Chromosome 16q12 duplication syndrome

Summary

Chromosome 16q12 duplication syndrome (MONDO:0859210) is a disease with 3 cohort genes.

At a glance

• Cohort genes: 3
• ClinVar variants: 4

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	chromosome 16q12 duplication syndrome
Mondo ID	MONDO:0859210
OMIM	619649
UMLS	C5562082
MedGen	1794292
GARD	0026668
Is cancer (heuristic)	no

Data availability: 4 ClinVar variants.

Disease family

Classification path: disease › human disease › disease by etiologic mechanism › disease of genetic or genomic mechanism › chromosomal disorder › chromosome 16q12 duplication syndrome

Related subtypes (17): mosaic variegated aneuploidy syndrome, syndrome caused by partial chromosomal deletion, syndrome caused by partial chromosomal duplication, Prader-Willi syndrome, Silver-Russell syndrome, Bloom syndrome, duplication/inversion 15q11, polyploidy, autosomal anomaly, gonosome anomaly, FRAXD syndrome, chromosome inversion disorder, aneuploidy, uniparental disomy, ring chromosome disorder, chromosome Xq13 duplication syndrome, chromosome 1p36 deletion syndrome, proximal

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

4 retrieved; paginated sample, class counts are floors:

3 pathogenic, 1 likely pathogenic

ClinVar	Variant (HGVS)	Gene	Classification	Review
997023	NC_000016.10:g.54716967_54716968ins[54716967_55565004;AGCTAACAAGTAATACCTAACAGTTATTCAGC]		Pathogenic	no assertion criteria provided
997021	NC_000016.10:g.54893325_55501091dup	CRNDE	Pathogenic	no assertion criteria provided
997022	NC_000016.10:g.54801236_55533834dup	IRX6	Pathogenic	no assertion criteria provided
3255478	NC_000016.9:g.(?48799549)(70756330_?)dup	AARS1	Likely pathogenic	criteria provided, single submitter

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 0 · Orphanet: 3 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
AARS1	Orphanet:228174	Autosomal dominant Charcot-Marie-Tooth disease type 2N
AARS1	Orphanet:33364	Trichothiodystrophy
AARS1	Orphanet:442835	Non-specific early-onset epileptic encephalopathy

Cohort genes → proteins

3 cohort genes, 2 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	3

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
IRX6	HGNC:14675	ENSG00000159387	P78412	Iroquois-class homeodomain protein IRX-6	clinvar
AARS1	HGNC:20	ENSG00000090861	P49588	Alanine–tRNA ligase, cytoplasmic	clinvar
CRNDE	HGNC:37078	ENSG00000245694		colorectal neoplasia differentially expressed	clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
IRX6	Iroquois-class homeodomain protein IRX-6	Transcription factor.
AARS1	Alanine–tRNA ligase, cytoplasmic	Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala).

Protein-family classification

Druggable: 0 · Difficult: 1 · Unknown: 2 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Transcription factor	1	2.8×	0.587
Other/Unknown	2	1.2×	0.587

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
IRX6	Transcription factor	no		HD, Iroquois_homeo, KN_HD
AARS1	Other/Unknown	no		Ala-tRNA-lgiase_IIc, DHHA1_dom, Transl_B-barrel_sf
CRNDE	Other/Unknown	no

Expression context

Cohort genes with no expression data: 0.

3 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	3
unknown	0

Top tissues across cohort

Tissue	Cohort genes
apex of heart	1
hindlimb stylopod muscle	1
skin of abdomen	1
endometrium epithelium	1
frontal pole	1
type B pancreatic cell	1
bronchial epithelial cell	1
right testis	1
sperm	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
IRX6	95	tissue_specific	marker	apex of heart, skin of abdomen, hindlimb stylopod muscle
AARS1	301	ubiquitous	marker	endometrium epithelium, type B pancreatic cell, frontal pole
CRNDE	243	ubiquitous	marker	sperm, bronchial epithelial cell, right testis

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
AARS1	3,074
IRX6	1,533
CRNDE	0

Structural data

PDB: 1 · AlphaFold-only: 1 · No structure: 1

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
AARS1	P49588	6

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
IRX6	P78412	55.29

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 4. Enrichment computed across 3 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Cytosolic tRNA aminoacylation	1	439.2×	0.007	AARS1
tRNA Aminoacylation	1	285.5×	0.007	AARS1
Translation	1	62.1×	0.021	AARS1
Metabolism of proteins	1	12.4×	0.081	AARS1

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
regulation of cytoplasmic translational fidelity	1	8426.0×	0.002	AARS1
alanyl-tRNA aminoacylation	1	4213.0×	0.002	AARS1
cerebellar Purkinje cell layer development	1	766.0×	0.004	AARS1
negative regulation of signal transduction by p53 class mediator	1	601.9×	0.004	AARS1
positive regulation of hippo signaling	1	526.6×	0.004	AARS1
cell development	1	443.5×	0.004	IRX6
tRNA aminoacylation for protein translation	1	421.3×	0.004	AARS1
tRNA processing	1	421.3×	0.004	AARS1
tRNA modification	1	300.9×	0.006	AARS1
neuromuscular process controlling balance	1	165.2×	0.009	AARS1
neuron apoptotic process	1	92.6×	0.015	AARS1
negative regulation of neuron apoptotic process	1	55.4×	0.022	AARS1
neuron differentiation	1	50.1×	0.023	IRX6
positive regulation of DNA-templated transcription	1	14.0×	0.075	IRX6
regulation of transcription by RNA polymerase II	1	5.8×	0.164	IRX6

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 3

Druggability breadth: 1 of 3 evidence-associated genes (33%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
IRX6	0	0
AARS1	0	0
CRNDE	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
AARS1	2	Binding:2

Pharmacogenomics

Cohort genes with a PharmGKB record: 3; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	3	IRX6, AARS1, CRNDE

Undrugged target profiles

3 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
IRX6	0	—
AARS1	2	—
CRNDE	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.