Familial melanoma
diseaseOn this page
Also known as hereditary melanoma (disease)
Summary
Familial melanoma (MONDO:0018961) is a cancer with 11 cohort genes (5 CIViC-evidence somatic drivers; 1,931 ClinVar predisposition records) and 1 clinical trial.
At a glance
- Classification: Cancer
- Prevalence: 1-9 / 100 000 (Europe) [Orphanet-validated]
- Cohort genes: 11
- ClinVar variants: 1,931
- Phenotypes (HPO): 11
- Clinical trials: 1
Clinical features
Epidemiology
Prevalence records
1 prevalence record(s), Orphanet:
| Type | Class | Value | Geography | Validation |
|---|---|---|---|---|
| Annual incidence | 1-9 / 100 000 | 1.5 | Europe | Validated |
Signs & symptoms
Clinical features (HPO)
11 HPO clinical features (Orphanet curated; top 11 by frequency):
| HPO ID | Term | Frequency |
|---|---|---|
| HP:0002861 | Melanoma | Very frequent (80-99%) |
| HP:0003764 | Nevus | Very frequent (80-99%) |
| HP:0000958 | Dry skin | Frequent (30-79%) |
| HP:0001480 | Freckling | Frequent (30-79%) |
| HP:0001595 | Abnormality of the hair | Frequent (30-79%) |
| HP:0100763 | Abnormality of the lymphatic system | Frequent (30-79%) |
| HP:0000488 | Retinopathy | Occasional (5-29%) |
| HP:0002071 | Abnormality of extrapyramidal motor function | Occasional (5-29%) |
| HP:0002894 | Neoplasm of the pancreas | Occasional (5-29%) |
| HP:0006753 | Neoplasm of the stomach | Occasional (5-29%) |
| HP:0100013 | Neoplasm of the breast | Occasional (5-29%) |
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | familial melanoma |
| Mondo ID | MONDO:0018961 |
| Orphanet | 618 |
| DOID | DOID:6846 |
| NCIT | C8498 |
| UMLS | C1512419 |
| MedGen | 268851 |
| GARD | 0003460 |
| Is cancer (heuristic) | yes |
Also known as: hereditary melanoma (disease)
Data availability: 1,931 ClinVar variants · 11 cell lines.
Disease family
An umbrella term covering 1 Mondo subtype.
Classification path: disease › human disease › disease by etiologic mechanism › disease of genetic or genomic mechanism › hereditary disease › familial melanoma
Related subtypes (1923): inherited bleeding disorder, platelet-type, infantile liver failure, febrile seizures, familial, hereditary hypophosphatemic rickets, hypothyroidism, congenital, nongoitrous, isolated microphthalmia, nephrolithiasis/osteoporosis, hypophosphatemic, anemia, hypochromic microcytic with iron overload, camptodactyly syndrome, Guadalajara, cerebelloparenchymal disorder, Chiari malformation, developmental dysplasia of the hip, bone marrow failure syndrome, Zimmermann-Laband syndrome, autoimmune disease, multisystem, infantile-onset, multinodular goiter, orofacial cleft, spondylocostal dysostosis, X-linked disease, Y-linked disease, autosomal genetic disease, cornea plana, epithelial-stromal TGFBI dystrophy, congenital diarrhea, Klippel-Feil syndrome, familial polycythemia, myopia, inherited aplastic anemia, FG syndrome, hypotrichosis, hereditary Wilms tumor, familial hemolytic anemia, hereditary fallopian tube carcinoma, ariboflavinosis, bronchiectasis, spermatogenic failure, preeclampsia, cataract, celiac disease, inflammatory bowel disease, ciliopathy, Fuchs’ endothelial dystrophy, hypospadias, bone Paget disease, visceral leishmaniasis, tooth agenesis, nanophthalmia, hydatidiform mole, fibromuscular dysplasia, familial abdominal aortic aneurysm, Adams-Oliver syndrome, Achard syndrome, Achoo syndrome, acroleukopathy, symmetric, acromegaloid changes, cutis verticis gyrata, and corneal leukoma, acromial dimples, adenosine triphosphatase deficiency, anemia due to, alopecia-epilepsy-pyorrhea-intellectual disability syndrome, amastia, bilateral, with ureteral triplication and dysmorphism, amelia and terminal transverse hemimelia, amenorrhea-galactorrhea syndrome, amyotrophic dystonic paraplegia, anal sphincter dysplasia, anal sphincter myopathy, internal, isolated aniridia, aniridia-absent patella syndrome, aniridia, microcornea, and spontaneously Reabsorbed cataract, anisocoria, ankyloglossia, diffuse idiopathic skeletal hyperostosis, annular erythema, anonychia-ectrodactyly, anonychia-onychodystrophy with brachydactyly type b and ectrodactyly, aortic arch interruption, facial palsy, and retinal coloboma, arcus senilis, arms, malformation of, arteries, anomalies of, arteriovenous malformations of the brain, arteritis, familial granulomatous, with juvenile polyarthritis, arthritis, sacroiliac, asymmetric short stature syndrome, PR interval, variation in, aurocephalosyndactyly, Axenfeld-Rieger anomaly with partially absent eye muscles, distinctive face, hydrocephaly, and skeletal abnormalities, azotemia, familial, gastroesophageal reflux disease, beta-amino acids, renal transport of, bladder diverticulum, blepharochalasis, superior, bone pain, periodic, Brachmann-de Lange-like facial changes with microcephaly, metatarsus adductus, and developmental delay, brachymesomelia-renal syndrome, Brachymetatarsus 4, Brachymorphism-onychodysplasia-dysphalangism syndrome, branchial myoclonus with spastic paraparesis and cerebellar ataxia, familial juvenile hypertrophy of the breast, bundle branch block, familial isolated complete right, butyrylesterase 1, Burkitt lymphoma, calcific aortic disease with immunologic abnormalities, familial, cancer, familial, with in vitro Radioresistance, canine teeth, absence of upper permanent, Car factor deficiency, Carabelli anomaly of maxillary molar teeth, carpal displacement, cervical hypertrichosis with underlying kyphoscoliosis, cervical rib disease, cervical vertebral Bridge, cervical vertebral dysplasia, chemodectoma, intraabdominal, with cutaneous angiolipomas, Chondronectin, choroidal osteoma, bilateral, cirrhosis, familial, congenital pseudoarthrosis of clavicle, aorta coarctation, coloboma, ocular, autosomal dominant, uveal coloboma-cleft lip and palate-intellectual disability, colonic varices without portal hypertension, comedones, familial Dyskeratotic, commissural lip pits, coracoclavicular joint, anomalous, cornea guttata with anterior polar cataracts, corneal degeneration, ribbonlike, with deafness, Schnyder corneal dystrophy, fleck corneal dystrophy, Meesmann corneal dystrophy, epithelial recurrent erosion dystrophy, coumarin resistance, coxa vara, cranioacrofacial syndrome, craniofacial-deafness-hand syndrome, craniorhiny, creatine phosphokinase, elevated serum, cryofibrinogenemia, familial primary, cryptotia, familial, isolated cryptophthalmia, Darwinian tubercle of pinna, autosomal dominant deafness - onychodystrophy syndrome, deafness-ear malformation-facial palsy syndrome, keratoderma hereditarium mutilans, deafness, mid-tone neural, deafness, sensorineural, with peripheral neuropathy and arterial disease, deafness, unilateral, deafness with anhidrotic ectodermal dysplasia, dens evaginatus, dens in dente and palatal invaginations, cerebral arteriopathy with subcortical infarcts and leukoencephalopathy, dementia/parkinsonism with non-Alzheimer amyloid plaques, primary failure of tooth eruption, dentin dysplasia type I, dentin dysplasia type II, dentin dysplasia-sclerotic bones syndrome, deoxyribose-5-phosphate aldolase deficiency, dentinogenesis imperfecta type 2, dentinogenesis imperfecta type 3, dermal Ridges, patternless, diarrhea, glucose-stimulated secretory, with common variable immunodeficiency, diastema, dental medial, dilution, pigmentary, discrimination, Two-point, reduction 1N, distal osteosclerosis, distichiasis with congenital anomalies of the heart and peripheral vasculature, DNA, satellite, 3, DNA, low-repetitive sequences of, double nail for fifth toe, duodenal ulcer due to antral G-cell hyperfunction, duodenal ulcer, hyperpepsinogenemic 1, dwarfism, Levi type, dwarfism with stiff joints and ocular abnormalities, dystelephalangy, ear antitragus, tag at base of, ear exostoses, ear folding, ear malformation, preauricular fistulae, congenital, ear pits, posterior helical, thickened earlobes-conductive deafness syndrome, ectodermal dysplasia syndrome with distinctive facial appearance and preaxial polydactyly of feet, ectodermal dysplasia with adrenal cyst, ectopia lentis 1, isolated, autosomal dominant, ectopia pupillae, ectrodactyly and ectodermal dysplasia without cleft lip/palate, ectrodactyly-cleft palate syndrome, edema, familial idiopathic, prepubertal, electroencephalographic peculiarity: 14 and 6 per sec. positive spike phenomenon, electroencephalographic peculiarity: fronto-precentral beta wave groups, emphysema, hereditary pulmonary, eosinophilia, familial, Eosinophilopenia, epidermoid cysts, epidermolysis bullosa with deficiency of galactosylhydroxylysyl glucosyltransferase, epidermolysis bullosa with congenital