Congenital reticular ichthyosiform erythroderma
diseaseOn this page
Also known as CRIEerythroderma, ichthyosiform, congenital reticularichthyosis variegataichthyosis with confettiIWC
Summary
Congenital reticular ichthyosiform erythroderma (MONDO:0012208) is a disease caused by KRT10 (GenCC Strong), with 3 cohort genes.
At a glance
- Prevalence: <1 / 1 000 000 (Worldwide) [Orphanet-validated]
- Causal gene: KRT10 (GenCC Strong)
- Cohort genes: 3
- ClinVar variants: 21
Clinical features
Epidemiology
Prevalence records
2 prevalence record(s), Orphanet:
| Type | Class | Value | Geography | Validation |
|---|---|---|---|---|
| Cases/families | 40 | Worldwide | Validated | |
| Point prevalence | <1 / 1 000 000 | Worldwide | Validated |
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | congenital reticular ichthyosiform erythroderma |
| Mondo ID | MONDO:0012208 |
| MeSH | C563781 |
| OMIM | 609165 |
| Orphanet | 281190 |
| ICD-11 | 565254051 |
| SNOMED CT | 703504006 |
| UMLS | C3665704 |
| MedGen | 777141 |
| GARD | 0017305 |
| Is cancer (heuristic) | no |
Also known as: CRIE · erythroderma, ichthyosiform, congenital reticular · ichthyosis variegata · ichthyosis with confetti · IWC
Data availability: 21 ClinVar variants · 3 GenCC gene-disease records.
Disease family
Classification path: disease › human disease › disease by body system or component › integumentary system disorder › skin disorder › epidermal disease › ichthyosis › inherited ichthyosis › keratinopathic ichthyosis › congenital reticular ichthyosiform erythroderma
Related subtypes (4): epidermolytic ichthyosis, ichthyosis hystrix of Curth-Macklin, superficial epidermolytic ichthyosis, epidermolytic nevus
Genetics & variants
GWAS landscape
No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.
Variant details and genetic-evidence tiers
ClinVar germline variants
21 retrieved; paginated sample, class counts are floors:
10 pathogenic, 3 conflicting classifications of pathogenicity, 3 uncertain significance, 2 benign/likely benign, 1 benign, 1 likely pathogenic, 1 likely benign
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 548649 | NM_006121.4(KRT1):c.1865dup (p.Val623fs) | KRT1 | Pathogenic | no assertion criteria provided |
| 1236189 | NM_000421.5(KRT10):c.1374-1G>C | KRT10 | Pathogenic | no assertion criteria provided |
| 1236190 | NM_000421.5(KRT10):c.1373+1del | KRT10 | Pathogenic | no assertion criteria provided |
| 1236191 | NM_000421.5(KRT10):c.1403_1417delinsA (p.Ser468fs) | KRT10 | Pathogenic | no assertion criteria provided |
| 1299620 | NM_000421.5(KRT10):c.470T>C (p.Leu157Pro) | KRT10 | Pathogenic | criteria provided, single submitter |
| 14576 | NM_000421.5(KRT10):c.466C>T (p.Arg156Cys) | KRT10 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 14581 | NM_000421.5(KRT10):c.1374-2A>G | KRT10 | Pathogenic | no assertion criteria provided |
| 14582 | NM_000421.5(KRT10):c.1373+1G>A | KRT10 | Pathogenic | criteria provided, single submitter |
| 14583 | NM_000421.5(KRT10):c.1449dup (p.Gly484fs) | KRT10 | Pathogenic | no assertion criteria provided |
| 14584 | NM_000421.5(KRT10):c.1560_1561del (p.Gly521fs) | KRT10 | Pathogenic | criteria provided, single submitter |
| 2431374 | NM_000421.5(KRT10):c.1374-1G>A | KRT10 | Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 1049274 | NM_000421.5(KRT10):c.1654AGCTCCGGCGGCGGATACGGCGGCGGCAGC[3] (p.556GYGGGSSSGG[3]) | KRT10 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 808260 | NM_000421.5(KRT10):c.1639_1653dup (p.543GGGSS[3]) | KRT10 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 1186831 | NM_000421.5(KRT10):c.49GGA[9] (p.Gly24dup) | KRT10-AS1 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 3891517 | NM_000421.5(KRT10):c.1676G>T (p.Gly559Val) | KRT10 | Uncertain significance | criteria provided, single submitter |
