Epidermolytic ichthyosis

Summary

Epidermolytic ichthyosis (MONDO:0007239) is a disease caused by variants in KRT1 and KRT10, with 4 cohort genes and 3 clinical trials. Top therapeutic interventions include secukinumab.

At a glance

• Causal genes: KRT1 (GenCC Strong), KRT10 (GenCC Strong)
• Cohort genes: 4
• ClinVar variants: 59
• Clinical trials: 3

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	epidermolytic ichthyosis
Mondo ID	MONDO:0007239
MeSH	D017488
OMIM	113800
DOID	DOID:4603
ICD-11	1183730789
SNOMED CT	254167000
UMLS	C0079153
MedGen	38179
GARD	0024537
NORD	1100
Is cancer (heuristic)	no

Also known as: autosomal dominant epidermolytic ichthyosis · BCIE · bullous congenital ichthyosiform erythroderma · bullous congenital ichthyosiform erythroderma of Brock · bullous ichthyosiform erythroderma congenita · bullous ichthyosis · congenital bullous ichthyosiform erythroderma · EHK · EI · epidermolytic hyperkeratosis · epidermolytic ichthyosis · ichthyosis hystrix Brocq type

Data availability: 59 ClinVar variants · 6 GenCC gene-disease records · 4 cell lines.

Disease family

An umbrella term covering 4 Mondo subtypes.

Classification path: disease › human disease › disease by body system or component › integumentary system disorder › skin disorder › epidermal disease › ichthyosis › inherited ichthyosis › keratinopathic ichthyosis › epidermolytic ichthyosis

Related subtypes (4): ichthyosis hystrix of Curth-Macklin, superficial epidermolytic ichthyosis, congenital reticular ichthyosiform erythroderma, epidermolytic nevus

Subtypes (4): autosomal dominant epidermolytic ichthyosis, autosomal recessive epidermolytic ichthyosis, epidermolytic hyperkeratosis 1, epidermolytic hyperkeratosis 2

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

59 retrieved; paginated sample, class counts are floors:

16 benign, 14 uncertain significance, 11 benign/likely benign, 8 pathogenic, 4 conflicting classifications of pathogenicity, 3 likely pathogenic, 1 likely benign, 1 not provided, 1 pathogenic/likely pathogenic