localized absence of skin and deformity of nails, erythema nodosum, familial, esophageal ring, lower, exchondrosis of pinna, posterior, exostoses-anetodermia-brachydactyly type E syndrome, facial spasm, factor VIII and Factor IX, combined deficiency of, factors VIII, IX and XI, combined deficiency of, factor 9 and Factor XI, combined deficiency of, fibrinolytic defect, fibrodysplasia ossificans progressiva, fibula, recurrent dislocation of head of, Floating-Harbor syndrome, flushing of ears and somnolence, focal epithelial hyperplasia of the oral mucosa, fragile site 10Q23, Friedreich ataxia, so-called, with optic atrophy and sensorineural deafness, intellectual disability, FRA12A type, fucosidase regulator, gamma-A-globulin, defect in assembly of, Gamstorp-Wohlfart syndrome, gastric volvulus, intrathoracic, MALT lymphoma, gastric mucosal hypertrophy, genu valgum, st. Helena familial, giant neutrophil leukocytes, globulin anomaly involving beta (2A)-globulin, glomuvenous malformation, Glucoglycinuria, glucose-6-phosphate dehydrogenase-like, glutamic acid decarboxylase, brain, membrane form, glutathione transferase activity toward trans-stilbene oxide, hyperglycinuria, granddad syndrome, Grant syndrome, granulosis rubra nasi, graying of hair, precocious, guanylate kinase 3, hairy nose tip, hairy palms and soles, hand clasping pattern, cavernous hemangiomas of face-supraumbilical midline raphe syndrome, Kasabach-Merritt syndrome, oculoauriculovertebral spectrum with radial defects, hemolytic poikilocytic anemia due to reduced ankyrin binding sites, hemoglobin–variants for which the chain carrying the mutation 1S unknown or uncertain, hepatic adenomas, familial, hernia, double inguinal, heterochromia iridis, histiocytic dermatoarthritis, humeroradial synostosis, 5-hydroxytryptamine oxygenase regulator, orthostatic hypotensive disorder, Streeten type, hypercalciuria, absorptive, 2, hyperheparinemia, hyperhidrosis palmaris ET plantaris, hyperimmunoglobulin G1(A1) syndrome, hyperlipoproteinemia, type II, and deafness, hyperostosis cranialis interna, hyperpigmentation of eyelid, hyperpigmentation of Fuldauer and Kuijpers, hyperproglucagonemia, hyperreflexia, hypersecretion of adrenal androgens, familial, hypotaurinemic retinal degeneration and cardiomyopathy, essential hypertension, genetic, hyperthermia, cutaneous, with headaches and nausea, hyperthyroxinemia, dystransthyretinemic, hypertrophia musculorum vera, hypoparathyroidism-deafness-renal disease syndrome, hypophosphatemic bone disease, hypoxanthine guanine phosphoribosyltransferase suppressor, ichthyosis-cheek-eyebrow syndrome, IgE responsiveness, atopic, fused mandibular incisors, incisors, lower central, absence of, incisors, rotation of upper central, incisors, shovel-shaped, insensitivity to pain with hyperplastic Myelinopathy, insect Stings, hypersensitivity to, interferon antiviral depressor, iris pigment layer, cleavage of, islet cell adenomatosis, intussusception, IVIC syndrome, internal carotid artery, spontaneous dissection of, keloid formation, keratitis fugax hereditaria, keratosis, familial actinic, angioosteohypertrophic syndrome, knuckle pads, Kyrle disease, labia minora, incomplete adhesion of, lactic acidosis, chronic adult form, laryngeal adductor paralysis, lattice degeneration of retina leading to retinal detachment, periodic fever, immunodeficiency, and thrombocytopenia syndrome, leg ulcers, familial, of juvenile onset, lentiginosis, centrofacial neurodysraphic, leukocyte nuclear appendages, hereditary prevalence of, levator-medial rectus synkinesis, lip, hamartomatous, lipoprotein types–Lt system, lipoprotein, variant of beta, lithium transport, low density lipoprotein, variation in molecular weight of, lumbar stenosis, familial, macrocephaly, benign familial, myelodysplastic syndrome associated with isolated del(5q), malocclusion due to protuberant upper front teeth, Mammastatin, mannose 6-phosphate receptor recognition defect, Lebanese type, marfanoid hypermobility syndrome, masticatory muscles, hypertrophy of, maxillofacial dysostosis, Meckel diverticulum, mediosternal depigmentation line, megalodactyly, melanoma tumor antigen Gp90, mental and growth retardation with amblyopia, mesomelic dwarfism of hypoplastic tibia and radius type, metachondromatosis, metachromasia of fibroblasts, metatarsus varus, type 1, microphthalmia, isolated, with corectopia, microspherophakia with hernia, microspherophakia-metaphyseal dysplasia syndrome, milia, multiple eruptive, tooth ankylosis, MOMO syndrome, antigen defined by monoclonal antibody Aj9, antigen defined by monoclonal antibody T87, Monophalangy of great toe, nondisjunction, mullerian aplasia and hyperandrogenism, multiple exostoses with spastic tetraparesis, muscle cramps, familial, muscular atrophy, malignant neurogenic, muscular hypoplasia, congenital universal, of Krabbe, myelinated optic nerve fibers, myopathy with storage of glycoproteins and Glycosaminoglycans, nasal alar collapse, bilateral, nasal bones, absence of, nasal groove, familial transverse, nasal hyperpigmentation, familial transverse, neurofibromatosis-pheochromocytoma-duodenal carcinoid syndrome, neuropathy, congenital, with arthrogryposis multiplex, neuropathy, with paraprotein in serum, cerebrospinal fluid and urine, neutropenia, chronic familial, hereditary neutrophilia, nevus anemicus, nevus flammeus of nape of neck, nipples inverted, familial supernumerary nipples, noduli Cutanei, multiple, with urinary tract abnormalities, nose, anomalous shape of, onychogryposis, pedal, with keratosis plantaris and coarse hair, omphalocele, autosomal, ophthalmomandibulomelic dysplasia, ophthalmoplegia, familial static, ophthalmoplegia, familial total, with iris transillumination, ossified ear cartilages, ossicular malformations, familial, osteosclerosis with ichthyosis and fractures, otofaciocervical syndrome, ovalocytosis, hereditary hemolytic, with defective erythropoiesis, osteochondrodysplasia, rhizomelic, with callosal agenesis, thrombocytopenia, hydrocephalus, and hypertension, palmaris longus muscle, absence of, hereditary chronic pancreatitis, pancytopenia and occlusive vascular disease, papillomatosis, confluent and reticulated, papillomatosis, florid, of nipple, Paramolar tubercle of bolk, Parotidomegaly, hereditary bilateral, Passovoy factor defect, patella aplasia/hypoplasia, patella, familial recurrent dislocation of, Pechet factor deficiency, pectus excavatum, pelvic lipomatosis with crossed renal ectopia, pernicious anemia, peroneal nerve, accessory deep, peroxidase, salivary, phagocytosis, plasma-related defect 1N, pheochromocytoma-islet cell tumor syndrome, phlebectasia of lips, phocomelia-ectrodactyly-deafness-sinus arrhythmia syndrome, phosphatase, acid, of tissues, phosphoglucomutase 4, 6-phosphogluconolactonase deficiency, phosphoglycoprotein 1, photomyoclonus, diabetes mellitus, deafness, nephropathy, and cerebral dysfunction, Robin sequence-oligodactyly syndrome, pigmented purpuric eruption, pilonidal sinus, platelet adenylate cyclase activity, platelet aggregation, spontaneous, platelet disorder, undefined, platelet factor 3 deficiency, platelet membrane fluidity, platelet responsiveness to adrenaline, depressed, platelet signal processing defect, familial spontaneous pneumothorax, polyposis, intestinal, scattered and discrete, polyposis, intestinal, with multiple exostoses, polyps, multiple and recurrent inflammatory fibroid, gastrointestinal, popliteal cyst, postaxial tetramelic oligodactyly, posterior column ataxia, Guttmacher syndrome, familial male-limited precocious puberty, premature chromatid separation trait, presenile dementia, Kraepelin type, priapism, familial idiopathic, pronation-supination of the forearm, impairment of, proteolytic capacity of plasma, Protrusio acetabuli, pruritus, hereditary localized, pseudoarthrogryposis, Pseudoatrophoderma colli, pseudomonilethrix, pseudoxanthoma elasticum, forme fruste, pterygium colli, isolated, pubic bone dysplasia, pulmonary atresia with ventricular septal defect, pulmonic stenosis, atrial septal defect, and unique electrocardiographic abnormalities, pulmonic stenosis and deafness, pupillary membrane, persistence of, purpura simplex, radial heads, posterior dislocation of, radio-renal syndrome, radius, aplasia of, with cleft lip/palate, ragweed sensitivity, raindrop hypopigmentation, Raynaud disease, recombinant 8 syndrome, red cell permeability defect, red cell phospholipid defect with hemolysis, retinal venous beading, rhiny, ring dermoid of cornea, Rombo syndrome, Robinow-Sorauf syndrome, Roussy-Levy syndrome, Silver-Russell