Cutaneous leishmaniasis
disease diseaseOn this page
Also known as Asian desert cutaneous leishmaniasiszone of skin leishmaniasis
Summary
Cutaneous leishmaniasis (MONDO:0005446) is a disease with 15 cohort genes (14 GWAS associations across 1 studies) and 52 clinical trials. Top therapeutic interventions include paromomycin, miltefosine, and sodium stibogluconate.
At a glance
- Cohort genes: 15
- GWAS associations: 14
- Clinical trials: 52
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | cutaneous leishmaniasis |
| Mondo ID | MONDO:0005446 |
| EFO | EFO:0005046 |
| MeSH | D016773 |
| DOID | DOID:9111 |
| ICD-10-CM | B55.1 |
| ICD-11 | 124737785 |
| NCIT | C34768, C34770 |
| SNOMED CT | 186807008 |
| UMLS | C0023283 |
| MedGen | 9715 |
| GARD | 0024189 |
| Anatomy (UBERON) | UBERON:0000014 |
| Is cancer (heuristic) | no |
Also known as: Asian desert cutaneous leishmaniasis · zone of skin leishmaniasis
Data availability: 14 GWAS associations (1 study).
Disease family
An umbrella term covering 1 Mondo subtype.
Classification path: disease › human disease › disease by etiologic mechanism › disease of primarily extrinsic mechanism › infectious disease › parasitic infectious disease › protozoa infectious disease › leishmaniasis › cutaneous leishmaniasis
Related subtypes (2): visceral leishmaniasis, mucocutaneous leishmaniasis
Subtypes (1): leishmaniasis, diffuse cutaneous
Genetics & variants
GWAS landscape
14 GWAS associations across 1 studies. Top hits map to 13 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|---|---|---|---|
| rs13261618 | 1e-06 | PXDNL | A | 0.87 |
| rs1383086 | 2e-06 | ZNF385D | T | 0.85 |
| rs8084306 | 2e-06 | SERPINB10 | C | 1.07 |
| rs77563142 | 2e-06 | TSPAN9 - LINC02827 | G | 1.28 |
| rs4939853 | 2e-06 | DYM | G | 1.09 |
| rs1239627205 | 3e-06 | CHKB | G | 1.09 |
| rs143586968 | 3e-06 | CALCR | T | 1.16 |
| rs3848610 | 5e-06 | PPP6R1 | T | 0.84 |
| rs75270613 | 5e-06 | CRLF3 | T | 0.83 |
| rs8090418 | 6e-06 | TCF4 | T | 0.91 |
| rs144488134 | 6e-06 | STX7 | A | 0.82 |
| rs74285558 | 7e-06 | LAMP3 | T | 0.87 |
| rs10783496 | 7e-06 | LINC00592 | A | 1.06 |
| rs201555201 | 9e-06 | S100B | TAGATGTTAAAA | 1.06 |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|---|---|---|---|---|
| GCST011739 | Castellucci LC | 2020 | 2,066 | 2,046 | A Genome-Wide Association Study Identifies SERPINB10, CRLF3, STX7, LAMP3, IFNG-AS1 and KRT80 As Risk Loci Contributing to Cutaneous Leishmaniasis In Brazil. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|---|
| Tier 1: coding | 0 |
| Tier 2: splice/UTR | 0 |
| Tier 3: regulatory | 1 |
| Tier 4: intronic/intergenic | 13 |
MAF distribution
| Bucket | Variants |
|---|---|
| common (>=0.05) | 10 |
| low_freq (0.01-0.05) | 0 |
| rare (<0.01) | 0 |
| unknown | 4 |
Functional consequences
| Consequence | Count |
|---|---|
| intron_variant | 12 |
| intergenic_variant | 1 |
| regulatory_region_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|---|---|---|---|---|---|---|---|
| rs13261618 | 8 | 51716260 | G>A | 0.05 | intron_variant | PXDNL | 1e-06 | Tier 4: intronic/intergenic |
| rs1383086 | 3 | 22076244 | A>G,T | 0.05 | intron_variant | ZNF385D | 2e-06 | Tier 4: intronic/intergenic |
| rs8084306 | 18 | 63931529 | T>C | 0.05 | intron_variant | SERPINB10 | 2e-06 | Tier 4: intronic/intergenic |
| rs77563142 | 12 | 3288238 | A>G,T | intergenic_variant | TSPAN9 - LINC02827 | 2e-06 | Tier 4: intronic/intergenic | |
