Cirrhosis of liver
diseaseOn this page
Also known as cirrhosis
Summary
Cirrhosis of liver (MONDO:0005155) is a disease with 30 cohort genes (111 GWAS associations across 35 studies) and 542 clinical trials. Top therapeutic interventions include propranolol, albumin human, and carvedilol.
At a glance
- Cohort genes: 30
- GWAS associations: 111
- ClinVar variants: 5
- Clinical trials: 542
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | cirrhosis of liver |
| Mondo ID | MONDO:0005155 |
| EFO | EFO:0001422 |
| MeSH | D008103 |
| DOID | DOID:5082 |
| NCIT | C2951 |
| SNOMED CT | 19943007 |
| UMLS | C0023890 |
| MedGen | 7368 |
| Is cancer (heuristic) | no |
Also known as: cirrhosis
Data availability: 5 ClinVar variants · 111 GWAS associations (35 studies) · 18 cell lines.
Disease family
An umbrella term covering 3 Mondo subtypes.
Classification path: disease › human disease › disease by body system or component › digestive system disorder › hepatobiliary disorder › liver disorder › cirrhosis of liver
Related subtypes (31): polycystic echinococcosis, autosomal dominant polycystic liver disease, hepatorenal syndrome, hepatitis, hepatic vascular disorder, hepatic porphyria, hepatopulmonary syndrome, fatty liver disease, drug-induced liver injury, perinatal jaundice due to hepatocellular damage, Aagenaes syndrome, transient familial neonatal hyperbilirubinemia, hyperbiliverdinemia, transient infantile hypertriglyceridemia and hepatosteatosis, idiopathic copper-associated cirrhosis, familial intrahepatic cholestasis, bile duct cyst, nodular regenerative hyperplasia of the liver, hepatoportal sclerosis, primitive portal vein thrombosis, glycogen storage disease due to liver phosphorylase kinase deficiency, liver and intrahepatic bile duct neoplasm, alcoholic liver disease, early-onset familial noncirrhotic portal hypertension, liver failure, fibrotic liver disease, intestinal failure–associated liver disease, liver abscess (disease), membranous obstruction of inferior vena cava, liver disease, severe congenital, cystic fibrosis-related liver disease
Subtypes (3): hepatitis C induced liver cirrhosis, alcoholic liver cirrhosis, cirrhosis, familial
Genetics & variants
GWAS landscape
111 GWAS associations across 35 studies. Top hits map to 29 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|---|---|---|---|
| rs738409 | 2e-290 | PNPLA3 | G | |
| rs738408 | 1e-270 | PNPLA3 | T | 0.46 |
| rs58542926 | 3e-83 | TM6SF2 | T | |
| rs28929474 | 8e-56 | SERPINA1 | T | |
| rs6834314 | 3e-54 | KLHL8 - MIR5705 | G | |
| rs739846 | 3e-47 | SUGP1 | A | 0.3 |
| rs2642438 | 1e-43 | MTARC1 | A | |
| rs13056638 | 9e-34 | PNPLA3 | ? | |
| rs28636836 | 2e-29 | HSD17B13 | T | 0.14 |
| rs4803221 | 1e-25 | IFNL4 | C | 0.13 |
| rs112635299 | 1e-24 | SERPINA2 - SERPINA1 | G | 0.4 |
| rs2642439 | 6e-22 | MTARC1 | A | 0.12 |
| rs2896019 | 2e-20 | PNPLA3 | G | 2.02 |
| rs28746951 | 4e-18 | HLA-DQB1 - MTCO3P1 | G | 0.12 |
| rs3747207 | 3e-17 | PNPLA3 | G | 0.25 |
| rs671 | 1e-16 | ALDH2 | A | 0.28 |
| rs11735092 | 2e-16 | HSD17B13 | T | 0.1 |
| rs2001846 | 9e-16 | TRIB1 - TRIB1AL | T | 0.09 |
| rs483082 | 3e-14 | APOE - APOC1 | T | 0.1 |
| chr9:5073770 | 4e-14 | T | 9.59 | |
| rs5117 | 6e-14 | APOC1 | T | 0.1 |
| rs73004962 | 3e-13 | PBX4 | ? | 1.28 |
| rs78069066 | 1e-12 | MAPKAPK5, ADAM1A | A | 0.76 |
| rs12484700 | 1e-12 | PNPLA3 | G | 1.24 |
| rs6982502 | 2e-12 | TRIB1AL | C | 0.09 |
| rs59325138 | 1e-11 | APOE - APOC1 | C | 0.09 |
| rs3129943 | 2e-11 | TSBP1-AS1, TSBP1 | G | 0.2 |
| rs200663261 | 2e-11 | TSBP1-AS1 | CTACA | 0.19 |
| rs80215559 | 5e-11 | SLC17A2 | ? | 1.47 |
| rs4374383 | 1e-09 | MERTK | A |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|---|---|---|---|---|
| GCST90432139 | Jiang Y | 2023 | 116,382 | 213,325 | A cross-disorder study to identify causal relationships, shared genetic variants, and genes across 21 digestive disorders. |
| GCST90319877 | Ghouse J | 2024 | 15,225 | 1,564,786 | Integrative common and rare variant analyses provide insights into the genetic architecture of liver cirrhosis. |
| GCST90319878 | Ghouse J | 2024 | 15,225 | 1,564,786 | Integrative common and rare variant analyses provide insights into the genetic architecture of liver cirrhosis. |
| GCST90476086 | Verma A | 2024 | 13,367 | 433,864 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90478453 | Verma A | 2024 | 5,063 | 115,171 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90480337 | Verma A | 2024 | 5,063 | 115,171 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90651162 | Liu TY | 2025 | 3,794 | 217,650 | Diversity and longitudinal records: Genetic architecture of disease associations and polygenic risk in the Taiwanese Han population. |
| GCST90476085 | Verma A | 2024 | 2,679 | 56,567 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90018606 | Sakaue S | 2021 | 2,551 | 176,175 | A cross-population atlas of genetic associations for 220 human phenotypes. |
| GCST90013710 | Ishigaki K | 2020 | 2,184 | 210,269 | Large-scale genome-wide association study in a Japanese population identifies novel susceptibility loci across different diseases. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|---|
| Tier 1: coding | 6 |
| Tier 2: splice/UTR | 6 |
| Tier 3: regulatory | 1 |
| Tier 4: intronic/intergenic | 37 |
MAF distribution
| Bucket | Variants |
|---|---|
| common (>=0.05) | 46 |
| low_freq (0.01-0.05) | 2 |
| rare (<0.01) | 0 |
| unknown | 2 |
Functional consequences
| Consequence | Count |
|---|---|
| intron_variant | 26 |
| intergenic_variant | 7 |
| missense_variant | 5 |
| 3_prime_UTR_variant | 5 |
| non_coding_transcript_exon_variant | 2 |
| synonymous_variant | 1 |
