	NEFH
regulation of organelle transport along microtubule	1	4213.0×	9e-04	NEFH
intermediate filament bundle assembly	1	2808.7×	1e-03	NEFH
neurofilament cytoskeleton organization	1	1685.2×	0.001	NEFH
cell projection assembly	1	936.2×	0.002	NEFH
postsynaptic modulation of chemical synaptic transmission	1	674.1×	0.002	NEFH
axon development	1	455.5×	0.003	NEFH
axonogenesis	1	160.5×	0.007	NEFH
cellular response to leukemia inhibitory factor	1	159.0×	0.007	NEFH
microtubule cytoskeleton organization	1	121.2×	0.008	NEFH

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1

Druggability breadth: 0 of 1 evidence-associated genes (0%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
NEFH	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Pharmacogenomics

Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	1	NEFH

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
NEFH	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.