ClinVar	Variant (HGVS)	Gene	Classification	Review
15907	NM_006121.4(KRT1):c.931G>C (p.Glu311Gln)	KRT1	Pathogenic	no assertion criteria provided
15908	NM_006121.4(KRT1):c.482T>C (p.Leu161Pro)	KRT1	Pathogenic	criteria provided, single submitter
15913	NM_006121.4(KRT1):c.464T>A (p.Val155Asp)	KRT1	Pathogenic	no assertion criteria provided
15914	NM_006121.4(KRT1):c.564C>A (p.Asn188Lys)	KRT1	Pathogenic	criteria provided, multiple submitters, no conflicts
15921	NM_006121.4(KRT1):c.1757dup (p.Tyr587fs)	KRT1	Pathogenic	criteria provided, single submitter
432078	NM_006121.4(KRT1):c.1453C>T (p.Leu485Phe)	KRT1	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
66659	NM_006121.4(KRT1):c.623T>C (p.Leu208Pro)	KRT1	Pathogenic	no assertion criteria provided
14576	NM_000421.5(KRT10):c.466C>T (p.Arg156Cys)	KRT10	Pathogenic	criteria provided, multiple submitters, no conflicts
14573	NM_000421.5(KRT10):c.467G>A (p.Arg156His)	KRT10-AS1	Pathogenic	criteria provided, multiple submitters, no conflicts
1339265	NM_006121.4(KRT1):c.563A>T (p.Asn188Ile)	KRT1	Likely pathogenic	criteria provided, single submitter
15909	NM_006121.4(KRT1):c.1445A>G (p.Tyr482Cys)	KRT1	Likely pathogenic	criteria provided, single submitter
2501706	NM_000421.5(KRT10):c.546T>A (p.Tyr182Ter)	KRT10-AS1	Likely pathogenic	criteria provided, single submitter
309636	NM_006121.4(KRT1):c.1912A>G (p.Thr638Ala)	KRT1	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
309648	NM_006121.4(KRT1):c.982A>T (p.Thr328Ser)	KRT1	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1049274	NM_000421.5(KRT10):c.1654AGCTCCGGCGGCGGATACGGCGGCGGCAGC[3] (p.556GYGGGSSSGG[3])	KRT10	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1186831	NM_000421.5(KRT10):c.49GGA[9] (p.Gly24dup)	KRT10-AS1	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
373954	NM_000094.4(COL7A1):c.1442G>A (p.Arg481His)	COL7A1	Uncertain significance	criteria provided, multiple submitters, no conflicts
15915	NM_006121.4(KRT1):c.1424T>C (p.Leu475Pro)	KRT1	Uncertain significance	criteria provided, single submitter
309631	NM_006121.4(KRT1):c.*372G>A	KRT1	Uncertain significance	criteria provided, single submitter
309633	NM_006121.4(KRT1):c.*275G>A	KRT1	Uncertain significance	criteria provided, single submitter
309652	NM_006121.4(KRT1):c.477G>C (p.Gln159His)	KRT1	Uncertain significance	criteria provided, single submitter
309653	NM_006121.4(KRT1):c.374G>A (p.Gly125Asp)	KRT1	Uncertain significance	criteria provided, single submitter
309655	NM_006121.4(KRT1):c.257G>A (p.Arg86His)	KRT1	Uncertain significance	criteria provided, multiple submitters, no conflicts
881053	NM_006121.4(KRT1):c.1666G>A (p.Gly556Ser)	KRT1	Uncertain significance	criteria provided, multiple submitters, no conflicts
881054	NM_006121.4(KRT1):c.1564G>A (p.Gly522Ser)	KRT1	Uncertain significance	criteria provided, single submitter
881095	NM_006121.4(KRT1):c.1002T>C (p.Asn334=)	KRT1	Uncertain significance	criteria provided, single submitter
881567	NM_006121.4(KRT1):c.729C>T (p.Asp243=)	KRT1	Uncertain significance	criteria provided, single submitter
883407	NM_006121.4(KRT1):c.*72G>T	KRT1	Uncertain significance	criteria provided, single submitter
883452	NM_006121.4(KRT1):c.1358A>C (p.Gln453Pro)	KRT1	Uncertain significance	criteria provided, single submitter
1030782	NM_000421.5(KRT10):c.98C>T (p.Ser33Phe)	KRT10-AS1	Uncertain significance	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 33 · Orphanet: 21 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
KRT1	Definitive	Autosomal dominant	annular epidermolytic ichthyosis	18
KRT10	Definitive	Autosomal dominant	annular epidermolytic ichthyosis	15

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
KRT1	Orphanet:2199	Epidermolytic palmoplantar keratoderma
KRT1	Orphanet:281139	Annular epidermolytic ichthyosis
KRT1	Orphanet:281190	Congenital reticular ichthyosiform erythroderma
KRT1	Orphanet:312	Autosomal dominant epidermolytic ichthyosis
KRT1	Orphanet:50942	Striate palmoplantar keratoderma
KRT1	Orphanet:530838	KRT1-related diffuse nonepidermolytic keratoderma
KRT1	Orphanet:538574	Palmoplantar keratoderma-hereditary motor and sensory neuropathy syndrome
KRT1	Orphanet:79503	Ichthyosis hystrix of Curth-Macklin
KRT10	Orphanet:281139	Annular epidermolytic ichthyosis
KRT10	Orphanet:281190	Congenital reticular ichthyosiform erythroderma
KRT10	Orphanet:312	Autosomal dominant epidermolytic ichthyosis
KRT10	Orphanet:512103	Autosomal recessive epidermolytic ichthyosis
COL7A1	Orphanet:158673	Localized dystrophic epidermolysis bullosa, acral form
COL7A1	Orphanet:158676	Localized dystrophic epidermolysis bullosa, nails only
COL7A1	Orphanet:231568	Autosomal dominant generalized dystrophic epidermolysis bullosa
COL7A1	Orphanet:79408	Autosomal recessive generalized dystrophic epidermolysis bullosa, severe form
COL7A1	Orphanet:79409	Recessive dystrophic epidermolysis bullosa inversa
COL7A1	Orphanet:79410	Localized dystrophic epidermolysis bullosa, pretibial form
COL7A1	Orphanet:79411	Self-improving dystrophic epidermolysis bullosa
COL7A1	Orphanet:89842	Autosomal recessive generalized dystrophic epidermolysis bullosa, intermediate form
COL7A1	Orphanet:89843	Dystrophic epidermolysis bullosa pruriginosa