| stop_gained | 1 |
| unknown | 1 |
| regulatory_region_variant | 1 |
| splice_donor_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|---|---|---|---|---|---|---|---|
| rs738409 | 22 | 43928847 | C>A,G,T | 0.23 | missense_variant | PNPLA3 | 2e-290 | Tier 1: coding |
| rs738408 | 22 | 43928850 | C>A,G,T | 0.05 | synonymous_variant | PNPLA3 | 1e-270 | Tier 4: intronic/intergenic |
| rs58542926 | 19 | 19268740 | C>A,T | 0.07 | stop_gained | TM6SF2 | 3e-83 | Tier 1: coding |
| rs28929474 | 14 | 94378610 | C>A,G,T | 0.02 | missense_variant | SERPINA1 | 8e-56 | Tier 1: coding |
| rs6834314 | 4 | 87292656 | A>G | 0.26 | intergenic_variant | KLHL8 - MIR5705 | 3e-54 | Tier 4: intronic/intergenic |
| rs739846 | 19 | 19308262 | G>A | 0.05 | intron_variant | SUGP1 | 3e-47 | Tier 4: intronic/intergenic |
| rs2642438 | 1 | 220796686 | A>C,G,T | 0.29 | missense_variant | MTARC1 | 1e-43 | Tier 1: coding |
| rs13056638 | 22 | 43935898 | C>A,G,T | 0.05 | intron_variant | PNPLA3 | 9e-34 | Tier 4: intronic/intergenic |
| rs28636836 | 4 | 87310713 | C>T | 0.05 | intron_variant | HSD17B13 | 2e-29 | Tier 4: intronic/intergenic |
| rs4803221 | 19 | 39248489 | C>G,T | 0.209 | missense_variant | IFNL4 | 1e-25 | Tier 1: coding |
| rs112635299 | 14 | 94371805 | G>A,C,T | 0.014 | intron_variant | SERPINA2 - SERPINA1 | 1e-24 | Tier 4: intronic/intergenic |
| rs2642439 | 1 | 220797157 | A>C,G,T | 0.05 | intron_variant | MTARC1 | 6e-22 | Tier 4: intronic/intergenic |
| rs2896019 | 22 | 43937814 | T>G | 0.45 | intron_variant | PNPLA3 | 2e-20 | Tier 4: intronic/intergenic |
| rs28746951 | 6 | 32685018 | G>A,C | 0.224 | intergenic_variant | HLA-DQB1 - MTCO3P1 | 4e-18 | Tier 4: intronic/intergenic |
| rs3747207 | 22 | 43928975 | G>A,C,T | 0.406 | intron_variant | PNPLA3 | 3e-17 | Tier 4: intronic/intergenic |
| rs671 | 12 | 111803962 | G>A | 0.247 | missense_variant | ALDH2 | 1e-16 | Tier 1: coding |
| rs11735092 | 4 | 87305079 | T>C | 0.426 | 3_prime_UTR_variant | HSD17B13 | 2e-16 | Tier 2: splice/UTR |
| rs2001846 | 8 | 125466208 | T>A,C,G | 0.428 | intergenic_variant | TRIB1 - TRIB1AL | 9e-16 | Tier 4: intronic/intergenic |
| rs483082 | 19 | 44912921 | G>T | 0.05 | non_coding_transcript_exon_variant | APOE - APOC1 | 3e-14 | Tier 4: intronic/intergenic |
| chr9:5073770 | 4e-14 | Tier 4: intronic/intergenic | ||||||
| rs5117 | 19 | 44915533 | T>A,C,G | 0.223 | intron_variant | APOC1 | 6e-14 | Tier 4: intronic/intergenic |
| rs73004962 | 19 | 19602260 | A>C,T | 0.05 | intron_variant | PBX4 | 3e-13 | Tier 4: intronic/intergenic |
| rs78069066 | 12 | 111900120 | G>A | 0.231 | 3_prime_UTR_variant | MAPKAPK5, ADAM1A | 1e-12 | Tier 2: splice/UTR |
| rs12484700 | 22 | 43931393 | A>C,G | 0.454 | intron_variant | PNPLA3 | 1e-12 | Tier 4: intronic/intergenic |
| rs6982502 | 8 | 125467120 | C>T | 0.491 | intron_variant | TRIB1AL | 2e-12 | Tier 4: intronic/intergenic |
| rs59325138 | 19 | 44913034 | C>G,T | 0.389 | non_coding_transcript_exon_variant | APOE - APOC1 | 1e-11 | Tier 4: intronic/intergenic |
| rs3129943 | 6 | 32370918 | A>G | 0.365 | intron_variant | TSBP1-AS1, TSBP1 | 2e-11 | Tier 4: intronic/intergenic |
| rs200663261 | 6 | 32276304 | CTACA>C,CTACATACA,CTACATACATACA,CTACATACATACATACA,CTACATACATACATACATACA,CTACATACATACATACATACATACA | 0.05 | intron_variant | TSBP1-AS1 | 2e-11 | Tier 4: intronic/intergenic |
| rs80215559 | 6 | 25917997 | T>C | 0.05 | intron_variant | SLC17A2 | 5e-11 | Tier 4: intronic/intergenic |
| rs4374383 | 2 | 112013193 | A>G | 0.42 | intron_variant | MERTK | 1e-09 | Tier 4: intronic/intergenic |
ClinVar germline variants
5 retrieved; paginated sample, class counts are floors:
5 pathogenic
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 545642 | NM_005687.5(FARSB):c.1381A>C (p.Thr461Pro) | FARSB | Pathogenic | criteria provided, single submitter |
| 545655 | NM_005687.5(FARSB):c.784A>G (p.Lys262Glu) | FARSB | Pathogenic | criteria provided, single submitter |
| 545664 | NM_005687.5(FARSB):c.1202G>A (p.Arg401Gln) | FARSB | Pathogenic | criteria provided, single submitter |
| 545694 | NM_005687.5(FARSB):c.755T>C (p.Phe252Ser) | FARSB | Pathogenic | no assertion criteria provided |
| 545695 | NM_005687.5(FARSB):c.226T>C (p.Cys76Arg) | FARSB | Pathogenic | criteria provided, single submitter |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 19 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| TULP1 | Orphanet:65 | Leber congenital amaurosis |
| TULP1 | Orphanet:791 | Retinitis pigmentosa |
| CACNA2D1 | Orphanet:130 | Brugada syndrome |
| CACNA2D1 | Orphanet:442835 | Non-specific early-onset epileptic encephalopathy |
| CACNA2D1 | Orphanet:51083 | Congenital short QT syndrome |
| PALLD | Orphanet:1333 | Familial pancreatic carcinoma |
| FARSB | Orphanet:178506 | Interstitial lung disease-brain calcification syndrome |
| PKD1L1 | Orphanet:101063 | Situs inversus totalis |
| PKD1L1 | Orphanet:157769 | Situs ambiguus |
| COL13A1 | Orphanet:98913 | Postsynaptic congenital myasthenic syndrome |
| COL13A1 | Orphanet:98914 | Presynaptic congenital myasthenic syndromes |
| LTBP2 | Orphanet:238763 | Glaucoma secondary to spherophakia/ectopia lentis and megalocornea |
| LTBP2 | Orphanet:3449 | Weill-Marchesani syndrome |
| LTBP2 | Orphanet:98976 | Congenital glaucoma |
| MERTK | Orphanet:791 | Retinitis pigmentosa |
| NGF | Orphanet:64752 | Hereditary sensory and autonomic neuropathy type 5 |
| SERPINA1 | Orphanet:178396 | Hemorrhagic disease due to alpha-1-antitrypsin Pittsburgh mutation |
| SERPINA1 | Orphanet:586 | Cystic fibrosis |
| SERPINA1 | Orphanet:60 | Alpha-1-antitrypsin deficiency |
Cohort genes → proteins
30 cohort genes, 30 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| gwas_only | 29 |