| rs4939853 | 18 | 49239784 | A>G,T | 0.05 | intron_variant | DYM | 2e-06 | Tier 4: intronic/intergenic |
| rs1239627205 | 22 | 50600379 | GCGCGGCGGCGCAGCTCCCGGGGCCGCCCCGGCCTCT>G | regulatory_region_variant | CHKB | 3e-06 | Tier 3: regulatory | |
| rs143586968 | 7 | 93435767 | C>T | 0.05 | intron_variant | CALCR | 3e-06 | Tier 4: intronic/intergenic |
| rs3848610 | 19 | 55250857 | T>A,C | 0.05 | intron_variant | PPP6R1 | 5e-06 | Tier 4: intronic/intergenic |
| rs75270613 | 17 | 30809108 | C>T | 0.05 | intron_variant | CRLF3 | 5e-06 | Tier 4: intronic/intergenic |
| rs8090418 | 18 | 55288444 | C>T | 0.05 | intron_variant | TCF4 | 6e-06 | Tier 4: intronic/intergenic |
| rs144488134 | 6 | 132494423 | C>A | intron_variant | STX7 | 6e-06 | Tier 4: intronic/intergenic | |
| rs74285558 | 3 | 183139473 | C>A,T | 0.05 | intron_variant | LAMP3 | 7e-06 | Tier 4: intronic/intergenic |
| rs10783496 | 12 | 52196220 | A>C,G | 0.05 | intron_variant | LINC00592 | 7e-06 | Tier 4: intronic/intergenic |
| rs201555201 | 21 | 46603727 | T>A | intron_variant | S100B | 9e-06 | Tier 4: intronic/intergenic |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 8 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| TCF4 | Orphanet:171 | Primary sclerosing cholangitis |
| TCF4 | Orphanet:178469 | Autosomal dominant non-syndromic intellectual disability |
| TCF4 | Orphanet:2896 | Pitt-Hopkins syndrome |
| TCF4 | Orphanet:98974 | Fuchs endothelial corneal dystrophy |
| CHKB | Orphanet:280671 | Megaconial congenital muscular dystrophy |
| CHKB | Orphanet:521305 | Proximal myopathy with focal depletion of mitochondria |
| DYM | Orphanet:178355 | Smith-McCort dysplasia |
| DYM | Orphanet:239 | Dyggve-Melchior-Clausen disease |
Cohort genes → proteins
15 cohort genes, 15 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| gwas_only | 15 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| S100B | HGNC:10500 | ENSG00000160307 | P04271 | Protein S100-B | gwas |
| STX7 | HGNC:11442 | ENSG00000079950 | O15400 | Syntaxin-7 | gwas |
| TCF4 | HGNC:11634 | ENSG00000196628 | P15884 | Transcription factor 4 | gwas |
| CALCR | HGNC:1440 | ENSG00000004948 | P30988 | Calcitonin receptor | gwas |
| LAMP3 | HGNC:14582 | ENSG00000078081 | Q9UQV4 | Lysosome-associated membrane glycoprotein 3 | gwas |
| CRLF3 | HGNC:17177 | ENSG00000176390 | Q8IUI8 | Cytokine receptor-like factor 3 | gwas |
| CHKB | HGNC:1938 | ENSG00000100288 | Q9Y259 | Choline/ethanolamine kinase | gwas |
| DYM | HGNC:21317 | ENSG00000141627 | Q7RTS9 | Dymeclin | gwas |
| TSPAN9 | HGNC:21640 | ENSG00000011105 | O75954 | Tetraspanin-9 | gwas |
| ZNF385D | HGNC:26191 | ENSG00000151789 | Q9H6B1 | Zinc finger protein 385D | gwas |
| PXDNL | HGNC:26359 | ENSG00000147485 | A1KZ92 | Probable oxidoreductase PXDNL | gwas |
| KRT80 | HGNC:27056 | ENSG00000167767 | Q6KB66 | Keratin, type II cytoskeletal 80 | gwas |
| PPP6R1 | HGNC:29195 | ENSG00000105063 | Q9UPN7 | Serine/threonine-protein phosphatase 6 regulatory subunit 1 | gwas |
| MAPK8IP2 | HGNC:6883 | ENSG00000008735 | Q13387 | C-Jun-amino-terminal kinase-interacting protein 2 | gwas |
| SERPINB10 | HGNC:8942 | ENSG00000242550 | P48595 | Serpin B10 | gwas |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| S100B | Protein S100-B | Small zinc- and- and calcium-binding protein that is highly expressed in astrocytes and constitutes one of the most abundant soluble proteins in brain. |