Cohort genes → proteins

4 cohort genes, 4 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	4

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
KRT1	HGNC:6412	ENSG00000167768	P04264	Keratin, type II cytoskeletal 1	gencc,clinvar
KRT10	HGNC:6413	ENSG00000186395	P13645	Keratin, type I cytoskeletal 10	gencc,clinvar
COL7A1	HGNC:2214	ENSG00000114270	Q02388	Collagen alpha-1(VII) chain	clinvar
KRT10-AS1	HGNC:28305	ENSG00000167920	Q8N816	Uncharacterized protein KRT10-AS1	clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
KRT1	Keratin, type II cytoskeletal 1	May regulate the activity of kinases such as PKC and SRC via binding to integrin beta-1 (ITB1) and the receptor of activated protein C kinase 1 (RACK1).
KRT10	Keratin, type I cytoskeletal 10	Plays a role in the establishment of the epidermal barrier on plantar skin.
COL7A1	Collagen alpha-1(VII) chain	Stratified squamous epithelial basement membrane protein that forms anchoring fibrils which may contribute to epithelial basement membrane organization and adherence by interacting with extracellular matrix (ECM) proteins such as type IV c…

Protein-family classification

Druggable: 1 · Difficult: 0 · Unknown: 3 · Druggable fraction: 0.25

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Antibody/Immunoglobulin	1	7.3×	0.260
Other/Unknown	3	1.3×	0.404

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
KRT1	Other/Unknown	no		Keratin_II, IF_conserved, Keratin_2_head
KRT10	Other/Unknown	no		Keratin_I, IF_conserved, IF_rod_dom
COL7A1	Antibody/Immunoglobulin	yes		VWF_A, Kunitz_BPTI, FN3_dom
KRT10-AS1	Other/Unknown	no

Expression context

Cohort genes with no expression data: 0.

4 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	4
unknown	0

Top tissues across cohort

Tissue	Cohort genes
mammalian vulva	2
upper leg skin	2
skin of hip	1
penis	1
skin of abdomen	1
skin of leg	1
stromal cell of endometrium	1
left testis	1
pancreatic ductal cell	1
right testis	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
KRT1	177	tissue_specific	marker	mammalian vulva, upper leg skin, skin of hip
KRT10	299	broad	marker	upper leg skin, penis, mammalian vulva
COL7A1	267	ubiquitous	marker	stromal cell of endometrium, skin of abdomen, skin of leg
KRT10-AS1	234	ubiquitous	marker	left testis, right testis, pancreatic ductal cell

Protein interactions among cohort

Intra-cohort edges: 1.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
KRT1	2,716
KRT10	2,304
COL7A1	1,767
KRT10-AS1	2

Intra-cohort edges

A	B	Sources
KRT1	KRT10	biogrid_interaction, intact, string_interaction

Structural data

PDB: 2 · AlphaFold-only: 2 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
KRT10	P13645	6
KRT1	P04264	3

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
KRT10-AS1	Q8N816	46.64
COL7A1	Q02388