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| RNF7 | HGNC:10070 | ENSG00000114125 | Q9UBF6 | RING-box protein 2 | gwas |
| ST8SIA1 | HGNC:10869 | ENSG00000111728 | Q92185 | Alpha-N-acetylneuraminide alpha-2,8-sialyltransferase | gwas |
| TM6SF2 | HGNC:11861 | ENSG00000213996 | Q9BZW4 | Transmembrane 6 superfamily member 2 | gwas |
| TULP1 | HGNC:12423 | ENSG00000112041 | O00294 | Tubby-related protein 1 | gwas |
| CACNA2D1 | HGNC:1399 | ENSG00000153956 | P54289 | Voltage-dependent calcium channel subunit alpha-2/delta-1 | gwas |
| PARVB | HGNC:14653 | ENSG00000188677 | Q9HBI1 | Beta-parvin | gwas |
| ZP4 | HGNC:15770 | ENSG00000116996 | Q12836 | Zona pellucida sperm-binding protein 4 | gwas |
| MACROD2 | HGNC:16126 | ENSG00000172264 | A1Z1Q3 | ADP-ribose glycohydrolase MACROD2 | gwas |
| PALLD | HGNC:17068 | ENSG00000129116 | Q8WX93 | Palladin | gwas |
| FARSB | HGNC:17800 | ENSG00000116120 | Q9NSD9 | Phenylalanine–tRNA ligase beta subunit | clinvar |
| PKD1L1 | HGNC:18053 | ENSG00000158683 | Q8TDX9 | Polycystin-1-like protein 1 | gwas |
| PNPLA3 | HGNC:18590 | ENSG00000100344 | Q9NST1 | 1-acylglycerol-3-phosphate O-acyltransferase PNPLA3 | gwas |
| HSD17B13 | HGNC:18685 | ENSG00000170509 | Q7Z5P4 | 17-beta-hydroxysteroid dehydrogenase 13 | gwas |
| COL13A1 | HGNC:2190 | ENSG00000197467 | Q5TAT6 | Collagen alpha-1(XIII) chain | gwas |
| SAMM50 | HGNC:24276 | ENSG00000100347 | Q9Y512 | Sorting and assembly machinery component 50 homolog | gwas |
| GLT8D2 | HGNC:24890 | ENSG00000120820 | Q9H1C3 | Glycosyltransferase 8 domain-containing protein 2 | gwas |
| MTARC1 | HGNC:26189 | ENSG00000186205 | Q5VT66 | Mitochondrial amidoxime-reducing component 1 | gwas |
| DDX60L | HGNC:26429 | ENSG00000181381 | Q5H9U9 | Probable ATP-dependent RNA helicase DDX60-like | gwas |
| DCLK1 | HGNC:2700 | ENSG00000133083 | O15075 | Serine/threonine-protein kinase DCLK1 | gwas |
| CRACR2A | HGNC:28657 | ENSG00000130038 | Q9BSW2 | EF-hand calcium-binding domain-containing protein 4B | gwas |
| EHBP1L1 | HGNC:30682 | ENSG00000173442 | Q8N3D4 | EH domain-binding protein 1-like protein 1 | gwas |
| TEX36 | HGNC:31653 | ENSG00000175018 | Q5VZQ5 | Testis-expressed protein 36 | gwas |
| FARP1 | HGNC:3591 | ENSG00000152767 | Q9Y4F1 | FERM, ARHGEF and pleckstrin domain-containing protein 1 | gwas |
| FDFT1 | HGNC:3629 | ENSG00000079459 | P37268 | Squalene synthase | gwas |
| LTBP2 | HGNC:6715 | ENSG00000119681 | Q14767 | Latent-transforming growth factor beta-binding protein 2 | gwas |
| MERTK | HGNC:7027 | ENSG00000153208 | Q12866 | Tyrosine-protein kinase Mer | gwas |
| NGF | HGNC:7808 | ENSG00000134259 | P01138 | Beta-nerve growth factor | gwas |
| SERPINA1 | HGNC:8941 | ENSG00000197249 | P01009 | Alpha-1-antitrypsin | gwas |
| PTPRU | HGNC:9683 | ENSG00000060656 | Q92729 | Receptor-type tyrosine-protein phosphatase U | gwas |
| PZP | HGNC:9750 | ENSG00000126838 | P20742 | Pregnancy zone protein | gwas |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| RNF7 | RING-box protein 2 | Catalytic component of multiple cullin-5-RING E3 ubiquitin-protein ligase complexes (ECS complexes), which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. |
| ST8SIA1 | Alpha-N-acetylneuraminide alpha-2,8-sialyltransferase | Catalyzes the addition of sialic acid in alpha 2,8-linkage to the sialic acid moiety of the ganglioside GM3 to form ganglioside GD3; gangliosides are a subfamily of complex glycosphingolipds that contain one or more residues of sialic acid. |
| TM6SF2 | Transmembrane 6 superfamily member 2 | Regulator of liver fat metabolism influencing triglyceride secretion and hepatic lipid droplet content. |
| TULP1 | Tubby-related protein 1 | Required for normal development of photoreceptor synapses. |
| CACNA2D1 | Voltage-dependent calcium channel subunit alpha-2/delta-1 | The alpha-2/delta subunit of voltage-dependent calcium channels regulates calcium current density and activation/inactivation kinetics of the calcium channel. |
| PARVB | Beta-parvin | Adapter protein that plays a role in integrin signaling via ILK and in activation of the GTPases CDC42 and RAC1 by guanine exchange factors, such as ARHGEF6. |
| ZP4 | Zona pellucida sperm-binding protein 4 | Component of the zona pellucida, an extracellular matrix surrounding oocytes which mediates sperm binding, induction of the acrosome reaction and prevents post-fertilization polyspermy. |
| MACROD2 | ADP-ribose glycohydrolase MACROD2 | Removes ADP-ribose from aspartate and glutamate residues in proteins bearing a single ADP-ribose moiety. |
| PALLD | Palladin | Cytoskeletal protein required for organization of normal actin cytoskeleton. |
| PKD1L1 | Polycystin-1-like protein 1 | Component of a calcium-permeant ion channel formed by PKD1L2 and PKD1L1 in primary cilia, where it controls cilium calcium concentration, without affecting cytoplasmic calcium concentration, and regulates sonic hedgehog/SHH signaling and G… |
| PNPLA3 | 1-acylglycerol-3-phosphate O-acyltransferase PNPLA3 | Specifically catalyzes coenzyme A (CoA)-dependent acylation of 1-acyl-sn-glycerol 3-phosphate (2-lysophosphatidic acid/LPA) to generate phosphatidic acid (PA), an important metabolic intermediate and precursor for both triglycerides and gl… |
| HSD17B13 | 17-beta-hydroxysteroid dehydrogenase 13 | Plays a pivotal role in hepatic lipid metabolism. |
| COL13A1 | Collagen alpha-1(XIII) chain | Involved in cell-matrix and cell-cell adhesion interactions that are required for normal development. |
| SAMM50 | Sorting and assembly machinery component 50 homolog | Plays a crucial role in the maintenance of the structure of mitochondrial cristae and the proper assembly of the mitochondrial respiratory chain complexes. |