syndrome, aplasia of lacrimal and salivary glands, salivary substance, Clostridium botulinum type, salivary duct calculi, pleomorphic adenoma, cleft palate-large ears-small head syndrome, sella turcica, bridged, sister chromatid exchange, frequency of, skeletal dysplasia with delayed epiphyseal and carpal bone ossification, Somatomedin, embryonic, spastic paraplegia with associated extrapyramidal signs, spastic paraplegia, optic atrophy, and dementia, sperm protamine P4, spinocerebellar ataxia with rigidity and peripheral neuropathy, spinocerebellar atrophy with pupillary paralysis, splenogonadal fusion-limb defects-micrognathia syndrome, splenomegaly syndrome with splenic Germinal center hypoplasia and reduced circulating T helper cells, split lower lip, split-hand and split-foot with hypodontia, Karsch-Neugebauer syndrome, spondylolisthesis, spondylosis, cervical, polycystic ovary syndrome, sternum, premature obliteration of sutures of, storm syndrome, striae distensae, familial, surface antigen, glycoprotein 75, symphalangism of toes, surface polypeptides, anonymous, symphalangism, C. S. Lewis type, distal symphalangism, symphalangism with multiple anomalies of hands and feet, synovial chondromatosis, familial, with dwarfism, syringomas, multiple, talonavicular coalition, tarsal coalition, tear protein, anodal, T-cell Subgroups, non-HLA-linked, teeth, odd shapes of, teeth present at birth, teeth, supernumerary, temperature-sensitive lethal mutation, spermatic cord torsion, tetralogy of fallot and glaucoma, tetramelic monodactyly, thumb deformity, thyroid hormone plasma membrane transport defect, tibial torsion, bilateral medial, toe, fifth, number of phalanges 1N, toe, misshapen, toe, rotated fifth, toes, relative length of first and second, toes, space between first and second, malposition of teeth with or without hypodontia/oligodontia, torus palatinus and torus mandibularis, tremor of intention, ataxia, and lipofuscinosis, trichomegaly, trichoepitheliomas, multiple desmoplastic, trigger thumb, triphalangeal thumb with double phalanges, triphalangeal thumb, Nonopposable, Tristichiasis, humerus trochlea aplasia, Tuftsin deficiency, suppressor of tumorigenicity 3, tune deafness, Undritz anomaly, Upington disease, ureter, bifid or double, ureterocele, urolithiasis, uric acid, autosomal dominant, urinary bladder, atony of, uterine anomalies, vascular helix of umbilical cord, veins, pattern of, on anterior thorax, venular insufficiency, systemic, vertebral hypoplasia with lumbar kyphosis, congenital vertical talus, vestibulocochlear dysfunction, progressive, volvulus of midgut, Woronets trait, ablepharon macrostomia syndrome, familial glucocorticoid deficiency, aganglionosis, total intestinal, agenesis of cerebral white matter, agnathia-otocephaly complex, Moynahan syndrome, alopecia - intellectual disability syndrome, amino aciduria with mental deficiency, dwarfism, muscular dystrophy, osteoporosis, and acidosis, Amobarbital, deficient N-hydroxylation of, amyloidosis of gingiva and conjunctiva, with intellectual disability, gelatinous drop-like corneal dystrophy, amyloidosis, cutaneous bullous, angiomatosis, diffuse Corticomeningeal, of Divry and van Bogaert, aniridia-renal agenesis-psychomotor retardation syndrome, anodontia, anosmia for isobutyric acid, antithrombin, familial hemorrhagic diathesis due to, Aphalangy-hemivertebrae-urogenital-intestinal dysgenesis syndrome, arteriosclerosis, severe juvenile, arthrogryposis, distal, with intellectual disability and characteristic facies, asthma, nasal polyps, and aspirin intolerance, asthma, short stature, and elevated IgA, ataxia with myoclonic epilepsy and presenile dementia, ataxia, deafness, and cardiomyopathy, ataxia-microcephaly-cataract syndrome, atherosclerosis-deafness-diabetes-epilepsy-nephropathy syndrome, Athrombia, essential, atonic-astatic syndrome of Foerster, atrichia with papular lesions, berry aneurysm, cirrhosis, pulmonary emphysema, and cerebral calcification, beta-aminoisobutyric acid, urinary excretion of, biliary malformation with renal tubular insufficiency, Bowen syndrome of multiple malformations, brachydactyly, type A2, with microcephaly, Elsahy-Waters syndrome, Sabinas brittle hair syndrome, hereditary arterial and articular multiple calcification syndrome, camptodactyly-ichthyosis syndrome, congenital disorder of glycosylation, type i/IIx, carboxypeptidase N deficiency, cardiac septal defects with coarctation of the aorta, cardioauditory syndrome of Sanchez Cascos, cardiomyopathy associated with myopathy and sudden death, carnitine deficiency, myopathic, colobomatous optic disc-macular atrophy-chorioretinopathy syndrome, premature centromere division, cephalin lipidosis, cerebellar ataxia and neurosensory deafness, cerebellar ataxia, benign, with thermoanalgesia, cerebral angiopathy, dysphoric, cerebral malformation, seizures, hypertrichosis, and overlapping fingers, cerebrocortical degeneration of infancy, cervical vertebrae, agenesis of, CHAND syndrome, Charcot-Marie-Tooth disease-hearing loss-intellectual disability syndrome, cholestasis with gallstone, ataxia, and visual disturbance, cholesterol pneumonia, chondroitin-6-sulfaturia, defective cellular immunity, nephrotic syndrome, central areolar choroidal dystrophy, chromosomal instability with tissue-specific radiosensitivity, circumvallate placenta syndrome, citrulline transport defect, Juberg-Hayward syndrome, coloboma, ocular, autosomal recessive, Jalili syndrome, convulsive disorder, familial, with prenatal or early onset, corneal dystrophy-perceptive deafness syndrome, corneal degeneration, band-shaped spheroid, congenital hereditary endothelial dystrophy of cornea, Crane-Heise syndrome, cranial nerves, congenital paresis of, cranial nerves, recurrent paresis of, temtamy syndrome, craniosynostosis with anomalies of the cranial base and digits, craniosynostosis-intellectual disability syndrome of 51N and Gettig, craniosynostosis-intellectual disability-clefting syndrome, cryptorchidism, curved nail of fourth toe, Cushing syndrome due to macronodular adrenal hyperplasia, cutis verticis gyrata and intellectual disability, cyanosis and hepatic disease, cysteine Peptiduria, cystic disease of lung, ventriculomegaly-cystic kidney disease, deafness, congenital, and familial myoclonic epilepsy, DOORS syndrome, high myopia-sensorineural deafness syndrome, conductive deafness-malformed external ear syndrome, deafness-vitiligo-achalasia syndrome, deafness-small bowel diverticulosis-neuropathy syndrome, deafness, neural, congenital moderate, deafness, neural, with atypical atopic dermatitis, dextrocardia with unusual facies and microphthalmia, diaminopentanuria, disseminated sclerosis with narcolepsy, Dohle bodies and leukemia, dwarfism, low-birth-weight type, with unresponsiveness to growth hormone, dwarfism, intellectual disability, and eye abnormality, dwarfism, proportionate, with hip dislocation, dysautonomia-like disorder, dysmyelination with jaundice, dystonia with Ringbinden, ectopia lentis 2, isolated, autosomal recessive, ectopia lentis et pupillae, encephalomalacia, multilocular, Fowler syndrome, endocardial fibroelastosis and coarctation of abdominal aorta, endothelial dystrophy, congenital hereditary, with nail hypoplasia, enterocolitis, congenital enteropathy due to enteropeptidase deficiency, protein-losing enteropathy, epidermolysis bullosa with diaphragmatic hernia, epilepsy, photogenic, with spastic diplegia and intellectual disability, celiac disease-epilepsy-cerebral calcification syndrome, epiphyseal dysplasia of femoral head, myopia, and deafness, epithelial squamous dysplasia, keratinizing desquamative, of urinary tract, immunodeficiency 32B, erythema of acral regions, ethanolaminosis, facial abnormalities, kyphoscoliosis, and intellectual disability, lethal faciocardiomelic dysplasia, faciothoracogenital syndrome, Fanconi-like syndrome, fever, familial lifelong persistent, fibrosclerosis, multifocal, focal epithelial hyperplasia, Fraser-like syndrome, Freesia Flowers, inability to smell, Friedreich ataxia and congenital glaucoma, fructose and galactose intolerance, monosodium glutamate sensitivity, gluteal muscles, absence of, GOMBO syndrome, granulocytopenia with immunoglobulin abnormality, grouped pigmentation of the retina, Halothane hepatitis, hemangiomatosis, cutaneous, with associated features, hepatic veno-occlusive disease-immunodeficiency syndrome, Hirschsprung disease with ulnar polydactyly, polysyndactyly of big toes, and ventricular septal defect, familial lipochrome histiocytosis, classic Hodgkin lymphoma, Hooft