| STX7 | Syntaxin-7 | May be involved in protein trafficking from the plasma membrane to the early endosome (EE) as well as in homotypic fusion of endocytic organelles. |
| TCF4 | Transcription factor 4 | Transcription factor that binds to the immunoglobulin enhancer Mu-E5/KE5-motif. |
| CALCR | Calcitonin receptor | G protein-coupled receptor activated by ligand peptides amylin (IAPP), calcitonin (CT/CALCA) and calcitonin gene-related peptide type 1 (CGRP1/CALCA). |
| LAMP3 | Lysosome-associated membrane glycoprotein 3 | Lysosomal membrane glycoprotein which plays a role in the unfolded protein response (UPR) that contributes to protein degradation and cell survival during proteasomal dysfunction. |
| CRLF3 | Cytokine receptor-like factor 3 | May play a role in the negative regulation of cell cycle progression. |
| CHKB | Choline/ethanolamine kinase | Has a key role in phospholipid metabolism, and catalyzes the first step of phosphatidylethanolamine and phosphatidylcholine biosynthesis. |
| DYM | Dymeclin | Necessary for correct organization of Golgi apparatus. |
| PXDNL | Probable oxidoreductase PXDNL | Probable oxidoreductase. |
| PPP6R1 | Serine/threonine-protein phosphatase 6 regulatory subunit 1 | Regulatory subunit of protein phosphatase 6 (PP6). |
| MAPK8IP2 | C-Jun-amino-terminal kinase-interacting protein 2 | The JNK-interacting protein (JIP) group of scaffold proteins selectively mediates JNK signaling by aggregating specific components of the MAPK cascade to form a functional JNK signaling module. |
| SERPINB10 | Serpin B10 | Protease inhibitor that may play a role in the regulation of protease activities during hematopoiesis and apoptosis induced by TNF. |
Protein-family classification
Druggable: 4 · Difficult: 3 · Unknown: 8 · Druggable fraction: 0.27
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Antibody/Immunoglobulin | 2 | 3.9× | 0.550 |
| Kinase | 1 | 1.9× | 0.677 |
| GPCR | 1 | 1.6× | 0.677 |
| Scaffold/PPI | 1 | 1.1× | 0.677 |
| Transcription factor | 2 | 1.1× | 0.677 |
| Other/Unknown | 8 | 1.0× | 0.677 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| S100B | Other/Unknown | no | S100/CaBP7/8-like_CS, EF_hand_dom, EF-hand-dom_pair | |
| STX7 | Other/Unknown | no | T_SNARE_dom, Syntaxin_N, Syntaxin/epimorphin_CS | |
| TCF4 | Transcription factor | no | 7.6.2.3 | bHLH_dom, HLH_DNA-bd_sf, NeuroDiff_E-box_TFs |
| CALCR | GPCR | yes | GPCR_2_secretin-like, GPCR_2_calcitonin_rcpt, GPCR_2_extracellular_dom | |
| LAMP3 | Other/Unknown | no | Lysosome-assoc_membr_glycop, Lamp2-like_luminal | |
| CRLF3 | Antibody/Immunoglobulin | yes | FN3_dom, Ig-like_fold, FN3_sf | |
| CHKB | Kinase | yes | 2.7.1.32 | Kinase-like_dom_sf |
| DYM | Other/Unknown | no | Dymeclin | |
| TSPAN9 | Other/Unknown | no | Tetraspanin_animals, Tetraspanin_EC2_sf, Tetraspanin/Peripherin | |
| ZNF385D | Transcription factor | no | Matrin/U1-like-C_Znf_C2H2, Znf_C2H2_type, Znf_C2H2_sf | |
| PXDNL | Antibody/Immunoglobulin | yes | 1.11.1.7 | Cys-rich_flank_reg_C, VWF_dom, Leu-rich_rpt |
| KRT80 | Other/Unknown | no | Keratin_II, IF_rod_dom | |
| PPP6R1 | Other/Unknown | no | SAPS, ARM-type_fold | |
| MAPK8IP2 | Scaffold/PPI | no | SH3_domain, PTB/PI_dom, PH-like_dom_sf | |
| SERPINB10 | Other/Unknown | no | Serpin_fam, Serpin_CS, Serpin_dom |
Expression context
Cohort genes with no expression data: 0.