| MTARC1 | Mitochondrial amidoxime-reducing component 1 | Catalyzes the reduction of N-oxygenated molecules, acting as a counterpart of cytochrome P450 and flavin-containing monooxygenases in metabolic cycles. |
| DCLK1 | Serine/threonine-protein kinase DCLK1 | Probable kinase that may be involved in a calcium-signaling pathway controlling neuronal migration in the developing brain. |
| CRACR2A | EF-hand calcium-binding domain-containing protein 4B | Ca(2+)-binding protein that plays a key role in store-operated Ca(2+) entry (SOCE) in T-cells by regulating CRAC channel activation. |
| EHBP1L1 | EH domain-binding protein 1-like protein 1 | May act as Rab effector protein and play a role in vesicle trafficking. |
| FARP1 | FERM, ARHGEF and pleckstrin domain-containing protein 1 | Functions as a guanine nucleotide exchange factor for RAC1. |
| FDFT1 | Squalene synthase | Catalyzes the condensation of 2 farnesyl pyrophosphate (FPP) moieties to form squalene. |
| LTBP2 | Latent-transforming growth factor beta-binding protein 2 | May play an integral structural role in elastic-fiber architectural organization and/or assembly. |
| MERTK | Tyrosine-protein kinase Mer | Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding to several ligands including LGALS3, TUB, TULP1 or GAS6. |
| NGF | Beta-nerve growth factor | Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. |
| SERPINA1 | Alpha-1-antitrypsin | Inhibitor of serine proteases. |
| PTPRU | Receptor-type tyrosine-protein phosphatase U | Tyrosine-protein phosphatase which dephosphorylates CTNNB1. |
| PZP | Pregnancy zone protein | Is able to inhibit all four classes of proteinases by a unique ’trapping’ mechanism. |
Protein-family classification
Druggable: 12 · Difficult: 2 · Unknown: 16 · Druggable fraction: 0.4
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Complement | 1 | 8.9× | 0.283 |
| Antibody/Immunoglobulin | 3 | 2.9× | 0.283 |
| Enzyme (other) | 5 | 2.0× | 0.283 |
| Phosphatase | 1 | 2.8× | 0.484 |
| Kinase | 2 | 1.9× | 0.484 |
| Other/Unknown | 16 | 1.0× | 0.904 |
| Scaffold/PPI | 1 | 0.6× | 0.952 |
| Transcription factor | 1 | 0.3× | 0.979 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| RNF7 | Transcription factor | no | Znf_RING, Znf_RING/FYVE/PHD, Znf_RING_H2 | |
| ST8SIA1 | Enzyme (other) | yes | 2.4.99.8 | Glyco_trans_29, Sialyl_trans, GT29-like_sf |
| TM6SF2 | Other/Unknown | no | EXPERA, TM6SF1-like, TM_Tm6sf1/2 | |
| TULP1 | Other/Unknown | no | Tubby_C, Tubby_C_CS, Tubby-like_C | |
| CACNA2D1 | Other/Unknown | no | VWF_A, VWA_N, VDCC_a2/dsu | |
| PARVB | Other/Unknown | no | CH_dom, Parvin, CH_dom_sf | |
| ZP4 | Antibody/Immunoglobulin | yes | P_trefoil_dom, ZP_dom, P_trefoil_CS | |
| MACROD2 | Enzyme (other) | yes | 3.1.1.106 | Macro_dom, Macro_dom-like |
| PALLD | Antibody/Immunoglobulin | yes | Ig_sub2, Ig_sub, Ig-like_dom | |
| FARSB | Enzyme (other) | yes | 6.1.1.20 | Phe-tRNA-synth_IIc_bsu_arc_euk, B3/B4_tRNA-bd, tRNA_synthase_B5-dom |
| PKD1L1 | Antibody/Immunoglobulin | yes | PKD_dom, PLAT/LH2_dom, PKD/REJ-like | |
| PNPLA3 | Other/Unknown | no | PNPLA_dom, Acyl_Trfase/lysoPLipase, PLPL | |
| HSD17B13 | Other/Unknown | no | SDR_fam, NAD(P)-bd_dom_sf | |
| COL13A1 | Other/Unknown | no | Collagen, Collagen_Structural_Proteins | |
| SAMM50 | Other/Unknown | no | Bac_surfAg_D15, POTRA, D15-like | |
| GLT8D2 | Other/Unknown | no | Glyco_trans_8, Nucleotide-diphossugar_trans, Glycosyltrans_8_dom-fam | |
| MTARC1 | Enzyme (other) | yes | 1.16.98.B1 | MoCF_Sase_C, MOCOS_middle, Pyrv_Knase-like_insert_dom_sf |
| DDX60L | Other/Unknown | no | Helicase_C-like, DEAD/DEAH_box_helicase_dom, Helicase_ATP-bd | |
| DCLK1 | Kinase | yes | 2.7.11.1 | Prot_kinase_dom, Doublecortin_dom, Ser/Thr_kinase_AS |
| CRACR2A | Other/Unknown | no | Small_GTPase, EF_hand_dom, Small_GTP-bd | |
| EHBP1L1 | Other/Unknown | no | CH_dom, NT-C2, bMERB_dom | |
| TEX36 | Other/Unknown | no | HDNR | |
| FARP1 | Scaffold/PPI | no | DH_dom, FERM_domain, Ez/rad/moesin-like | |
| FDFT1 | Enzyme (other) | yes | 2.5.1.21 | Squ/phyt_synthse, Squal_synth-like, Isoprenoid_synthase_dom_sf |
| LTBP2 | Other/Unknown | no | EGF-type_Asp/Asn_hydroxyl_site, EGF, EGF-like_Ca-bd_dom | |
| MERTK | Kinase | yes | 2.7.10.1 | Prot_kinase_dom, Ser-Thr/Tyr_kinase_cat_dom, Ig_sub |
| NGF | Other/Unknown | no | Nerve_growth_factor-rel, Nerve_growth_factor_CS, Nerve_growth_factor-like | |
| SERPINA1 | Other/Unknown | no | Serpin_fam, Serpin_CS, Serpin_dom | |
| PTPRU | Phosphatase | yes | 3.1.3.48 | PTP_cat, Tyr_Pase_dom, MAM_dom |
| PZP | Complement | yes | Macroglobln_a2, MG2, Terpenoid_cyclase/PrenylTrfase |
Expression context
Cohort genes with no expression data: 0.
29 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 1 |
| broad (>20) | 29 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| endothelial cell | 3 |
| right lobe of liver | 3 |
| right adrenal gland | 2 |
| cortical plate | 2 |
| ganglionic eminence | 2 |
| ileal mucosa | 2 |
| jejunal mucosa | 2 |
| primordial germ cell in gonad | 2 |
| skeletal muscle tissue of rectus abdominis | 2 |
| buccal mucosa cell | 2 |
| liver | 2 |
| olfactory segment of nasal mucosa | 2 |
| descending thoracic aorta | 2 |
| adrenal tissue | 2 |
| left adrenal gland | 1 |
| left adrenal gland cortex | 1 |
| ventricular zone | 1 |
| duodenum | 1 |
| retina | 1 |
| tendon of biceps brachii | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| RNF7 | 292 | ubiquitous | marker | left adrenal gland, left adrenal gland cortex, right adrenal gland |
| ST8SIA1 | 224 | broad | marker | ventricular zone, ganglionic eminence, cortical plate |