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 20. Enrichment computed across 4 evidence-associated genes (3 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 3 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Differentiation of Keratinocytes in Interfollicular Epidermis in Mammalian Skin	2	185.7×	6e-04	KRT1, KRT10
Developmental Cell Lineages	2	149.3×	6e-04	KRT1, KRT10
Formation of the cornified envelope	2	58.6×	0.003	KRT1, KRT10
Keratinization	2	37.1×	0.005	KRT1, KRT10
Regulation of FXIIa and plasma kallikrein activity	1	380.7×	0.010	KRT1
Anchoring fibril formation	1	253.8×	0.013	COL7A1
Fibronectin matrix formation	1	190.3×	0.015	COL7A1
Laminin interactions	1	126.9×	0.020	COL7A1
Cargo concentration in the ER	1	112.0×	0.020	COL7A1
Collagen chain trimerization	1	86.5×	0.023	COL7A1
Assembly of collagen fibrils and other multimeric structures	1	66.8×	0.023	COL7A1
Collagen degradation	1	58.6×	0.023	COL7A1
FXIIa activates plasma kallikrein-kinin system	1	57.7×	0.023	KRT1
Collagen biosynthesis and modifying enzymes	1	56.8×	0.023	COL7A1
COPII-mediated vesicle transport	1	54.4×	0.023	COL7A1
Developmental Biology	2	9.6×	0.023	KRT1, KRT10
Integrin cell surface interactions	1	44.8×	0.026	COL7A1
Innate Immune System	1	8.5×	0.126	KRT1
Neutrophil degranulation	1	7.7×	0.131	KRT1
Immune System	1	4.3×	0.214	KRT1

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 3 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
protein heterotetramerization	2	702.2×	2e-05	KRT1, KRT10
cornification	2	702.2×	2e-05	KRT1, KRT10
intermediate filament organization	2	160.5×	3e-04	KRT1, KRT10
positive regulation of epidermis development	1	1123.5×	0.004	KRT10
complement activation, lectin pathway	1	561.7×	0.006	KRT1
fibrinolysis	1	280.9×	0.009	KRT1
endodermal cell differentiation	1	165.2×	0.013	COL7A1
establishment of skin barrier	1	151.8×	0.013	KRT1
regulation of angiogenesis	1	140.4×	0.013	KRT1
morphogenesis of an epithelium	1	114.6×	0.014	KRT10
keratinocyte differentiation	1	82.6×	0.017	KRT10
keratinization	1	78.0×	0.017	KRT1
epidermis development	1	70.2×	0.017	COL7A1
negative regulation of inflammatory response	1	45.7×	0.024	KRT1
response to oxidative stress	1	43.5×	0.024	KRT1
cell adhesion	1	12.5×	0.078	COL7A1

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 4

Druggability breadth: 1 of 4 evidence-associated genes (25%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
KRT1	0	0
KRT10	0	0
COL7A1	0	0
KRT10-AS1	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Pharmacogenomics

Cohort genes with a PharmGKB record: 3; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	1	COL7A1
E	Difficult family or no structure, no drug	3	KRT1, KRT10, KRT10-AS1

Undrugged target profiles

4 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
KRT1	0	—
KRT10	0	—
COL7A1	0	—
KRT10-AS1	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 3.

Phase distribution (across all retrieved trials)

Phase	Trials
PHASE2	1
PHASE1/PHASE2	1
Not specified	1

Top trials by phase / activity

NCT	Phase	Status	Title
NCT06545695	PHASE1/PHASE2	NOT_YET_RECRUITING	Epidermal Growth Factor Receptor Inhibition for Keratinopathies
NCT03041038	PHASE2	COMPLETED	The Efficacy and Safety of Secukinumab in Patients With Ichthyoses
NCT05312073	Not specified	COMPLETED	Study of in Vivo and in Vitro Transcriptomic and Proteomic Signatures in Unhereditary Ichtyosis

Drugs tested across these trials (top 30)

Molecule	Max phase	Trials referencing
SECUKINUMAB	4	1