15 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 15 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| endothelial cell | 2 |
| granulocyte | 2 |
| bone marrow cell | 2 |
| apex of heart | 2 |
| cerebellar hemisphere | 2 |
| C1 segment of cervical spinal cord | 1 |
| inferior vagus X ganglion | 1 |
| olfactory bulb | 1 |
| cortical plate | 1 |
| monocyte | 1 |
| pericardium | 1 |
| skin of hip | 1 |
| endometrium epithelium | 1 |
| hair follicle | 1 |
| tibia | 1 |
| lower lobe of lung | 1 |
| sperm | 1 |
| visceral pleura | 1 |
| leukocyte | 1 |
| mononuclear cell | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| S100B | 230 | broad | marker | C1 segment of cervical spinal cord, inferior vagus X ganglion, olfactory bulb |
| STX7 | 293 | ubiquitous | marker | cortical plate, endothelial cell, monocyte |
| TCF4 | 292 | ubiquitous | marker | endothelial cell, skin of hip, pericardium |
| CALCR | 71 | tissue_specific | marker | tibia, endometrium epithelium, hair follicle |
| LAMP3 | 199 | broad | marker | lower lobe of lung, sperm, visceral pleura |
| CRLF3 | 287 | ubiquitous | marker | trabecular bone tissue, mononuclear cell, leukocyte |
| CHKB | 134 | ubiquitous | marker | pituitary gland, granulocyte, adenohypophysis |
| DYM | 254 | ubiquitous | marker | bone marrow cell, embryo, ganglionic eminence |
| TSPAN9 | 270 | ubiquitous | marker | apex of heart, cerebellar hemisphere, cerebellar cortex |
| ZNF385D | 221 | broad | marker | descending thoracic aorta, ascending aorta, thoracic aorta |
| PXDNL | 134 | tissue_specific | marker | cardiac muscle of right atrium, cardiac atrium, apex of heart |
| KRT80 | 170 | broad | marker | skin of abdomen, upper arm skin, skin of leg |
| PPP6R1 | 134 | ubiquitous | marker | left testis, right testis, granulocyte |
| MAPK8IP2 | 204 | broad | marker | Brodmann (1909) area 10, right hemisphere of cerebellum, cerebellar hemisphere |
| SERPINB10 | 88 | broad | marker | bone marrow, bone marrow cell, type B pancreatic cell |
Protein interactions among cohort
Intra-cohort edges: 0.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| PXDNL | 9,051 |
| TCF4 | 3,342 |
| S100B | 3,175 |
| STX7 | 3,037 |
| MAPK8IP2 | 1,849 |
| PPP6R1 | 1,716 |
| LAMP3 | 1,527 |
| CALCR | 1,390 |
| DYM | 1,298 |
| CHKB | 1,154 |
Structural data
PDB: 6 · AlphaFold-only: 9 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| CALCR | P30988 | 32 |
| S100B | P04271 | 15 |
| TCF4 | P15884 | 5 |
| CHKB | Q9Y259 | 3 |
| LAMP3 | Q9UQV4 | 1 |
| MAPK8IP2 | Q13387 | 1 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|---|---|
| CRLF3 | Q8IUI8 | 90.15 |
| TSPAN9 | O75954 | 89.65 |
| SERPINB10 | P48595 | 88.99 |
| DYM | Q7RTS9 | 87.91 |
| PXDNL | A1KZ92 | 81.78 |
| STX7 | O15400 | 78.96 |
| KRT80 | Q6KB66 | 76.93 |
| PPP6R1 | Q9UPN7 | 67.96 |
| ZNF385D | Q9H6B1 | 62.68 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 49. Enrichment computed across 15 evidence-associated genes (7 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 7 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Calcitonin-like ligand receptors | 1 | 148.3× | 0.069 | CALCR |
| Synthesis of PE | 1 | 125.5× | 0.069 | CHKB |
| Advanced glycosylation endproduct receptor signaling | 1 | 102.0× | 0.069 | S100B |
| TRAF6 mediated NF-kB activation | 1 | 65.3× | 0.069 | S100B |
| TGFBR3 expression | 1 | 65.3× | 0.069 | TCF4 |
| Synthesis of PC | 1 | 58.3× | 0.069 | CHKB |
| Myogenesis | 1 | 54.4× | 0.069 | TCF4 |
| Signaling by TGFBR3 | 1 | 52.6× | 0.069 | TCF4 |
| Nuclear signaling by ERBB4 | 1 | 49.4× | 0.069 | S100B |
| TAK1-dependent IKK and NF-kappa-B activation | 1 | 42.9× | 0.069 | S100B |
| Signaling by ERBB4 | 1 | 38.8× | 0.069 | S100B |
| Interleukin-1 family signaling | 1 | 38.8× | 0.069 | S100B |