| TM6SF2 | 151 | broad | marker | ileal mucosa, jejunal mucosa, duodenum |
| TULP1 | 134 | tissue_specific | marker | primordial germ cell in gonad, tendon of biceps brachii, retina |
| CACNA2D1 | 261 | ubiquitous | marker | biceps brachii, skeletal muscle tissue of biceps brachii, skeletal muscle tissue of rectus abdominis |
| PARVB | 235 | ubiquitous | marker | hindlimb stylopod muscle, gastrocnemius, muscle of leg |
| ZP4 | 18 | marker | oocyte, secondary oocyte, pancreatic ductal cell | |
| MACROD2 | 214 | ubiquitous | marker | endothelial cell, buccal mucosa cell, epithelial cell of pancreas |
| PALLD | 302 | ubiquitous | marker | saphenous vein, heart right ventricle, blood vessel layer |
| FARSB | 264 | ubiquitous | marker | left ventricle myocardium, cardiac muscle of right atrium, gingival epithelium |
| PKD1L1 | 150 | tissue_specific | marker | male germ line stem cell (sensu Vertebrata) in testis, apex of heart, primordial germ cell in gonad |
| PNPLA3 | 178 | ubiquitous | marker | pigmented layer of retina, buccal mucosa cell, right lobe of liver |
| HSD17B13 | 127 | tissue_specific | yes | liver, right lobe of liver, olfactory segment of nasal mucosa |
| COL13A1 | 209 | ubiquitous | marker | cerebellar hemisphere, cerebellar cortex, cerebellum |
| SAMM50 | 292 | ubiquitous | marker | endothelial cell, vastus lateralis, skeletal muscle tissue of rectus abdominis |
| GLT8D2 | 247 | ubiquitous | marker | tibia, parietal pleura, descending thoracic aorta |
| MTARC1 | 209 | ubiquitous | marker | adipose tissue, adipose tissue of abdominal region, omental fat pad |
| DDX60L | 229 | ubiquitous | marker | monocyte, leukocyte, jejunal mucosa |
| DCLK1 | 264 | ubiquitous | marker | endothelial cell, frontal pole, cortical plate |
| CRACR2A | 210 | broad | marker | parotid gland, ileal mucosa, mucosa of sigmoid colon |
| EHBP1L1 | 233 | ubiquitous | marker | granulocyte, lower esophagus, lower esophagus muscularis layer |
| TEX36 | 30 | tissue_specific | marker | left testis, right testis, testis |
| FARP1 | 283 | ubiquitous | marker | renal medulla, stromal cell of endometrium, adrenal tissue |
| FDFT1 | 236 | ubiquitous | marker | embryo, ganglionic eminence, adrenal tissue |
| LTBP2 | 276 | ubiquitous | marker | descending thoracic aorta, thoracic aorta, ascending aorta |
| MERTK | 246 | ubiquitous | marker | right adrenal gland cortex, mucosa of stomach, right adrenal gland |
| NGF | 158 | broad | marker | cartilage tissue, left uterine tube, right ovary |
| SERPINA1 | 133 | ubiquitous | marker | right lobe of liver, liver, blood |
| PTPRU | 239 | ubiquitous | marker | endocervix, olfactory segment of nasal mucosa, ectocervix |
| PZP | 178 | tissue_specific | marker | bronchial epithelial cell, epithelium of bronchus, bronchus |
Protein interactions among cohort
Intra-cohort edges: 12.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| NGF | 3,968 |
| SERPINA1 | 3,617 |
| DCLK1 | 3,597 |
| HSD17B13 | 3,393 |
| FARSB | 3,392 |
| FDFT1 | 3,249 |
| SAMM50 | 2,977 |
| MERTK | 2,735 |
| LTBP2 | 2,658 |
| RNF7 | 2,453 |
Intra-cohort edges
| A | B | Sources |
|---|---|---|
| CACNA2D1 | GLT8D2 | biogrid_interaction |
| FDFT1 | PNPLA3 | string_interaction |
| FDFT1 | TM6SF2 | string_interaction |
| HSD17B13 | MTARC1 | string_interaction |
| HSD17B13 | PNPLA3 | string_interaction |
| HSD17B13 | SAMM50 | string_interaction |
| HSD17B13 | TM6SF2 | string_interaction |
| MERTK | TULP1 | string_interaction |
| MTARC1 | PNPLA3 | string_interaction |
| MTARC1 | TM6SF2 | string_interaction |
| PNPLA3 | SAMM50 | string_interaction |
| PNPLA3 | TM6SF2 | string_interaction |
Structural data
PDB: 18 · AlphaFold-only: 12 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| SERPINA1 | P01009 | 46 |
| MERTK | Q12866 | 42 |
| FDFT1 | P37268 | 32 |
| CACNA2D1 | P54289 | 30 |
| DCLK1 | O15075 | 11 |
| NGF | P01138 | 10 |
| RNF7 | Q9UBF6 | 7 |
| MACROD2 | A1Z1Q3 | 4 |
| PARVB | Q9HBI1 | 3 |
| FARSB | Q9NSD9 | 3 |
| MTARC1 | Q5VT66 | 3 |
| TULP1 | O00294 | 2 |
| PALLD | Q8WX93 | 2 |
| SAMM50 | Q9Y512 | 2 |
| PTPRU | Q92729 | 2 |
| HSD17B13 | Q7Z5P4 | 1 |
| CRACR2A | Q9BSW2 | 1 |
| FARP1 | Q9Y4F1 | 1 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|---|---|
| TM6SF2 | Q9BZW4 | 91.03 |
| ST8SIA1 | Q92185 | 88.71 |
| GLT8D2 | Q9H1C3 | 88.41 |
| PZP | P20742 | 81.87 |
| DDX60L | Q5H9U9 | 79.77 |
| ZP4 | Q12836 | 74.90 |
| PNPLA3 | Q9NST1 | 71.70 |
| TEX36 | Q5VZQ5 | 60.88 |
| LTBP2 | Q14767 | 58.33 |
| COL13A1 | Q5TAT6 | 55.67 |
| EHBP1L1 | Q8N3D4 | 49.98 |
| PKD1L1 | Q8TDX9 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 87. Enrichment computed across 30 evidence-associated genes (19 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 19 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| TRKA activation by NGF | 1 | 300.5× | 0.078 | NGF |
| NFG and proNGF binds to p75NTR | 1 | 300.5× | 0.078 | NGF |
| PLC-gamma1 signalling | 1 | 200.3× | 0.078 | NGF |
| Ceramide signalling | 1 | 200.3× | 0.078 | NGF |
| Signalling to STAT3 | 1 | 200.3× | 0.078 | NGF |
| NGF processing | 1 | 150.3× | 0.078 | NGF |
| Axonal growth stimulation | 1 | 150.3× | 0.078 | NGF |
| Signalling to p38 via RIT and RIN | 1 | 120.2× | 0.078 | NGF |
| p75NTR negatively regulates cell cycle via SC1 | 1 | 100.2× | 0.078 | NGF |
| NADE modulates death signalling | 1 | 100.2× | 0.078 | NGF |
| Lipid particle organization | 1 | 100.2× | 0.078 | HSD17B13 |
| Acyl chain remodeling of DAG and TAG | 1 | 85.9× | 0.078 | PNPLA3 |
| ARMS-mediated activation | 1 | 85.9× | 0.078 | NGF |
| Regulation of cytoskeletal remodeling and cell spreading by IPP complex components | 1 | 75.1× | 0.082 | PARVB |