disease, Hutterite cerebroosteonephrodysplasia syndrome, hydroxyprolinemia, hymen, imperforate, Leydig cell hypoplasia, type 1, hyperleucine-Isoleucinemia, hyperlysinuria with hyperammonemia, hypermetabolism due to defect in mitochondria, hyperopia, high, hyperparathyroidism, neonatal self-limited primary, with hypercalciuria, hyperphosphatemia, polyuria, and seizures, hypertelorism and tetralogy of fallot, hypertrophic neuropathy and cataract, hyperuricemia, infantile, with abnormal behavior and normal hypoxanthine guanine phosphoribosyltransferase, hypoglycemia, leucine-induced, hypoinsulinemic hypoglycemia and body hemihypertrophy, hypogonadism with low-grade mental deficiency and microcephaly, hypogonadism, male, hypohidrosis with abnormal palmar dermal Ridges, hypokalemic alkalosis, familial, with specific renal tubulopathy, hypophosphatemia, renal, with intracerebral calcifications, hypopituitarism, congenital, with central diabetes insipidus, Bamforth-Lazarus syndrome, ichthyosis congenita with biliary atresia, ichthyosis-intellectual disability-dwarfism-renal impairment syndrome, ichthyosis, split hairs, and amino aciduria, immunoglobulin d level in plasma, low, channelopathy-associated congenital insensitivity to pain, autosomal recessive, indolylacroyl glycinuria with intellectual disability, inosine phosphorylase deficiency, immune defect due to, internal carotid arteries, hypoplasia of, immunodeficiency with defective T-cell response to interleukin 1, acetylation, slow, isovaleric acid, inability to smell, Jumping Frenchmen of Maine, oculocerebrofacial syndrome, Kaufman type, keratoconus and congenital hip dysplasia, keratoconus posticus circumscriptus, Kniest-like dysplasia with pursed lips and ectopia lentis, Kifafa seizure disorder, specific granule deficiency, Lambotte syndrome, absence deformity of leg-cataract syndrome, leukemia, acute myelocytic, with polyposis coli and colon cancer, lymphoid system deterioration, progressive, lymphopenic hypergammaglobulinemia, antibody deficiency, autoimmune hemolytic anemia, and glomerulonephritis, lysine malabsorption syndrome, macroepiphyseal dysplasia with osteoporosis, wrinkled skin, and aged appearance, macrosomia adiposa congenita, magnesium, elevated red cell, malocclusion and short stature, mandibulofacial dysostosis with mental deficiency, oculotrichoanal syndrome, megaepiphyseal dwarfism, megalencephaly with dysmyelination, megalocornea, mesoaxial hexadactyly and cardiac malformation, metaphyseal chondrodysplasia, Pena type, metaphyseal dysplasia, anetoderma, and optic atrophy, metaphyseal modeling abnormality, skin lesions, and spastic paraplegia, methionine malabsorption syndrome, microcephaly-micromelia syndrome, Jawad syndrome, microphthalmia with hyperopia, retinal degeneration, macrophakia, and dental anomalies, microtia with meatal atresia and conductive deafness, mucus inspissation of respiratory tract, muscular dystrophy, adult-onset, with leukoencephalopathy, muscular hypertonia, lethal, musk, inability to smell, myeloperoxidase deficiency, myopathy, granulovacuolar lobular, with electrical myotonia, myopathy due to malate-aspartate shuttle defect, myopathy with giant abnormal mitochondria, Keipert syndrome, nephropathy - deafness - hyperparathyroidism syndrome, neuroectodermal melanolysosomal disease, neurologic disease, infantile multisystem, with osseous fragility, neuropathy, hereditary motor and sensory, with excessive myelin folding complex, autosomal recessive, neuropathy, painful, obesity-hypoventilation syndrome, ocular myopathy with curare sensitivity, oculocerebral hypopigmentation syndrome of Preus, oculorenocerebellar syndrome, olivopontocerebellar atrophy II, autosomal recessive, Onychotrichodysplasia and neutropenia, ophthalmoplegia totalis with ptosis and miosis, ophthalmoplegic neuromuscular disorder with abnormal mitochondria, optic atrophy, hearing loss, and peripheral neuropathy, autosomal recessive, Opticocochleodentate degeneration, oral sensibility, disturbance of, Primrose syndrome, osteodysplasty, precocious, of Danks, Mayne, and Kozlowski, congenital osteogenesis imperfecta-microcephaly-cataracts syndrome, osteoma of middle ear, otoonychoperoneal syndrome, palant cleft palate syndrome, pancreatic agenesis, pancreatitis, sclerosing cholangitis, and sicca complex, Partington-Anderson syndrome, pellagra-like syndrome, periodontitis, chronic, adult, peripheral neuropathy, ataxia, focal necrotizing encephalopathy, and spongy degeneration of brain, peroneus tertius muscle, absence of, phenformin 4-hydroxylation, Rabson-Mendenhall syndrome, pituitary dwarfism with large sella turcica, plasma clot retraction factor, deficiency of, platelet prostacyclin receptor defect, pleoconial myopathy with salt craving, polycystic kidney, cataract, and congenital blindness, polymyoclonus, infantile, polysaccharide, storage of unusual, polyhydramnios, chronic idiopathic, Prepapillary vascular loops, progesterone resistance, prolactin deficiency, isolated, prolactin deficiency with obesity and enlarged testes, prune belly syndrome with pulmonic stenosis, intellectual disability, and deafness, 46,XY disorder of sex development due to 17-beta-hydroxysteroid dehydrogenase 3 deficiency, Pseudouridinuria and mental defect, pulmonary alveolar microlithiasis, pulmonary atresia-intact ventricular septum syndrome, pulmonary bullae causing pneumothorax, pulmonary venoocclusive disease, pulmonic stenosis, pulmonic stenosis and congenital nephrosis, pyloric atresia, pyropoikilocytosis, hereditary, radiculoneuropathy, fatal neonatal, Ramon syndrome, red skin pigment anomaly of new guinea, Reese retinal dysplasia, renal and mullerian duct hypoplasia, Perlman syndrome, respiratory underresponsiveness to hypoxia and hypercapnia, retinal degeneration and epilepsy, retinal telangiectasia and hypogammaglobulinemia, retinitis pigmentosa inversa with deafness, retinitis pigmentosa-intellectual disability-deafness-hypogenitalism syndrome, retinopathy, pigmentary, and intellectual disability, rod-cone dystrophy, sensorineural deafness, and Fanconi-type renal dysfunction, Rowley-Rosenberg syndrome, second metatarsal-metacarpal syndrome, senile plaque formation, short stature-obesity syndrome, Sjogren-Larsson-like ichthyosis without CNS or eye involvement, sodium-potassium-ATPase activity of red cell, growth delay due to insulin-like growth factor I resistance, ataxia, spastic, childhood-onset, autosomal recessive, with optic atrophy and intellectual disability, spastic diplegia and intellectual disability, spastic paraplegia with myoclonic epilepsy, spastic tetraplegia-retinitis pigmentosa-intellectual disability syndrome, spinal muscular atrophy with intellectual disability, spinal muscular atrophy with microcephaly and mental subnormality, familial isolated congenital asplenia, splenoportal vascular anomalies, spondylocostal dysostosis-anal and genitourinary malformations syndrome, subaortic stenosis, membranous, sucrosuria, hiatus hernia and intellectual disability, syndesmodysplasic dwarfism, tardive dyskinesia, taurodontism, teeth, fused, testes, rudimentary, tetraamelia with ectodermal dysplasia and lacrimal duct abnormalities, tetraamelia-multiple malformations syndrome, thalamic degeneration, symmetric infantile, thumb, distal hyperextensibility of, thymic aplasia with fetal death, thymoma, familial, tiglic acidemia, tibia, absence of, with congenital deafness, tongue, pigmented fungiform papillae of, Tryptophanuria with dwarfism, T-substance anomaly, Tyrosinosis, ulna hypoplasia-intellectual disability syndrome, ulnar agenesis and endocardial fibroelastosis, Valinemia, van Bogaert-Hozay syndrome, vascular hyalinosis, isolated right ventricular hypoplasia, vitiligo, progressive, with intellectual disability and urethral duplication, de Sanctis-Cacchione syndrome, xylosidase deficiency, Young syndrome, corpus callosum agenesis-abnormal genitalia syndrome, intestinal pseudoobstruction, neuronal, chronic idiopathic, X-linked, CGF1, arthrogryposis, congenital, lower limb, X-linked, hypotonia, congenital nystagmus, ataxia, and abnormal auditory brainstem responses, Simpson-Golabi-Behmel syndrome type 2, episodic muscle weakness, X-linked, radioulnar synostosis, radial ray abnormalities, and severe malformations in the male, Christianson syndrome, Armfield syndrome, radial ray deficiency, X-linked, alpha-thalassemia-myelodysplastic syndrome, cataract, ataxia, short stature, and intellectual disability, Tn polyagglutination syndrome, fragile X syndrome, deafness, cataract, retinitis pigmentosa, and sperm