| DDX58/IFIH1-mediated induction of interferon-alpha/beta | 1 | 36.2× | 0.069 | S100B |
| Toll Like Receptor 10 (TLR10) Cascade | 1 | 30.8× | 0.069 | S100B |
| Toll Like Receptor 5 (TLR5) Cascade | 1 | 30.8× | 0.069 | S100B |
| MyD88 cascade initiated on plasma membrane | 1 | 29.1× | 0.069 | S100B |
| Toll Like Receptor 3 (TLR3) Cascade | 1 | 27.6× | 0.069 | S100B |
| Class B/2 (Secretin family receptors) | 1 | 27.2× | 0.069 | CALCR |
| TRIF (TICAM1)-mediated TLR4 signaling | 1 | 27.2× | 0.069 | S100B |
| TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation | 1 | 27.2× | 0.069 | S100B |
| MyD88 dependent cascade initiated on endosome | 1 | 27.2× | 0.069 | S100B |
| MyD88-independent TLR4 cascade | 1 | 26.3× | 0.069 | S100B |
| Toll Like Receptor 7/8 (TLR7/8) Cascade | 1 | 26.3× | 0.069 | S100B |
| Toll Like Receptor 9 (TLR9) Cascade | 1 | 25.1× | 0.069 | S100B |
| Toll Like Receptor TLR6:TLR2 Cascade | 1 | 25.1× | 0.069 | S100B |
| Toll Like Receptor 2 (TLR2) Cascade | 1 | 24.7× | 0.069 | S100B |
| Toll Like Receptor TLR1:TLR2 Cascade | 1 | 24.0× | 0.069 | S100B |
| COPII-mediated vesicle transport | 1 | 23.3× | 0.069 | PPP6R1 |
| Innate Immune System | 2 | 7.3× | 0.069 | S100B, SERPINB10 |
| Signal Transduction | 3 | 4.4× | 0.069 | S100B, TCF4, CALCR |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 13 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| nonassociative learning | 1 | 1296.3× | 0.018 | MAPK8IP2 |
| receptor diffusion trapping | 1 | 1296.3× | 0.018 | TSPAN9 |
| regulation of viral life cycle | 1 | 1296.3× | 0.018 | LAMP3 |
| response to glucocorticoid | 2 | 49.9× | 0.018 | S100B, CALCR |
| calcitonin family receptor signaling pathway | 1 | 648.1× | 0.020 | CALCR |
| negative regulation of skeletal muscle cell differentiation | 1 | 648.1× | 0.020 | S100B |
| protein-DNA complex assembly | 1 | 432.1× | 0.020 | TCF4 |
| organelle localization | 1 | 324.1× | 0.020 | STX7 |
| amylin receptor 3 signaling pathway | 1 | 324.1× | 0.020 | CALCR |
| positive regulation of receptor localization to synapse | 1 | 324.1× | 0.020 | STX7 |
| CDP-choline pathway | 1 | 259.3× | 0.020 | CHKB |
| system development | 1 | 259.3× | 0.020 | PXDNL |
| amylin receptor signaling pathway | 1 | 259.3× | 0.020 | CALCR |
| amylin receptor 1 signaling pathway | 1 | 259.3× | 0.020 | CALCR |
| amylin receptor 2 signaling pathway | 1 | 259.3× | 0.020 | CALCR |
| mating behavior | 1 | 216.1× | 0.020 | MAPK8IP2 |
| organelle assembly | 1 | 216.1× | 0.020 | STX7 |
| response to anesthetic | 1 | 216.1× | 0.020 | S100B |
| sympathetic neuron projection extension | 1 | 216.1× | 0.020 | S100B |
| mitocytosis | 1 | 216.1× | 0.020 | TSPAN9 |
| calcitonin gene-related peptide receptor signaling pathway | 1 | 216.1× | 0.020 | CALCR |
| positive regulation of neuron differentiation | 2 | 30.5× | 0.020 | S100B, TCF4 |
| response to methylmercury | 1 | 185.2× | 0.022 | S100B |
| signal complex assembly | 1 | 162.0× | 0.023 | MAPK8IP2 |
| modulation of excitatory postsynaptic potential | 1 | 162.0× | 0.023 | MAPK8IP2 |
| phosphatidylethanolamine biosynthetic process | 1 | 144.0× | 0.023 | CHKB |
| basement membrane assembly | 1 | 144.0× | 0.023 | PXDNL |
| establishment of protein localization to organelle | 1 | 144.0× | 0.023 | LAMP3 |
| response to interferon-alpha | 1 | 129.6× | 0.025 | LAMP3 |
| neutrophil homeostasis | 1 | 117.8× | 0.027 | TSPAN9 |
Therapeutics
Drugs indicated or in trials for this disease
1 approved drug — disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
| Drug | Status |
|---|---|
| Miltefosine | Approved (phase 4) |
11 drugs in clinical trials for this disease (phase 2–3, investigational): efficacy not established — a trial record, not an indication.