| PI3K/AKT activation | 1 | 66.8× | 0.086 | NGF |
| Interaction With Cumulus Cells And The Zona Pellucida | 1 | 54.6× | 0.097 | ZP4 |
| Frs2-mediated activation | 1 | 50.1× | 0.097 | NGF |
| p75NTR recruits signalling complexes | 1 | 46.2× | 0.097 | NGF |
| NF-kB is activated and signals survival | 1 | 46.2× | 0.097 | NGF |
| Retrograde neurotrophin signalling | 1 | 42.9× | 0.097 | NGF |
| Lanosterol biosynthesis | 1 | 40.1× | 0.097 | FDFT1 |
| NRIF signals cell death from the nucleus | 1 | 37.6× | 0.097 | NGF |
| Signalling to RAS | 1 | 35.4× | 0.097 | NGF |
| Cell-extracellular matrix interactions | 1 | 35.4× | 0.097 | PARVB |
| Mechanical load activates signaling by PIEZO1 and integrins in osteocytes | 1 | 35.4× | 0.097 | CACNA2D1 |
| Asparagine N-linked glycosylation | 2 | 6.3× | 0.131 | ST8SIA1, SERPINA1 |
| Cytosolic tRNA aminoacylation | 1 | 23.1× | 0.132 | FARSB |
| Inactivation of CSF3 (G-CSF) signaling | 1 | 23.1× | 0.132 | RNF7 |
| Cristae formation | 1 | 18.2× | 0.149 | SAMM50 |
| Elastic fibre formation | 1 | 17.7× | 0.149 | LTBP2 |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 27 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| triglyceride acyl-chain remodeling | 1 | 624.1× | 0.043 | PNPLA3 |
| farnesyl diphosphate metabolic process | 1 | 624.1× | 0.043 | FDFT1 |
| detoxification of nitrogen compound | 1 | 312.1× | 0.043 | MTARC1 |
| cellular response to 3,3’,5-triiodo-L-thyronine | 1 | 312.1× | 0.043 | PNPLA3 |
| negative regulation of leukocyte apoptotic process | 1 | 312.1× | 0.043 | MERTK |
| detection of nodal flow | 1 | 208.1× | 0.043 | PKD1L1 |
| positive regulation of neuron maturation | 1 | 208.1× | 0.043 | NGF |
| nitrate metabolic process | 1 | 208.1× | 0.043 | MTARC1 |
| purine nucleoside metabolic process | 1 | 208.1× | 0.043 | MACROD2 |
| negative regulation of lymphocyte activation | 1 | 208.1× | 0.043 | MERTK |
| calcium ion transmembrane transport via high voltage-gated calcium channel | 1 | 208.1× | 0.043 | CACNA2D1 |
| membrane depolarization during bundle of His cell action potential | 1 | 208.1× | 0.043 | CACNA2D1 |
| regulation of membrane repolarization during action potential | 1 | 208.1× | 0.043 | CACNA2D1 |
| retrograde trans-synaptic signaling by trans-synaptic protein complex | 1 | 208.1× | 0.043 | FARP1 |
| peptidyl-glutamate ADP-deribosylation | 1 | 208.1× | 0.043 | MACROD2 |
| positive regulation of humoral immune response | 1 | 156.0× | 0.043 | ZP4 |
| phenylalanyl-tRNA aminoacylation | 1 | 156.0× | 0.043 | FARSB |
| response to histamine | 1 | 156.0× | 0.043 | CRACR2A |
| acylglycerol acyl-chain remodeling | 1 | 156.0× | 0.043 | PNPLA3 |
| establishment or maintenance of cell polarity regulating cell shape | 1 | 156.0× | 0.043 | PARVB |
| negative regulation of focal adhesion disassembly | 1 | 156.0× | 0.043 | RNF7 |
| negative regulation of binding of sperm to zona pellucida | 1 | 156.0× | 0.043 | ZP4 |
| axon extension | 2 | 36.7× | 0.043 | DCLK1, NGF |
| substrate adhesion-dependent cell spreading | 2 | 25.5× | 0.043 | PARVB, MERTK |
| lipid homeostasis | 2 | 25.0× | 0.043 | TM6SF2, PNPLA3 |
| positive regulation of phagocytosis | 2 | 23.6× | 0.043 | TULP1, MERTK |
| retina development in camera-type eye | 2 | 18.9× | 0.043 | TULP1, MERTK |
| endosomal transport | 2 | 18.1× | 0.043 | DCLK1, CRACR2A |
| response to sucrose | 1 | 124.8× | 0.047 | PNPLA3 |
| activation of store-operated calcium channel activity | 1 | 124.8× | 0.047 | CRACR2A |
Therapeutics
Drugs indicated for this disease
6 approved, 29 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
| Drug | Development status |
|---|---|
| Ethacrynic Acid | Approved (phase 4) |
| Furosemide | Approved (phase 4) |
| Hydrochlorothiazide | Approved (phase 4) |
| Ribavirin | Approved (phase 4) |
| Spironolactone | Approved (phase 4) |
| Triamterene | Approved (phase 4) |
| Albumin Human | Phase 3 (in late-stage trials) |
| Bemiparin | Phase 3 (in late-stage trials) |
| Calcium Carbonate | Phase 3 (in late-stage trials) |
| Cyclobenzaprine | Phase 3 (in late-stage trials) |
| Dexamethasone | Phase 3 (in late-stage trials) |
| Filgrastim | Phase 3 (in late-stage trials) |
| Fospropofol | Phase 3 (in late-stage trials) |
| Gabapentin | Phase 3 (in late-stage trials) |
| Hydrocortisone | Phase 3 (in late-stage trials) |
| Hydronidone | Phase 3 (in late-stage trials) |
| INTERFERON ALFA-2B | Phase 3 (in late-stage trials) |
| Lamivudine | Phase 3 (in late-stage trials) |
| Methocarbamol | Phase 3 (in late-stage trials) |
| Midazolam | Phase 3 (in late-stage trials) |
| Norfloxacin | Phase 3 (in late-stage trials) |
| PEGINTERFERON ALFA-2A | Phase 3 (in late-stage trials) |
| PEGINTERFERON ALFA-2B | Phase 3 (in late-stage trials) |
| Pentoxifylline | Phase 3 (in late-stage trials) |
| Propofol | Phase 3 (in late-stage trials) |
| Propranolol | Phase 3 (in late-stage trials) |
| Rifaximin | Phase 3 (in late-stage trials) |
| Rivaroxaban | Phase 3 (in late-stage trials) |
| Satavaptan | Phase 3 (in late-stage trials) |
| Simvastatin | Phase 3 (in late-stage trials) |
| Sodium Chloride | Phase 3 (in late-stage trials) |
| Telbivudine | Phase 3 (in late-stage trials) |
| Terlipressin | Phase 3 (in late-stage trials) |
| Tolvaptan | Phase 3 (in late-stage trials) |
| Vitamin E | Phase 3 (in late-stage trials) |
Earlier-phase candidates (phase 2, investigational — efficacy not yet established): Alcohol, Allopurinol, Apixaban, Atorvastatin, Bosentan, Conivaptan, Dapagliflozin, Edoxaban, Enoxaparin Sodium, Epigalocatechin Gallate, Hepatitis B Virus Hbsag Surface Protein Antigen, INTERFERON GAMMA-1B, Icomidocholic Acid, Imiquimod, Lactulose, Oltipraz, Sapropterin, Somatropin, Warfarin, Zibotentan.