abnormalities, Lisch epithelial corneal dystrophy, synovial sarcoma, cardiomyopathy, fatal fetal, due to myocardial calcification, X-linked dominant chondrodysplasia, Chassaing-Lacombe type, immunodeficiency 47, Meester-Loeys syndrome, midface hypoplasia, hearing impairment, elliptocytosis, and nephrocalcinosis, Arts syndrome, tubulin, beta, bullous dystrophy, macular type, Nance-Horan syndrome, central incisors, absence of, Charcot-Marie-Tooth peroneal muscular atrophy, X-linked, with aplasia cutis congenita, Abruzzo-Erickson syndrome, X-linked complicated corpus callosum dysgenesis, cutis verticis gyrata, thyroid aplasia, and intellectual disability, immune dysregulation-polyendocrinopathy-enteropathy-X-linked syndrome, focal dermal hypoplasia, glutamyl ribose-5-phosphate storage disease, granulomas, congenital cerebral, hemopoietic proliferation, Hhhh syndrome, ichthyosis and male hypogonadism, immunodeficiency, X-linked, with deficiency of 115,000 Dalton surface glycoprotein, immunoglobulin M, level of, impacted teeth, multiple, imprinting gene related to retinoblastoma, jaundice, familial obstructive, of infancy, Kallmann syndrome with spastic paraplegia, modifier, X-linked, for Neurofunctional defects, myelolymphatic insufficiency, nuclear ribonucleic acid, occipital hair, white lock of, omphalocele, X-linked, ophthalmoplegia, external, and myopia, optic atrophy–spastic paraplegia syndrome, Paine syndrome, Pierre Robin syndrome-faciodigital anomaly syndrome, properdin deficiency, X-linked, absent radius-anogenital anomalies syndrome, radiation sensitivity of natural killer activity, reticuloendotheliosis, X-linked, spastic paraparesis-deafness syndrome, spatial visualization, aptitude for, Taqi polymorphism, taurodontism, microdontia, and dens invaginatus, thrombocytopenia with elevated serum IgA and renal disease, thumbs, congenital Clasped, ulnar hypoplasia-split foot syndrome, unique green phenomenon, VACTERL association, X-linked, with or without hydrocephalus, widow’s peak syndrome, hairy ears, Y-linked, ubiquitin-activating enzyme, Y-linked, hypomagnesemia, hypertension, and hypercholesterolemia, mitochondrial, cardiomyopathy, infantile hypertrophic, chloramphenicol toxicity, nephropathy, chronic tubulointerstitial, pancreatic hypoplasia-diabetes-congenital heart disease syndrome, macrocytosis, familial, pancreatic beta cell agenesis with neonatal diabetes mellitus, chondrodysplasia-pseudohermaphroditism syndrome, familial caudal dysgenesis, gonadal agenesis, succinic acidemia, parotid salivary glands, polycystic dysgenetic disease of, enteropathy, familial, with villous edema and immunoglobulin G2 deficiency, pachydermodactyly, familial, angiokeratoma corporis diffusum with arteriovenous fistulas, pigment dispersion syndrome, setting-Sun phenomenon, familial benign, enuresis, nocturnal, 1, varicella, severe recurrent, dwarfism, familial, with muscle spasms, isoproterenol-mediated vasodilatation, nocturnal enuresis, 2, mitochondrial import-stimulating factor, hereditary hyperferritinemia with congenital cataracts, ectodermal dysplasia with intellectual disability and syndactyly, enamel hypoplasia, cataracts, and aqueductal stenosis, protocadherin 3, cardiac malformation, cleft lip/palate, microcephaly, and digital anomalies, portal vein, cavernous transformation of, midline malformations, multiple, with limb abnormalities and hypopituitarism, ichthyosis-intellectual disability syndrome with large keratohyalin granules in the skin, Ayme-Gripp syndrome, guanylate cyclase 2E, trisomy 18-like syndrome, muscular dystrophy, congenital, with severe central nervous system atrophy and absence of large myelinated fibers, osteoporosis-oculocutaneous hypopigmentation syndrome, myeloid tumor suppressor, epithelial basolateral chloride conductance regulator, rabbit, homolog of, atrophia maculosa varioliformis cutis, familial, spinal dysplasia, Anhalt type, Martinez-Frias syndrome, myelodysplasia, immunodeficiency, facial dysmorphism, short stature, and psychomotor delay, ectrodactyly of lower limbs, congenital heart defect, and micrognathia, short stature, Brussels type, deafness-epiphyseal dysplasia-short stature syndrome, amelia cleft lip palate hydrocephalus iris coloboma, distal monosomy 10p, cervical ribs, Sprengel anomaly, anal atresia, and urethral obstruction, microcephaly, corpus callosum dysgenesis, and cleft lip/palate, anterior chamber cleavage disorder, cerebellar hypoplasia, hypothyroidism, and tracheal stenosis, progressive deafness with stapes fixation, patent ductus venosus, ribbing disease, microcephaly, retinitis pigmentosa, and sutural cataract, facial dysmorphism-lens dislocation-anterior segment abnormalities-spontaneous filtering blebs syndrome, spastic paraplegia and Evans syndrome, iris pigment epithelium anomalies, acute insulin response, sebaceous gland hyperplasia, familial presenile, superior transverse scapular ligament, calcification of, familial, Spondylospinal thoracic dysostosis, acroosteolysis-keloid-like lesions-premature aging syndrome, vacuolar Neuromyopathy, sperm-specific antigen 1, otofacioosseous-gonadal syndrome, broad terminal phalanges, familial, capillary infantile hemangioma, medium chain 3-ketoacyl-Coa thiolase deficiency, ventriculomegaly with defects of the radius and kidney, mitochondrial intermembrane space protein Tim12, yeast, homolog of, sensorineural hearing loss, retinal pigment epithelium lesions, discolored teeth, Weyers ulnar ray/oligodactyly syndrome, creases, infra-auricular cutaneous, with tall stature and advanced bone age, pseudoacromegaly with severe insulin resistance, grange syndrome, jejunal atresia with renal adysplasia, microcephaly, macrotia, and intellectual disability, facial dysmorphism, cleft palate, hearing loss, and camptodactyly, brachydactyly, intraventricular septal defect, and deafness, emphysema, congenital, with deafness, penoscrotal web, and intellectual disability, pancreatic lymphoma, familial, camptodactyly, myopia, and fibrosis of the medial rectus muscle of eye, skeletal dysplasia and progressive central nervous system degeneration, lethal, intellectual disability, severe, with spasticity and pigmentary tapetoretinal degeneration, tumor suppressor gene on chromosome 11, spastic paraplegia, optic atrophy, microcephaly, and 10Y sex reversal, apraxia of eyelid opening, dislocated elbows, bowed tibias, scoliosis, deafness, cataract, microcephaly, and intellectual disability, muscular dystrophy, congenital, with cerebellar atrophy, GRACILE syndrome, familial gestational hyperthyroidism, long chain fatty acids, defect in transport of, Osebold skeletal dysplasia/osteolysis syndrome, osteosclerotic chondrodysplasia, lethal, with intracellular inclusions, microcephaly, severe, with skeletal anomalies including posterior rib-Gap defects, Tonoki syndrome, expansile bone lesions, Oroacral syndrome, Verloes-Koulischer type, Dyserythropoiesis, congenital, with ultrastructurally normal erythroblast heterochromatin, microcephaly, facial abnormalities, micromelia, and intellectual disability, follicular atrophoderma, perioral pigmented, with milia and epidermoid cysts, parotitis, juvenile recurrent, facial dysmorphism, selective tooth agenesis, and choroid calcification, osteoma of cranial vault, familial, neuroendocrine carcinoma of salivary glands, sensorineural hearing loss, and enamel hypoplasia, atrial septal defect, secundum, with various cardiac and Noncardiac defects, exostosis, Dupuytren subungual, eccrine syringofibroadenomatosis with eyelid abnormalities, blue nevi, familial multiple, blepharophimosis - intellectual disability syndrome, SBBYS type, Acrodysplasia with ossification abnormalities, short stature, and fibular hypoplasia, intervertebral disk degenerative disorder, Caronte, cholesteatoma, congenital, Hirschsprung disease with heart defects, laryngeal anomalies, and preaxial polydactyly, Chudley-McCullough syndrome, camera-Marugo-Cohen syndrome, anemia, congenital hypoplastic, with multiple congenital anomalies/intellectual disability syndrome, myoclonic epilepsy, congenital deafness, macular dystrophy, and psychiatric disorders, ulnar ray dysgenesis with postaxial polydactyly and renal cystic dysplasia, lissencephaly, familial, with cleft palate and cerebellar hypoplasia, polyneuropathy, lethal neonatal, axonal sensorimotor, autosomal recessive, growth and developintellectual disability, ocular ptosis, cardiac defect, and anal atresia, polycystic bone disease, mandibulofacial dysostosis syndrome, Bauru type, hyaluronan metabolism, defect 1N, wormian bone-multiple fractures-dentinogenesis