| Drug | Highest phase |
|---|---|
| Fluconazole | Phase 3 |
| Imiquimod | Phase 3 |
| Meglumine Antimonate | Phase 3 |
| Nitric Oxide | Phase 3 |
| Paromomycin | Phase 3 |
| ANTIMONY CATION (5+) | Phase 2 |
| Antimony | Phase 2 |
| Gentamicin | Phase 2 |
| Pentoxifylline | Phase 2 |
| Sargramostim | Phase 2 |
| Tofacitinib | Phase 2 |
Drug target analysis
Approved (phase 4): 2 · Phase ≥3: 2 · Phased (≥1): 4 · Undrugged: 11
Druggability breadth: 6 of 15 evidence-associated genes (40%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|---|
| S100B | PENTAMIDINE |
| CALCR | PRAMLINTIDE |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| CALCR | 3 | 4 |
| S100B | 1 | 4 |
| TCF4 | 1 | 2 |
| SERPINB10 | 1 | 2 |
| STX7 | 0 | 0 |
| LAMP3 | 0 | 0 |
| CRLF3 | 0 | 0 |
| CHKB | 0 | 0 |
| DYM | 0 | 0 |
| TSPAN9 | 0 | 0 |
Drugs targeting cohort genes (top 30)
| Molecule | Max phase | Targets in cohort |
|---|---|---|
| PENTAMIDINE | 4 | S100B |
| PRAMLINTIDE | 4 | CALCR |
| CALCITONIN SALMON | 4 | CALCR |
| CAGRILINTIDE | 3 | CALCR |
| SALINOMYCIN | 2 | TCF4 |
| MOLIBRESIB | 2 | SERPINB10 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 3.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| CALCR | 34 | Binding:24, Functional:10 |
| TCF4 | 31 | Binding:31 |
| CHKB | 11 | Binding:11 |
| S100B | 6 | Binding:6 |
| SERPINB10 | 6 | Binding:6 |
| PPP6R1 | 2 | Binding:2 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|---|---|
| TCF4 | 7.6.2.3 | ABC-type glutathione-S-conjugate transporter |
| CHKB | 2.7.1.32 | choline kinase |
| PXDNL | 1.11.1.7 | peroxidase |
Pharmacogenomics
Cohort genes with a PharmGKB record: 15; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
6 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
| Compound | Max phase | Cohort target (bioactivity) |
|---|---|---|
| PENTAMIDINE | 4 | S100B |
| PRAMLINTIDE | 4 | CALCR |
| CALCITONIN SALMON | 4 | CALCR |
| CAGRILINTIDE | 3 | CALCR |
| SALINOMYCIN | 2 | TCF4 |
| MOLIBRESIB | 2 | SERPINB10 |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 2 | S100B, CALCR |
| B | Phased (≥1) drug, not yet approved | 2 | TCF4, SERPINB10 |
| C | Druggable family + PDB, no drug | 1 | CHKB |
| D | Druggable family + AlphaFold only, no drug | 2 | CRLF3, PXDNL |
| E | Difficult family or no structure, no drug | 8 | STX7, LAMP3, DYM, TSPAN9, ZNF385D, KRT80, PPP6R1, MAPK8IP2 |
Undrugged target profiles
11 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| STX7 | 0 | — |
| LAMP3 | 0 | — |
| CRLF3 | 0 | — |
| CHKB | 11 | — |
| DYM | 0 | — |
| TSPAN9 | 0 | — |
| ZNF385D | 0 | — |
| PXDNL | 0 | — |
| KRT80 | 0 | — |
| PPP6R1 | 2 | — |
| MAPK8IP2 | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 52.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| PHASE2 | 19 |
| Not specified | 11 |
| PHASE3 | 10 |
| PHASE2/PHASE3 | 4 |
| PHASE4 | 3 |
| PHASE1 | 3 |
| PHASE1/PHASE2 | 1 |
| EARLY_PHASE1 | 1 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT00317980 | PHASE4 | COMPLETED | Safety and Efficacy of Low-Dose Pentavalent Antimony for Treatment of Cutaneous Leishmaniasis |