| 3891518 | NM_000421.5(KRT10):c.1650_1667dup (p.Gly556_Tyr557insSerSerSerGlyGlyGly) | KRT10 | Uncertain significance | criteria provided, single submitter |
| 3891519 | NM_000421.5(KRT10):c.1460_1461insGTTC (p.His487fs) | KRT10 | Uncertain significance | criteria provided, single submitter |
| 1300082 | NM_000421.5(KRT10):c.1459C>T (p.His487Tyr) | KRT10 | Benign | criteria provided, multiple submitters, no conflicts |
| 2500052 | NM_000421.5(KRT10):c.1749-10A>G | KRT10 | Likely benign | criteria provided, single submitter |
| 516735 | NM_000421.5(KRT10):c.1654_1683dup (p.Gly556_Gly565dup) | KRT10 | Benign/Likely benign | criteria provided, multiple submitters, no conflicts |
| 66171 | NM_000421.5(KRT10):c.376G>A (p.Gly126Ser) | KRT10-AS1 | Benign/Likely benign | criteria provided, multiple submitters, no conflicts |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 33 · Orphanet: 12 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
GenCC gene–disease validity (cohort genes)
the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.
| Gene | Classification | Inheritance | Disease | Records |
|---|---|---|---|---|
| KRT10 | Strong | Autosomal dominant | congenital reticular ichthyosiform erythroderma | 15 |
| KRT1 | Supportive | Autosomal dominant | congenital reticular ichthyosiform erythroderma | 18 |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| KRT1 | Orphanet:2199 | Epidermolytic palmoplantar keratoderma |
| KRT1 | Orphanet:281139 | Annular epidermolytic ichthyosis |
| KRT1 | Orphanet:281190 | Congenital reticular ichthyosiform erythroderma |
| KRT1 | Orphanet:312 | Autosomal dominant epidermolytic ichthyosis |
| KRT1 | Orphanet:50942 | Striate palmoplantar keratoderma |
| KRT1 | Orphanet:530838 | KRT1-related diffuse nonepidermolytic keratoderma |
| KRT1 | Orphanet:538574 | Palmoplantar keratoderma-hereditary motor and sensory neuropathy syndrome |
| KRT1 | Orphanet:79503 | Ichthyosis hystrix of Curth-Macklin |
| KRT10 | Orphanet:281139 | Annular epidermolytic ichthyosis |
| KRT10 | Orphanet:281190 | Congenital reticular ichthyosiform erythroderma |
| KRT10 | Orphanet:312 | Autosomal dominant epidermolytic ichthyosis |
| KRT10 | Orphanet:512103 | Autosomal recessive epidermolytic ichthyosis |
Cohort genes → proteins
3 cohort genes, 3 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| multi_evidence | 3 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| KRT1 | HGNC:6412 | ENSG00000167768 | P04264 | Keratin, type II cytoskeletal 1 | gencc,clinvar |
| KRT10 | HGNC:6413 | ENSG00000186395 | P13645 | Keratin, type I cytoskeletal 10 | gencc,clinvar |
| KRT10-AS1 | HGNC:28305 | ENSG00000167920 | Q8N816 | Uncharacterized protein KRT10-AS1 | clinvar |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| KRT1 | Keratin, type II cytoskeletal 1 | May regulate the activity of kinases such as PKC and SRC via binding to integrin beta-1 (ITB1) and the receptor of activated protein C kinase 1 (RACK1). |
| KRT10 | Keratin, type I cytoskeletal 10 | Plays a role in the establishment of the epidermal barrier on plantar skin. |
Protein-family classification
Druggable: 0 · Difficult: 0 · Unknown: 3 · Druggable fraction: 0.0
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Other/Unknown | 3 | 1.8× | 0.174 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| KRT1 | Other/Unknown | no | Keratin_II, IF_conserved, Keratin_2_head | |
| KRT10 | Other/Unknown | no | Keratin_I, IF_conserved, IF_rod_dom | |
| KRT10-AS1 | Other/Unknown | no |
Expression context
Cohort genes with no expression data: 0.