Drug target analysis
Approved (phase 4): 4 · Phase ≥3: 5 · Phased (≥1): 6 · Undrugged: 24
Druggability breadth: 12 of 30 evidence-associated genes (40%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|---|
| CACNA2D1 | PREGABALIN |
| DCLK1 | FEDRATINIB |
| FDFT1 | AMIODARONE |
| MERTK | FEDRATINIB |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| MERTK | 48 | 4 |
| DCLK1 | 15 | 4 |
| CACNA2D1 | 5 | 4 |
| FARSB | 3 | 2 |
| FDFT1 | 3 | 4 |
| HSD17B13 | 1 | 3 |
| RNF7 | 0 | 0 |
| ST8SIA1 | 0 | 0 |
| TM6SF2 | 0 | 0 |
| TULP1 | 0 | 0 |
Drugs targeting cohort genes (top 30)
| Molecule | Max phase | Targets in cohort |
|---|---|---|
| PREGABALIN | 4 | CACNA2D1 |
| GABAPENTIN | 4 | CACNA2D1 |
| NIMODIPINE | 4 | CACNA2D1 |
| TACRINE | 4 | CACNA2D1 |
| FEDRATINIB | 4 | DCLK1, MERTK |
| RUXOLITINIB | 4 | DCLK1 |
| TOFACITINIB CITRATE | 4 | DCLK1 |
| TOFACITINIB | 4 | DCLK1 |
| NINTEDANIB | 4 | DCLK1, MERTK |
| SUNITINIB | 4 | DCLK1, MERTK |
| CRIZOTINIB | 4 | DCLK1, MERTK |
| AMIODARONE | 4 | FDFT1 |
| AXITINIB | 4 | MERTK |
| SORAFENIB | 4 | MERTK |
| NERATINIB | 4 | MERTK |
| CABOZANTINIB | 4 | MERTK |
| VANDETANIB | 4 | MERTK |
| BOSUTINIB | 4 | MERTK |
| FILGOTINIB | 4 | MERTK |
| PACLITAXEL | 4 | MERTK |
| PAZOPANIB | 4 | MERTK |
| ERLOTINIB | 4 | MERTK |
| QUIZARTINIB | 4 | MERTK |
| MIDOSTAURIN | 4 | MERTK |
| CILOFEXOR | 3 | HSD17B13 |
| ALVOCIDIB | 3 | DCLK1, MERTK |
| LAPAQUISTAT ACETATE | 3 | FDFT1 |
| LINIFANIB | 3 | MERTK |
| ITACITINIB | 3 | MERTK |
| SURUFATINIB | 3 | MERTK |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 8.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| MERTK | 443 | Binding:442, Functional:1 |
| DCLK1 | 150 | Binding:149, Functional:1 |
| CACNA2D1 | 47 | Binding:45, ADMET:1, Toxicity:1 |
| FDFT1 | 40 | Binding:40 |
| MTARC1 | 25 | Binding:12, ADMET:11, Unclassified:2 |
| HSD17B13 | 22 | Binding:20, Functional:2 |
| FARSB | 8 | Binding:8 |
| MACROD2 | 4 | Binding:2, Toxicity:2 |
| NGF | 4 | Binding:4 |
| SAMM50 | 1 | Binding:1 |
| CRACR2A | 1 | Binding:1 |
| PTPRU | 1 | Binding:1 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|---|---|
| ST8SIA1 | 2.4.99.8 | alpha-N-acetylneuraminate alpha-2,8-sialyltransferase |
| MACROD2 | 3.1.1.106 | O-acetyl-ADP-ribose deacetylase |
| FARSB | 6.1.1.20 | phenylalanine-tRNA ligase |
| MTARC1 | 1.16.98.B1, 1.7.2.1 | , nitrite reductase (NO-forming) |
| DCLK1 | 2.7.11.1 | non-specific serine/threonine protein kinase |
| FDFT1 | 2.5.1.21 | squalene synthase |
| MERTK | 2.7.10.1 | receptor protein-tyrosine kinase |
| PTPRU | 3.1.3.48 | protein-tyrosine-phosphatase |
Cohort genes with high screening signal
≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.
| Symbol | ChEMBL assays |
|---|---|
| DCLK1 | 150 |
| MERTK | 443 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 30; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
30 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
| Compound | Max phase | Cohort target (bioactivity) |
|---|---|---|
| PREGABALIN | 4 | CACNA2D1 |
| GABAPENTIN | 4 | CACNA2D1 |
| NIMODIPINE | 4 | CACNA2D1 |
| TACRINE | 4 | CACNA2D1 |
| FEDRATINIB | 4 | DCLK1, MERTK |
| RUXOLITINIB | 4 | DCLK1 |
| TOFACITINIB CITRATE | 4 | DCLK1 |
| TOFACITINIB | 4 | DCLK1 |
| NINTEDANIB | 4 | DCLK1, MERTK |
| SUNITINIB | 4 | DCLK1, MERTK |
| CRIZOTINIB | 4 | DCLK1, MERTK |
| AMIODARONE | 4 | FDFT1 |
| AXITINIB | 4 | MERTK |
| SORAFENIB | 4 | MERTK |
| NERATINIB | 4 | MERTK |
| CABOZANTINIB | 4 | MERTK |
| VANDETANIB | 4 | MERTK |
| BOSUTINIB | 4 | MERTK |
| FILGOTINIB | 4 | MERTK |
| PACLITAXEL | 4 | MERTK |
| PAZOPANIB | 4 | MERTK |
| ERLOTINIB | 4 | MERTK |
| QUIZARTINIB | 4 | MERTK |
| MIDOSTAURIN | 4 | MERTK |
| CILOFEXOR | 3 | HSD17B13 |
| ALVOCIDIB | 3 | DCLK1, MERTK |
| LAPAQUISTAT ACETATE | 3 | FDFT1 |
| LINIFANIB | 3 | MERTK |
| ITACITINIB | 3 | MERTK |
| SURUFATINIB | 3 | MERTK |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 4 | CACNA2D1, DCLK1, FDFT1, MERTK |
| B | Phased (≥1) drug, not yet approved | 2 | FARSB, HSD17B13 |
| C | Druggable family + PDB, no drug | 4 | MACROD2, PALLD, MTARC1, PTPRU |
| D | Druggable family + AlphaFold only, no drug | 4 | ST8SIA1, ZP4, PKD1L1, PZP |
| E | Difficult family or no structure, no drug | 16 | RNF7, TM6SF2, TULP1, PARVB, PNPLA3, COL13A1, SAMM50, GLT8D2, DDX60L, CRACR2A (+6 more) |
Undrugged target profiles
24 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| TM6SF2 | 0 | HSD17B13 |
| TULP1 | 0 | MERTK |
| PNPLA3 | 0 | HSD17B13 |
| MTARC1 | 25 | HSD17B13 |
| RNF7 | 0 | — |
| ST8SIA1 | 0 | — |
| PARVB | 0 | — |
| ZP4 | 0 | — |
| MACROD2 | 4 | — |
| PALLD | 0 | — |
| PKD1L1 | 0 | — |
| COL13A1 | 0 | — |
| SAMM50 | 1 | — |
| GLT8D2 | 0 | — |
| DDX60L | 0 | — |
| CRACR2A | 1 | — |
| EHBP1L1 | 0 | — |
| TEX36 | 0 | — |
| FARP1 | 0 | — |
| LTBP2 | 0 | — |
| NGF | 4 | — |
| SERPINA1 | 0 | — |
| PTPRU | 1 | — |
| PZP | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 542.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| Not specified | 345 |
| PHASE4 | 65 |
| PHASE3 | 42 |
| PHASE2 | 42 |
| PHASE1 | 18 |
| PHASE2/PHASE3 | 17 |
| PHASE1/PHASE2 | 10 |
| EARLY_PHASE1 | 3 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT05147090 | PHASE4 | ACTIVE_NOT_RECRUITING | Effects of Empagliflozin on Fibrosis and Cirrhosis in Chronic Hepatitis B Patients |
| NCT05737030 | PHASE4 | ACTIVE_NOT_RECRUITING | Effect of L-ornithine-L-aspertate (LOLA) on the Gut Microbiome |
| NCT06594783 | PHASE4 | RECRUITING | Carvedilol Plus EVL or Not for the Primary Prevention of Esophageal Variceal Bleeding in Carvedilol Non-responders |
| NCT06808074 | PHASE4 | RECRUITING | A Study to Evaluate Role of Inhaled Amikacin to Prevent Ventilator Associated Pneumonia in Patients With Cirrhosis |
| NCT06881628 | PHASE4 | RECRUITING | Tranxemic Acid and Vitamin K Injection to Control Upper Gastrointestinal Bleeding in Cirrhotic Patients |
