Disorder of acid-base balance
diseaseOn this page
Summary
Disorder of acid-base balance (MONDO:0041261) is a disease with 4 GWAS associations across 13 studies. A subtype of metabolic disease — broader associated-gene and molecular evidence is on the parent page (see Disease family below).
At a glance
- GWAS associations: 4
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | disorder of acid-base balance |
| Mondo ID | MONDO:0041261 |
| SNOMED CT | 26436007 |
| UMLS | C0268029 |
| MedGen | 541141 |
| Is cancer (heuristic) | no |
Also known as: disorder of acid-base balance
Data availability: 4 GWAS associations (13 studies).
Disease family
This is a subtype of metabolic disease. Genetic, therapeutic, and trial evidence is largely curated at the broader-term level — see the parent page for the associated-gene cohort and molecular evidence.
Classification path: disease › human disease › disease by developmental or physiological process › metabolic disease › disorder of acid-base balance
Related subtypes (36): glutaric aciduria, mineral metabolism disease, xanthinuria, chondrocalcinosis, ochronosis disorder, glucose metabolism disease, diabetic kidney disease, xanthoma, diabetic retinopathy, hypertriglyceridemia, gout, lactic acidosis, acquired metabolic disease, lipodystrophy, developmental anomaly of metabolic origin, dopa-responsive dystonia, hypoalphalipoproteinemia, steroid dehydrogenase deficiency-dental anomalies syndrome, inborn errors of metabolism, vitamin B12 deficiency, proteostasis deficiencies, hyperlipidemia, disorder of GPI anchor biosynthesis, bilirubin metabolism disease, hyperlipoproteinemia, carbohydrate metabolism disease, porphyrin metabolism disease, purine metabolism disease, amino acid metabolism disease, pyrimidine metabolism disease, disorder of glutamate decarboxylase, tumor lysis syndrome, collagenous sprue, steroid metabolism disease, disorder of organic acid metabolism, skeletal fluorosis
Subtypes (1): acidosis disorder
Genetics & variants
GWAS landscape
4 GWAS associations across 13 studies. Top hits map to 2 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|---|---|---|---|
| rs1229984 | 2e-13 | ADH1B | T | 0.12 |
| rs6146296 | 4e-07 | LINC01478 - SETBP1-DT | ? | |
| rs9924554 | 8e-07 | CDYL2 | ? |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|---|---|---|---|---|
| GCST90475749 | Verma A | 2024 | 74,426 | 323,713 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90477403 | Verma A | 2024 | 24,830 | 81,326 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90479947 | Verma A | 2024 | 24,830 | 81,326 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90652212 | Liu TY | 2025 | 10,558 | 219,134 | Diversity and longitudinal records: Genetic architecture of disease associations and polygenic risk in the Taiwanese Han population. |
| GCST90477414 | Verma A | 2024 | 10,439 | 424,044 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90477401 | Verma A | 2024 | 8,476 | 44,893 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90435769 | Zhou W | 2018 | 7,455 | 401,506 | Efficiently controlling for case-control imbalance and sample relatedness in large-scale genetic association studies. |
| GCST90477413 | Verma A | 2024 | 4,455 | 112,020 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90480890 | Verma A | 2024 | 4,455 | 112,020 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90477412 | Verma A | 2024 | 1,422 | 56,474 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|---|
| Tier 1: coding | 1 |
| Tier 2: splice/UTR | 0 |
| Tier 3: regulatory | 0 |
| Tier 4: intronic/intergenic | 2 |
MAF distribution
| Bucket | Variants |
|---|---|
| common (>=0.05) | 2 |
| low_freq (0.01-0.05) | 1 |
| rare (<0.01) | 0 |
| unknown | 0 |
Functional consequences
| Consequence | Count |
|---|---|
| intron_variant | 2 |
| missense_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|---|---|---|---|---|---|---|---|
| rs1229984 | 4 | 99318162 | T>A,C,G | 0.036 | missense_variant | ADH1B | 2e-13 | Tier 1: coding |
| rs6146296 | 18 | 44663666 | TCTTCAGCAGTAGG>T,TCTTCAGCAGTAGGCTTCAGCAGTAGG | 0.05 | intron_variant | LINC01478 - SETBP1-DT | 4e-07 | Tier 4: intronic/intergenic |
| rs9924554 | 16 | 80618396 | A>C,G | 0.05 | intron_variant | CDYL2 | 8e-07 | Tier 4: intronic/intergenic |
Genes & proteins
No associated-gene cohort resolved for this disease. Atlas builds the molecular and therapeutic sections — associated genes, protein families, druggability, pathways, interactions, and drug associations — by aggregating over a disease’s associated genes (resolved via GWAS / GenCC / ClinVar / CIViC), and none resolved here. This is expected for antibody-mediated, autoimmune, or otherwise non-gene-defined conditions; the curated evidence for this disease is its clinical features, GWAS susceptibility, and clinical trials (above).
Function
No pathway enrichment — requires an associated-gene cohort.
Therapeutics
No druggable-target or therapeutic data for this disease’s cohort.
Clinical trials & evidence
Clinical trials
Clinical trials: 0.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.