imperfecta-skeletal dysplasia, Wolfram syndrome 2, diabetes mellitus, congenital autoimmune, low density lipoprotein cholesterol, mild elevation of, clavicular hypoplasia, zygomatic arch hypoplasia, and micrognathia, early response to neural induction gene, pseudohyperaldosteronism type 2, Wiedemann-Steiner syndrome, frontoocular syndrome, fibromatosis, gingival, with hypertrichosis and intellectual disability, tetralogy of fallot syndrome, autosomal recessive, anisomastia, ovarian dysgenesis, hypergonadotropic, with short stature and recurrent metabolic acidosis, short stature, intellectual disability, callosal agenesis, Heminasal hypoplasia, microphthalmia, and atypical clefting, arthropathy, erosive, liver fibrocystic disease and polydactyly, crumpled helices and small mouth, acromegaloid features, overgrowth, cleft palate, and hernia, Sener syndrome, baculum, congenital absence of, carnitine acetyltransferase deficiency, laryngeal abductor paralysis with cerebellar ataxia and motor neuropathy, intellectual disability, short stature, facial anomalies, and joint dislocations, Phelan-McDermid syndrome, intellectual disability, microcephaly, growth retardation, joint contractures, and facial dysmorphism, alveolar soft part sarcoma, pathological gambling, Megarbane syndrome, partial lipodystrophy, congenital cataracts, and neurodegeneration syndrome, gastrointestinal stromal tumor, hemifacial myohyperplasia, peripheral arterial occlusive disease 1, parasomnia, sleep bruxism type, Cardioneuromyopathy with hyaline masses and nemaline rods, Cree intellectual disability syndrome, primary intraosseous venous malformation, duodenojejunal atresia with volvulus, absent dorsal mesentery, and absent superior mesenteric artery, symphalangism, distal, with microdontia, dental pulp stones, and narrowed zygomatic arch, COPD, severe early onset, laryngeal atresia, encephalocele, and limb deformities, epilepsy, partial, with pericentral spikes, hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration, horizontal gaze palsy with progressive scoliosis, streptococcus, group A, severity of infection by, thyroid Hurthle cell carcinoma, headache associated with sexual activity, Camptosynpolydactyly, complex, secretory diarrhea, myopathy, and deafness, spastic paraplegia, ataxia, and intellectual disability, breath-holding Spells, prostate cancer aggressiveness quantitative trait locus on chromosome 19, microphthalmia with cyst, bilateral facial clefts, and limb anomalies, cataract, congenital, with mental impairment and dentate gyrus atrophy, craniolenticulosutural dysplasia, nonimmune chronic idiopathic neutropenia of adults, caudal duplication, Thai symphalangism syndrome, bile and pancreatic ducts, complete absence of, ovarian hyperstimulation syndrome, zinc deficiency, transient neonatal, aspirin resistance, mandibulofacial dysostosis with ptosis, autosomal dominant, parathyroid gland carcinoma, growth failure, microcephaly, intellectual disability, cataracts, large joint contractures, osteoporosis, cortical dysplasia, and cerebellar atrophy, scimitar anomaly, multiple cardiac malformations, and craniofacial and central nervous system abnormalities, capillary malformation-arteriovenous malformation syndrome, speech-sound disorder, alopecia universalis congenita, 10Y gonadal dysgenesis, and laryngomalacia, choanal atresia-hearing loss-cardiac defects-craniofacial dysmorphism syndrome, brachial palsy, familial congenital, oligodontia-cancer predisposition syndrome, midface hypoplasia, obesity, developmental delay, and neonatal hypotonia, ichthyosis prematurity syndrome, intellectual disability-brachydactyly-Pierre Robin syndrome, neuropathy, hereditary sensory and autonomic, adult-onset, with anosmia, growth delay due to insulin-like growth factor type 1 deficiency, sudden infant death-dysgenesis of the testes syndrome, leukoencephalopathy, arthritis, colitis, and hypogammaglobulinema, metaphyseal undermodeling, spondylar dysplasia, and overgrowth, lateral semicircular canal malformation, familial, with external and middle ear abnormalities, Meacham syndrome, marfanoid habitus with situs inversus, peripheral cone dystrophy, Emanuel syndrome, intellectual disability with optic atrophy, facial dysmorphism, microcephaly, and short stature, skeletal dysplasia, rhizomelic, with retinitis pigmentosa, familial hyperthyroidism due to mutations in TSH receptor, umbilicus, familial flat, dandy-walker malformation with occipital cephalocele, autosomal dominant, hypotrichosis, progressive patterned scalp, with wiry hair, onycholysis, and cleft lip/palate, syncope, familial vasovagal, B-cell immunodeficiency, distal limb anomalies, and urogenital malformations, chromosome 18 pericentric inversion, colloid cysts of third ventricle, intellectual disability, keratoconus, febrile seizures, and sinoatrial block, Goldberg-Shprintzen syndrome, cleft palate, midfacial hypoplasia, triangular facies, and sensorineural hearing loss, nephropathy, progressive, with deafness, iridogoniodysgenesis and skeletal anomalies, omphalocele, diaphragmatic hernia, and radial ray defects, spondylomegaepiphyseal dysplasia with upper limb mesomelia, punctate calcifications, and deafness, Nguyen syndrome, trichilemmal cyst, short stature and Facioauriculothoracic malformations, 7q11.23 microduplication syndrome, hamartoma, Precalcaneal congenital fibrolipomatous, vasculitis, lymphocytic, cutaneous small vessel, ectodermal dysplasia, sensorineural hearing loss, and distinctive facial features, brachyphalangy, polydactyly, and tibial aplasia/hypoplasia, metaphyseal chondrodysplasia with cone-shaped epiphyses, normal hair, and normal hands, trichoscyphodysplasia, arthrogryposis multiplex with deafness, inguinal hernias, and early death, brachydactyly, coloboma, and anterior segment dysgenesis, congenital stromal corneal dystrophy, Devriendt syndrome, MORM syndrome, kyphoscoliosis 1, esophagitis, eosinophilic, 1, alcohol sensitivity, acute, Kleefstra syndrome, rhizomelic dysplasia, scoliosis, and retinitis pigmentosa, right pulmonary artery, anomalous origin of, familial, preauricular tag, isolated, autosomal dominant, 1, testicular microlithiasis, Koolen-de Vries syndrome, preterm premature rupture of the membranes, insulin-resistance syndrome type A, corticosterone methyloxidase type 2 deficiency, holoprosencephaly, recurrent infections, and monocytosis, deafness with labyrinthine aplasia, microtia, and microdontia, iris pattern, epiphyseal dysplasia, Baumann type, Polyosteolysis-hyperostosis syndrome, Sakoda complex, Potocki-Lupski syndrome, hereditary pulmonary alveolar proteinosis, craniofacial dysplasia - osteopenia syndrome, Mungan syndrome, Tented eyebrows, corticosteroid-binding globulin deficiency, familial cavitary optic disk anomaly, renal tubular acidosis, distal, with nephrocalcinosis, short stature, intellectual disability, and distinctive facies, peripapillary atrophy, beta type, dystonia with cerebellar atrophy, Dauwerse-Peters syndrome, tremor, hereditary essential, and idiopathic normal pressure hydrocephalus, mesomelic dysplasia, camera type, Stevenson-Carey syndrome, Hunter-Macdonald syndrome, hypophosphatemic rickets and hyperparathyroidism, deafness, unilateral, with delayed endolymphatic hydrops, histiocytoma, Angiomatoid fibrous, diastasis recti and weakness of the linea alba, Ewing sarcoma, extraskeletal myxoid chondrosarcoma, bilateral microtia-deafness-cleft palate syndrome, Pseudofolliculitis barbae, skeletal defects, genital hypoplasia, and intellectual disability, endocrine-cerebro-osteodysplasia syndrome, cholestasis-pigmentary retinopathy-cleft palate syndrome, faciocardiomelic syndrome, hypotonia, seizures, and precocious puberty, Megarbane-Jalkh syndrome, Giacheti syndrome, lethal polymalformative syndrome, Boissel type, microcephaly, growth retardation, cataract, hearing loss, and unusual appearance, Stargardt macular degeneration, absent or hypoplastic corpus callosum, intellectual disability, and dysmorphic features, Santos syndrome, CLAPO syndrome, hereditary hypotrichosis with recurrent skin vesicles, hydrops fetalis, nonimmune, with gracile bones and dysmorphic features, trichotillomania, Pseudopili annulati, bile acid malabsorption, primary, 1, syndromic multisystem autoimmune disease due to ITCH deficiency, Birbeck granule deficiency, Warsaw breakage syndrome, chromosome 15q24 deletion syndrome, esophagitis, eosinophilic, 2, Reynolds syndrome, early repolarization associated with ventricular fibrillation, chromosome 4Q32.1-q32.2 triplication syndrome, forsythe-wakeling syndrome, lymphedema-posterior