| NCT07132515 | PHASE4 | RECRUITING | Efficacy & Safety of Anticoagulants in Cirrhosis ± HCC |
| NCT07322237 | PHASE4 | RECRUITING | DICE Study- Diastolic Improvement With Carvedilol & Empagliflozin in Patients With Cirrhosis |
| NCT07521332 | PHASE4 | RECRUITING | Apixaban-PK Trial: Preventing Portal Hypertension Complications in Cirrhosis |
| NCT00108355 | PHASE4 | COMPLETED | Vasoconstrictors as Alternatives to Albumin After Large-Volume Paracentesis (LVP) in Cirrhosis |
| NCT00179413 | PHASE4 | COMPLETED | Study of Long-term Peg Intron vs. Colchicine in Non-responders. |
| NCT00287664 | PHASE4 | SUSPENDED | Treatment of Hepatorenal Syndrome With Terlipressin Plus Albumin vs Albumin |
| NCT00347009 | PHASE4 | COMPLETED | Adefovir Dipivoxil For The Treatment Of Patients With Chronic Hepatitis B Related Advanced Fibrosis Or Cirrhosis |
| NCT00359853 | PHASE4 | COMPLETED | Norfloxacin In The Primary Prophylaxis Of Spontaneous Bacterial Peritonitis |
| NCT00414713 | PHASE4 | UNKNOWN | Transfusion Requirements in Gastrointestinal (GI) Bleeding |
| NCT00450164 | PHASE4 | COMPLETED | Secondary Prophylaxis After Variceal Bleeding in Non-Responders |
| NCT00513201 | PHASE4 | COMPLETED | Lyspro Insulin vs Regular Insulin in Cirrhotic Patients |
| NCT00534677 | PHASE4 | COMPLETED | The Safety & Efficacy of Terlipressin vs Octreotide for the Control of Variceal Bleed |
| NCT00570622 | PHASE4 | COMPLETED | Effect of Pioglitazone on Portal and Systemic Hemodynamics in Patients With Advanced Cirrhosis |
| NCT00570973 | PHASE4 | COMPLETED | Band Ligation Versus Transjugular Intrahepatic Portosystemic Stent Shunt (TIPS) in Cirrhotics With Recurrent Variceal Bleeding Non Responding to Medical Therapy |
| NCT00596414 | PHASE4 | COMPLETED | Sedation and Analgesia for Transjugular Liver Biopsy: A Randomized Double Blind Placebo Controlled Trial |
| NCT00741663 | PHASE4 | COMPLETED | Spironolactone Versus Spironolactone Plus Furosemide (SVSSF) |
| NCT00760032 | PHASE4 | WITHDRAWN | Lipopolysaccharide Binding Protein and Development of Infectious Events in Cirrhotic Patients |
| NCT00761098 | PHASE4 | UNKNOWN | Randomized Comparison of Two Albumin Administration Schedules for Spontaneous Bacterial Peritonitis (SBP) |
| NCT00906139 | PHASE4 | UNKNOWN | Propofol and Fentanyl Versus Midazolam and Fentanyl for Endoscopy Sedation in Cirrhotic Patients |
| NCT00921349 | PHASE4 | COMPLETED | A Trial of Ligation Plus Nadolol Versus Nadolol Alone in the Prophylaxis of First Variceal Bleeding in Cirrhosis |
| NCT00965900 | PHASE4 | UNKNOWN | Endoscopic Band Ligation (EBL) Versus Propranolol for Primary Prophylaxis of Variceal Bleeding |
| NCT00966082 | PHASE4 | UNKNOWN | EBL Versus EBL and Propranolol for the Prevention of Variceal Rebleeding in Pts With Previous Variceal Treatment |
| NCT00966121 | PHASE4 | UNKNOWN | Endoscopic Band Ligation (EBL) Versus Endoscopic Band Ligation and Propranolol for the Prevention of Variceal Rebleeding |
| NCT00968695 | PHASE4 | COMPLETED | Effects of Long Term Albumin 20% Administration in Patients With Cirrhosis and Ascites. |
| NCT01292304 | PHASE4 | COMPLETED | Tolvaptan for Ascites in Cirrhotic Patients |
| NCT01530711 | PHASE4 | UNKNOWN | Treatment of Hepatorenal Syndrome With Terlipressin Infusion Adjusted to Hemodynamic Response |
| NCT01686698 | PHASE4 | COMPLETED | Effect of VSL#3 (Original De Simone Formulation) on Cognitive Function, Risk of Falls and Quality of Life in Patients With Cirrhosis |
| NCT01722578 | PHASE4 | COMPLETED | L-ornithine L-aspartate in Overt Hepatic Encephalopathy |
| NCT01820026 | PHASE4 | UNKNOWN | Empirical vs 2nd Line Antibiotic Therapy in Health-care Associated Infections in Cirrhosis |
| NCT01842581 | PHASE4 | COMPLETED | The Safety/Efficacy of Rifaximin With/Without Lactulose in Participants With A History of Recurrent Hepatic Encephalopathy |
| NCT01847651 | PHASE4 | COMPLETED | Brain Muscle Axis During Treatment of Hepatic Encephalopathy With L-ornithine L-aspartate |
| NCT01893541 | PHASE4 | COMPLETED | PROPRANOLOL PLUS LIGATION REDUCES RECURRENCE OF ESOPHAGEAL VARICES? |
| NCT02074280 | PHASE4 | UNKNOWN | Rifaximin Predicts the Complications of Decompensated Cirrhosis |
| NCT02190357 | PHASE4 | UNKNOWN | Rifaximin Reduces the Complications of Decompensated Cirrhosis: a Randomized Controlled Trial |
| NCT02238444 | PHASE4 | UNKNOWN | Warfarin Prevents Portal Vein Thrombosis in Liver Cirrhotic Patients With Hypersplenism After Laparoscopic Splenectomy |
Drugs tested across these trials (top 30)
| Molecule | Max phase | Trials referencing |
|---|---|---|
| PROPRANOLOL | 4 | 24 |
| ALBUMIN HUMAN | 4 | 12 |
| CARVEDILOL | 4 | 8 |
| TERLIPRESSIN | 4 | 7 |
| TOLVAPTAN | 4 | 7 |
| LACTULOSE | 4 | 6 |
| MIDODRINE | 4 | 5 |
| RIFAXIMIN | 4 | 5 |
| SOFOSBUVIR | 4 | 4 |
| DACLATASVIR | 4 | 3 |
| DIPYRIDAMOLE | 4 | 3 |
| NORFLOXACIN | 4 | 3 |
| PRAZOSIN | 4 | 3 |
| SPIRONOLACTONE | 4 | 3 |
| WARFARIN | 4 | 3 |
| ADEFOVIR DIPIVOXIL | 4 | 2 |
| ALLOPURINOL | 4 | 2 |
| APIXABAN | 4 | 2 |
| BACLOFEN | 4 | 2 |
| BOCEPREVIR | 4 | 2 |
| CEFOTIAM | 4 | 2 |
| COSYNTROPIN | 4 | 2 |
| EMPAGLIFLOZIN | 4 | 2 |
| EPTACOG ALFA (ACTIVATED) | 4 | 2 |
| FUROSEMIDE | 4 | 2 |
| LEDIPASVIR | 4 | 2 |
| MIDAZOLAM | 4 | 2 |
| NADOLOL | 4 | 2 |
| OCTREOTIDE | 4 | 2 |
| OMBITASVIR | 4 | 2 |
Related Atlas pages
- Cohort genes: RNF7, ST8SIA1, TM6SF2, TULP1, CACNA2D1, PARVB, ZP4, MACROD2, PALLD, FARSB, PKD1L1, PNPLA3, HSD17B13, COL13A1, SAMM50, GLT8D2, MTARC1, DDX60L, DCLK1, CRACR2A, EHBP1L1, TEX36, FARP1, FDFT1, LTBP2, MERTK, NGF, SERPINA1, PTPRU, PZP
- Drugs: Propranolol, Albumin Human, Carvedilol, Terlipressin, Tolvaptan, Lactulose, Midodrine, Rifaximin, Sofosbuvir, Daclatasvir, Dipyridamole, Norfloxacin, Prazosin, Spironolactone, Warfarin, Adefovir Dipivoxil, Allopurinol, Apixaban, Baclofen, Boceprevir, Cefotiam, Cosyntropin, Empagliflozin, Eptacog Alfa (Activated), Furosemide, Ledipasvir, Midazolam, Nadolol, Octreotide, Ombitasvir