| NCT01462500 | PHASE4 | COMPLETED | Pharmacokinetics of Miltefosine in Children and Adults |
| NCT01661296 | PHASE4 | COMPLETED | Efficacy of Radio-frequency Induced Heat (RFH)Therapy in Treatment of Cutaneous Leishmaniasis in India |
| NCT00257530 | PHASE3 | COMPLETED | Imiquimod Plus Antimony Immunochemotherapy for Cutaneous Leishmaniasis |
| NCT00317629 | PHASE3 | TERMINATED | Controlled Nitric Oxide Releasing Patch Versus Meglumine Antimoniate in the Treatment of Cutaneous Leishmaniasis |
| NCT00351520 | PHASE3 | COMPLETED | Efficacy Trial on Oral Miltefosine in Comparison With Glucantime in the Treatment of ACL Caused by L. Tropica |
| NCT00471705 | PHASE3 | COMPLETED | Efficacy and Safety of Miltefosine or Thermotherapy for Cutaneous Leishmaniasis in Colombia. |
| NCT00487253 | PHASE3 | UNKNOWN | Oral Miltefosine for the Treatment of Pediatric Cutaneous Leishmaniasis in Colombia |
| NCT00606580 | PHASE3 | COMPLETED | Phase 3 Study to Evaluate WR 279,396 vs. Paromomycin Alone to Treat Cutaneous Leishmaniasis (in Tunisia) |
| NCT00682656 | PHASE2/PHASE3 | TERMINATED | Safety and Efficacy of Azithromycin to Treat Cutaneous Leishmaniasis |
| NCT01301924 | PHASE2/PHASE3 | COMPLETED | Comparison of Standard and Alternative Antimonial Dosage in Patients With American Cutaneous Leishmaniasis |
| NCT01381055 | PHASE2/PHASE3 | COMPLETED | Antimony Plus Pentoxifylline in Cutaneous Leishmaniasis |
| NCT01464242 | PHASE2/PHASE3 | COMPLETED | Add-on Study of Pentoxifylline in Cutaneous Leishmaniasis |
| NCT01790659 | PHASE3 | COMPLETED | Phase 3 Study of Walter Reed (WR) 279,396 and Paromomycin Alone for the Treatment of Cutaneous Leishmaniasis in Panama |
| NCT01953744 | PHASE3 | TERMINATED | High Dose Fluconazole in Cutaneous Leishmaniasis in Bahia and Manaus |
| NCT03023111 | PHASE3 | COMPLETED | Miltefosine and GM-CSF in Cutaneous Leishmaniasis |
| NCT04340128 | PHASE3 | COMPLETED | Efficacy of Intra-lesional Injections of Glucantime Once a Week or Twice a Week in the Treatment of Anthroponotic Cutaneous Leishmaniasis (ACL) |
| NCT06797544 | PHASE2 | RECRUITING | Intralesional Injection of Levofloxacin for the Management of Cutaneous Leishmaniasis |
| NCT06798402 | PHASE2 | RECRUITING | Ciprofloxacin Intralesional Injection for the Treatment of Cutaneous Leishmaniasis Compared to Sodium Stibogluconate |
| NCT06798415 | PHASE2 | RECRUITING | Intralesional Injection of Metronidazole for the Management of Cutaneous Leishmaniasis |
| NCT00121862 | PHASE2 | COMPLETED | Study to Evaluate the Leish-111f + MPL-SE Vaccine in Healthy Adults Not Previously Exposed to Leishmania Parasite |
| NCT00233545 | PHASE2 | COMPLETED | Miltefosine to Treat Cutaneous Leishmaniasis in Bolivia |
| NCT00633009 | PHASE2 | COMPLETED | Safety, False-Positive Reactions and Sensitizing Properties of Leishmania Tropica Skin Test Antigen |
| NCT00657917 | PHASE2 | TERMINATED | Topical Treatment of Recalcitrant Ulcerative Old World Leishmaniasis With WR 279,396 |