choanal atresia syndrome, agenesis of the corpus callosum and congenital lymphedema, brachydactyly, type A1, with short stature, scoliosis, microcephaly, ptosis, hearing loss, and intellectual disability, odontoid hypoplasia, cocoon syndrome, tuberculin skin test reactivity, absence of, intellectual disability, anterior maxillary protrusion, and strabismus, THOC6-related developmental delay-microcephaly-facial dysmorphism syndrome, mammary-digital-nail syndrome, supernumerary der(22)t(8;22) syndrome, porencephaly-microcephaly-bilateral congenital cataract syndrome, chromosome 1p32-p31 deletion syndrome, Congenital adrenal insufficiency with 46, XY sex reversal OR 46,XY disorder of sex development-adrenal insufficiency due to CYP11A1 deficiency, multisystemic smooth muscle dysfunction syndrome, inosine triphosphatase deficiency, fucosyltransferase 6 deficiency, Hirschsprung disease, cardiac defects, and autonomic dysfunction, obesity, hyperphagia, and developmental delay, lipodystrophy, partial, acquired, with low complement component c3, with or without glomerulonephritis, acetyl-coa carboxylase deficiency, Okt4 epitope deficiency, cyanosis, transient neonatal, protein Z deficiency, hydroxyacyl glutathione hydrolase deficiency, trypsinogen deficiency, acetyl-CoA acetyltransferase-2 deficiency, N-acetylaspartate deficiency, anhaptoglobinemia, plasma fibronectin deficiency, recurrent infections associated with rare immunoglobulin isotypes deficiency, hyperbiliverdinemia, myostatin-related muscle hypertrophy, hypertelorism-preauricular sinus-punctual pits-deafness syndrome, craniofacial anomalies and anterior segment dysgenesis syndrome, microcephaly-capillary malformation syndrome, arthrogryposis, Perthes disease, and upward gaze palsy, platelet-activating factor acetylhydrolase deficiency, tetrasomy 18p, EDICT syndrome, cognitive impairment with or without cerebellar ataxia, peripheral neuropathy-myopathy-hoarseness-hearing loss syndrome, glucocorticoid therapy, response to, transient infantile hypertriglyceridemia and hepatosteatosis, Huppke-Brendel syndrome, psychomotor retardation, epilepsy, and craniofacial dysmorphism, encephalomyopathy, mitochondrial, due to voltage-dependent anion channel deficiency, intestinal obstruction in the newborn due to guanylate cyclase 2C deficiency, hypertelorism and other facial dysmorphism, brachydactyly, genital abnormalities, intellectual disability, and recurrent inflammatory episodes, alar cleft, isolated, facial paresis, hereditary congenital, 3, Malan overgrowth syndrome, metaphyseal chondromatosis with D-2-hydroxyglutaric aciduria, immunodeficiency 28, retinal dystrophy, optic nerve edema, splenomegaly, anhidrosis, and migraine headache syndrome, phosphohydroxylysinuria, facial dysmorphism-immunodeficiency-livedo-short stature syndrome, intellectual disability-strabismus syndrome, estrogen resistance syndrome, severe feeding difficulties-failure to thrive-microcephaly due to ASXL3 deficiency syndrome, severe dermatitis-multiple allergies-metabolic wasting syndrome, severe intellectual disability-short stature-behavioral abnormalities-facial dysmorphism syndrome, testicular anomalies with or without congenital heart disease, multiple fibroadenoma of the breast, complement factor b deficiency, microcephaly-thin corpus callosum-intellectual disability syndrome, L-ferritin deficiency, macrocephaly-developmental delay syndrome, autosomal recessive primary immunodeficiency with defective spontaneous natural killer cell cytotoxicity, chromosome 16 inversion, 0.45-Mb, short stature due to GHSR deficiency, Webb-Dattani syndrome, kallikrein, decreased urinary activity of, short stature due to primary acid-labile subunit deficiency, hyperthyroxinemia, familial dysalbuminemic, congenital analbuminemia, immunodeficiency 37, retinitis pigmentosa-juvenile cataract-short stature-intellectual disability syndrome, chronic atrial and intestinal dysrhythmia, hyperproinsulinemia, Tenorio syndrome, congenital contractures of the limbs and face, hypotonia, and developmental delay, mitochondrial short-chain Enoyl-Coa hydratase 1 deficiency, peeling skin-leukonuchia-acral punctate keratoses-cheilitis-knuckle pads syndrome, immunodeficiency 39, mandibulofacial dysostosis with alopecia, congenital cataract-microcephaly-nevus flammeus simplex-severe intellectual disability syndrome, BENTA disease, microcephaly-intellectual disability-sensorineural hearing loss-epilepsy-abnormal muscle tone syndrome, progressive microcephaly-seizures-cortical blindness-developmental delay syndrome, primary immunodeficiency with post-measles-mumps-rubella vaccine viral infection, PMP22-RAI1 contiguous gene duplication syndrome, DeSanto-Shinawi syndrome due to WAC point mutation, familial progressive retinal dystrophy-iris coloboma-congenital cataract syndrome, palatal anomalies-widely spaced teeth-facial dysmorphism-developmental delay syndrome, wooly hair, autosomal recessive 3, leukodystrophy and acquired microcephaly with or without dystonia;, inherited oocyte maturation defect, Lamb-Shaffer syndrome, Luscan-Lumish syndrome, exercise intolerance, riboflavin-responsive, split-foot malformation-mesoaxial polydactyly syndrome, heart and brain malformation syndrome, chorea, childhood-onset, with psychomotor retardation, retinitis pigmentosa and erythrocytic microcytosis, macrocephaly, dysmorphic facies, and psychomotor retardation, MIRAGE syndrome, tall stature-intellectual disability-renal anomalies syndrome, Alazami-Yuan syndrome, ZTTK syndrome, Sifrim-Hitz-Weiss syndrome, short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay, Chitayat syndrome, language delay and attention deficit-hyperactivity disorder/cognitive impairment with or without cardiac arrhythmia, Shashi-Pena syndrome, sudden cardiac failure, infantile, sudden cardiac failure, alcohol-induced, cone-rod dystrophy and hearing loss, lung disease, immunodeficiency, and chromosome breakage syndrome;, uncombable hair syndrome 2, uncombable hair syndrome 3, global developmental delay, absent or hypoplastic corpus callosum, and dysmorphic facies, coloboma, osteopetrosis, microphthalmia, macrocephaly, albinism, and deafness, Yao syndrome, hypotonia, ataxia, and delayed development syndrome, FRAXF syndrome, arthrogryposis multiplex congenita, aniridia - intellectual disability syndrome, radial deficiency-tibial hypoplasia syndrome, familial pancreatic carcinoma, progeroid syndrome, 17q11.2 microduplication syndrome, hereditary sensory and autonomic neuropathy with deafness and global delay, hereditary neoplastic syndrome, orofaciodigital syndrome, lethal recessive chondrodysplasia, Coffin-Siris syndrome, craniosynostosis, keratoconus, congenital pseudoarthrosis of the limbs, hereditary hemophagocytic lymphohistiocytosis, hereditary dementia, advanced sleep phase syndrome, dysmorphism-cleft palate-loose skin syndrome, oculomaxillofacial dysostosis, isolated congenital breast hypoplasia/aplasia, primary pigmented nodular adrenocortical disease, shoulder and thorax deformity-congenital heart disease syndrome, erythromelalgia, Cornelia de Lange syndrome, familial clubfoot with or without associated lower limb anomalies, hereditary gingival fibromatosis, syndromic microphthalmia, progressive non-infectious anterior vertebral fusion, hereditary hypoparathyroidism, hereditary hyperparathyroidism, familial ovarian cancer, hereditary breast carcinoma, heart-hand syndrome, Kabuki syndrome, familial hyperaldosteronism, lymphoproliferative syndrome, split hand-foot malformation, dysraphism-cleft lip/palate-limb reduction defects syndrome, primary hypertrophic osteoarthropathy, Melhem-Fahl syndrome, hereditary anemia, limb transversal defect-cardiac anomaly syndrome, frontonasal dysplasia, familial visceral myopathy, osteochondrodysplatic nanism-deafness-retinitis pigmentosa syndrome, Opitz G/BBB syndrome, oromandibular-limb hypogenesis syndrome, heritable pulmonary arterial hypertension, imperforate oropharynx-costo vetebral anomalies syndrome, familial vesicoureteral reflux, Pilotto syndrome, celiac trunk compression syndrome, 3MC syndrome, hypoplastic pancreas-intestinal atresia-hypoplastic gallbalder syndrome, renal-hepatic-pancreatic dysplasia, lethal congenital contracture syndrome, triphalangeal thumb-polysyndactyly syndrome, autosomal recessive leukoencephalopathy-ischemic stroke-retinitis pigmentosa syndrome, van Maldergem syndrome, sclerosteosis, diencephalic-mesencephalic junction dysplasia, familial nonmedullary thyroid carcinoma, multiple synostoses syndrome, T-cell immunodeficiency with epidermodysplasia verruciformis, syngnathia