3 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 3 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| mammalian vulva | 2 |
| upper leg skin | 2 |
| skin of hip | 1 |
| penis | 1 |
| left testis | 1 |
| pancreatic ductal cell | 1 |
| right testis | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| KRT1 | 177 | tissue_specific | marker | mammalian vulva, upper leg skin, skin of hip |
| KRT10 | 299 | broad | marker | upper leg skin, penis, mammalian vulva |
| KRT10-AS1 | 234 | ubiquitous | marker | left testis, right testis, pancreatic ductal cell |
Protein interactions among cohort
Intra-cohort edges: 1.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| KRT1 | 2,716 |
| KRT10 | 2,304 |
| KRT10-AS1 | 2 |
Intra-cohort edges
| A | B | Sources |
|---|---|---|
| KRT1 | KRT10 | biogrid_interaction, intact, string_interaction |
Structural data
PDB: 2 · AlphaFold-only: 1 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| KRT10 | P13645 | 6 |
| KRT1 | P04264 | 3 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|---|---|
| KRT10-AS1 | Q8N816 | 46.64 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 10. Enrichment computed across 3 evidence-associated genes (2 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Differentiation of Keratinocytes in Interfollicular Epidermis in Mammalian Skin | 2 | 278.5× | 1e-04 | KRT1, KRT10 |
| Developmental Cell Lineages | 2 | 223.9× | 1e-04 | KRT1, KRT10 |
| Formation of the cornified envelope | 2 | 87.8× | 4e-04 | KRT1, KRT10 |
| Keratinization | 2 | 55.7× | 8e-04 | KRT1, KRT10 |
| Regulation of FXIIa and plasma kallikrein activity | 1 | 571.0× | 0.004 | KRT1 |
| Developmental Biology | 2 | 14.5× | 0.008 | KRT1, KRT10 |
| FXIIa activates plasma kallikrein-kinin system | 1 | 86.5× | 0.016 | KRT1 |
| Innate Immune System | 1 | 12.8× | 0.094 | KRT1 |
| Neutrophil degranulation | 1 | 11.5× | 0.094 | KRT1 |
| Immune System | 1 | 6.5× | 0.148 | KRT1 |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| protein heterotetramerization | 2 | 1053.2× | 5e-06 | KRT1, KRT10 |
| cornification | 2 | 1053.2× | 5e-06 | KRT1, KRT10 |
| intermediate filament organization | 2 | 240.7× | 7e-05 | KRT1, KRT10 |
| positive regulation of epidermis development | 1 | 1685.2× | 0.002 | KRT10 |
| complement activation, lectin pathway | 1 | 842.6× | 0.003 | KRT1 |
| fibrinolysis | 1 | 421.3× | 0.005 | KRT1 |
| establishment of skin barrier | 1 | 227.7× | 0.008 | KRT1 |
| regulation of angiogenesis | 1 | 210.7× | 0.008 | KRT1 |
| morphogenesis of an epithelium | 1 | 172.0× | 0.008 | KRT10 |
| keratinocyte differentiation | 1 | 123.9× | 0.010 | KRT10 |
| keratinization | 1 | 117.0× | 0.010 | KRT1 |
| negative regulation of inflammatory response | 1 | 68.5× | 0.015 | KRT1 |
| response to oxidative stress | 1 | 65.3× | 0.015 | KRT1 |
Therapeutics
Drug target analysis
Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 3
Druggability breadth: 0 of 3 evidence-associated genes (0%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| KRT1 | 0 | 0 |
| KRT10 | 0 | 0 |
| KRT10-AS1 | 0 | 0 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 0.
Pharmacogenomics
Cohort genes with a PharmGKB record: 2; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 0 | |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 0 | |
| D | Druggable family + AlphaFold only, no drug | 0 | |
| E | Difficult family or no structure, no drug | 3 | KRT1, KRT10, KRT10-AS1 |
Undrugged target profiles
3 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| KRT1 | 0 | — |
| KRT10 | 0 | — |
| KRT10-AS1 | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 0.