| NCT00703924 | PHASE2 | COMPLETED | Topical Treatment of Cutaneous Leishmaniasis With WR 279,396: A Phase 2 Study in the Old World |
| NCT00840359 | PHASE2 | UNKNOWN | Study of the Efficacy of Daylight Activated Photodynamic Therapy in the Treatment of Cutaneous Leishmaniasis |
| NCT00884377 | PHASE2 | COMPLETED | Local Heat Therapy Versus Sodium Stibogluconate for the Treatment of Cutaneous Leishmaniasis |
| NCT00973128 | PHASE2 | COMPLETED | Reduced Doses of Antimony Plus Ranulocyte Monocyte Colony Stimulating Factor (GM-CSF) for Cutaneous Leishmaniasis |
| NCT01011309 | PHASE2 | COMPLETED | A Study of the Efficacy and Safety of the LEISH-F2 + MPL-SE Vaccine for Treatment of Cutaneous Leishmaniasis |
| NCT01050907 | PHASE2 | COMPLETED | Miltefosine to Treat Mucocutaneous Leishmaniasis |
| NCT01300975 | PHASE2 | COMPLETED | Intralesional Antimony for Bolivian Cutaneous Leishmaniasis |
| NCT01380301 | PHASE2 | TERMINATED | Treatment of Cutaneous Leishmaniasis With a Combination of Miltefosine and Antimony |
| NCT01380314 | PHASE2 | COMPLETED | Oral Miltefosine Plus Topical Imiquimod to Treat Cutaneous Leishmaniasis |
| NCT01494350 | PHASE2 | TERMINATED | WR 279,396 Open Label Treatment Protocol in Tunisia |
| NCT01845727 | PHASE1/PHASE2 | COMPLETED | Topical 3% Amphotericin B Cream for the Treatment of Cutaneous Leishmaniasis in Colombia |
| NCT01988909 | PHASE2 | COMPLETED | WR 279,396 for the Treatment of Cutaneous Leishmaniasis |
| NCT02687971 | PHASE2 | COMPLETED | Thermotherapy + a Short Course of Miltefosine for the Treatment of Uncomplicated Cutaneous Leishmaniasis in the New World¨ |
| NCT07149753 | PHASE1 | NOT_YET_RECRUITING | Pilot Study: Miltefosine Gel (G-MTF) in Patients With Cutaneous Leishmaniasis |
| NCT00001906 | PHASE1 | COMPLETED | Safety and Immunogenicity of a Vaccine for Cutaneous Leishmaniasis Using Recombinant Human Interleukin-12 and Aluminum Hydroxide Gel as Adjuvants |
| NCT00121849 | PHASE1 | COMPLETED | Safety Study to Evaluate the Leish-111f + MPL-SE Vaccine in the Prevention of Cutaneous Leishmaniasis in Healthy Subjects Previously Exposed to the Leishmania Parasite |
Drugs tested across these trials (top 30)
| Molecule | Max phase | Trials referencing |
|---|---|---|
| PAROMOMYCIN | 4 | 9 |
| MILTEFOSINE | 4 | 8 |
| SODIUM STIBOGLUCONATE | 4 | 3 |
| IMIQUIMOD | 4 | 2 |
| PENTOXIFYLLINE | 4 | 2 |
| FLUCONAZOLE | 4 | 1 |
| MEGLUMINE ANTIMONATE | 3 | 8 |
| ANTIMONY | 3 | 2 |
| ANTIMONY CATION (5+) | 3 | 1 |
| CHEMBL4537559 | 0 | 7 |
| CHEMBL454494 | 0 | 7 |
| CHEMBL2079699 | 0 | 5 |
| CHEMBL3736283 | 0 | 4 |
| CHEMBL3754364 | 0 | 4 |
| CHEMBL4075089 | 0 | 2 |
| CHEMBL4745267 | 0 | 2 |
| CHEMBL5273932 | 0 | 2 |
| CHEMBL4444260 | 0 | 1 |
Related Atlas pages
- Cohort genes: S100B, STX7, TCF4, CALCR, LAMP3, CRLF3, CHKB, DYM, TSPAN9, ZNF385D, PXDNL, KRT80, PPP6R1, MAPK8IP2, SERPINB10
- Drugs: Paromomycin, Miltefosine, Sodium Stibogluconate, Imiquimod, Pentoxifylline, Fluconazole, Meglumine Antimonate, Antimony, ANTIMONY CATION (5+)