multiple anomalies, syngnathia-cleft palate syndrome, humero-radio-ulnar synostosis, severe early-onset obesity-insulin resistance syndrome due to SH2B1 deficiency, spondylocostal dysostosis-hypospadias-intellectual disability syndrome, thrombocytopenia-Robin sequence syndrome, tibial aplasia-ectrodactyly syndrome, microcephaly-brachydactyly-kyphoscoliosis syndrome, hereditary glaucoma, familial cervical artery dissection, bipartite talus, skeletal dysplasia, acrofacial dysostosis, chronic granulomatous disease, Hirschsprung disease, growth retardation-mild developmental delay-chronic hepatitis syndrome, osteonecrosis of genetic origin, global developmental delay - lung cysts - overgrowth - Wilms tumor syndrome, hereditary gastric cancer, severe congenital neutropenia, hypogonadotropic hypogonadism, GCGR-related hyperglucagonemia, autosomal dominant myopia-midfacial retrusion-sensorineural hearing loss-rhizomelic dysplasia syndrome, visceral heterotaxy, hereditary neuroendocrine tumor of small intestine, hereditary otorhinolaryngologic disease, congenital bilateral absence of vas deferens, bile duct cyst, Caroli syndrome, isolated neonatal sclerosing cholangitis, arterial calcification of infancy, branchiootic syndrome, Mazabraud syndrome, inherited hemoglobinopathy, inborn errors of metabolism, familial thrombocytosis, androgen insensitivity syndrome, central precocious puberty, familial long QT syndrome, inherited obesity, Axenfeld-Rieger syndrome, inherited isolated nail anomaly, lymphatic malformation, ischio-vertebral syndrome, fetal and neonatal alloimmune thrombocytopenia, anterior segment dysgenesis, amelogenesis imperfecta, van der Woude syndrome, familial thoracic aortic aneurysm and aortic dissection, inherited primary ovarian failure, distal arthrogryposis, Ehlers-Danlos syndrome, inherited sideroblastic anemia, posterior polymorphous corneal dystrophy, familial parathyroid adenoma, Simpson-Golabi-Behmel syndrome type 1, sex-linked disease, microcephaly, growth restriction and increased sister chromatid exchange, microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome, autosomal dominant wooly hair, congenital short bowel syndrome, autosomal recessive, uncombable hair syndrome 1, Menke-Hennekam syndrome, dwarfism with tall vertebrae, pulmonary alveolar proteinosis with hypogammaglobulinemia, contractures, pterygia, and variable skeletal fusions syndrome, syndactyly, polydactyly, brachydactyly, RASopathy, immunodeficiency disease, laminopathy, inherited blood coagulation disorder, central centrifugal cicatricial alopecia, double fingernail of fifth finger, FRAXD syndrome, familial colorectal cancer, familial partial paralysis, Dursun syndrome, hereditary disorder of connective tissue, Marinesco-Sjogren-like syndrome, WHIM syndrome, visceral neuropathy, familial, neurologic, endocrine, and pancreatic disease, multisystem, infantile-onset, portal hypertension, noncirrhotic, multiple congenital anomalies-neurodevelopmental syndrome, X-linked, azoospermia, obstructive, with nephrolithiasis, megacystis-microcolon-intestinal hypoperistalsis syndrome, Mullegama-Klein-Martinez syndrome, Shukla-Vernon syndrome, Basilicata-Akhtar syndrome, serpinopathy, peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, intellectual developmental disorder with hypertelorism and distinctive facies, Diets-Jongmans syndrome, autoinflammation with episodic fever and lymphadenopathy, retinal dystrophy with leukodystrophy, skeletal dysplasia, mild, with joint laxity and advanced bone age, Nizon-Isidor syndrome, seizures, early-onset, with neurodegeneration and brain calcifications, leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, leukoencephalopathy, motor delay, spasticity, and dysarthria syndrome, proteinuria, chronic benign, Liberfarb syndrome, microcephaly, developmental delay, and brittle hair syndrome, 46,xx sex reversal 5, intellectual developmental disorder with autistic features and language delay, with or without seizures, neurodevelopmental, jaw, eye, and digital syndrome, agenesis of corpus callosum, cardiac, ocular, and genital syndrome, retinitis pigmentosa 89, spondylometaphyseal dysplasia with corneal dystrophy, Teebi hypertelorism syndrome, leukoencephalopathy, hereditary diffuse, with spheroids, gastrointestinal defect and immunodeficiency syndrome, developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, intellectual developmental disorder with speech delay and axonal peripheral neuropathy, vertebral hypersegmentation and orofacial anomalies, cardiofacioneurodevelopmental syndrome, Kaya-Barakat-Masson syndrome, leukoencephalopathy, progressive, infantile-onset, with or without deafness, Lessel-Kreienkamp syndrome, intellectual developmental disorder with paroxysmal dyskinesia or seizures, Li-Campeau syndrome, neurofacioskeletal syndrome with or without renal agenesis, deafness, congenital, and adult-onset progressive leukoencephalopathy, oculomotor-abducens synkinesis, blistering, acantholytic, of oral and laryngeal mucosa, vertebral, cardiac, tracheoesophageal, renal, and limb defects, developmental delay with dysmorphic facies and dental anomalies, Kohlschutter-Tonz syndrome-like, bile acid conjugation defect 1, short stature, oligodontia, dysmorphic facies, and motor delay, global developmental delay with speech and behavioral abnormalities, vitreoretinopathy with phalangeal epiphyseal dysplasia, Baralle-Macken syndrome, dyskinesia with orofacial involvement, inherited interstitial lung disease, Bryant-Li-Bhoj neurodevelopmental syndrome, restrictive dermopathy, Stuve-Wiedemann syndrome, cardiac valvular defect, craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development syndrome, cardioacrofacial dysplasia, Tessadori-Van-Haaften neurodevelopmental syndrome, Carey-Fineman-Ziter syndrome, thyroid hormone metabolism, abnormal, short stature, facial dysmorphism, and skeletal anomalies with or without cardiac anomalies, developmental delay with short stature, dysmorphic facial features, and sparse hair, Braddock-Carey syndrome, ophthalmoplegia, external, with rib and vertebral anomalies, intellectual developmental disorder with macrocephaly, seizures, and speech delay, cardiac, facial, and digital anomalies with developmental delay, osteochondrodysplasia, brachydactyly, and overlapping malformed digits, warburg-cinotti syndrome, Snijders Blok-Campeau syndrome, inflammatory bowel disease, immunodeficiency, and encephalopathy, vertebral anomalies and variable endocrine and T-cell dysfunction, arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development, trichohepatoneurodevelopmental syndrome, mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations, fibrosis, neurodegeneration, and cerebral angiomatosis, cardiac-urogenital syndrome, visual impairment and progressive phthisis bulbi, microcephaly, cataracts, impaired intellectual development, and dystonia with abnormal striatum, macrocephaly, acquired, with impaired intellectual development, mucocutaneous ulceration, chronic, intellectual developmental disorder with cardiac defects and dysmorphic facies, global developmental delay with or without impaired intellectual development, infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development, intellectual developmental disorder with abnormal behavior, microcephaly, and short stature, polymicrogyria with or without vascular-type Ehlers-Danlos syndrome, microcephaly, growth deficiency, seizures, and brain malformations, short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis, turnpenny-fry syndrome, facial dysmorphism, hypertrichosis, epilepsy, intellectual/developmental delay, and gingival overgrowth syndrome, leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate, global developmental delay, progressive ataxia, and elevated glutamine, metabolic crises, recurrent, with variable encephalomyopathic features and neurologic regression, gonadal dysgenesis, dysmorphic facies, retinal dystrophy, and myopathy, intellectual developmental disorder with short stature and variable skeletal anomalies, developmental delay with or without dysmorphic facies and autism, Khan-Khan-Katsanis syndrome, cerebellar, ocular, craniofacial, and genital syndrome, hypotonia, hypoventilation, impaired intellectual development, dysautonomia, epilepsy, and eye abnormalities, congenital hypotonia, epilepsy, developmental delay, and digital anomalies, cerebellar atrophy with seizures and variable developmental delay, O’Donnell-Luria-Rodan syndrome, ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facial features, hypopigmentation, organomegaly, and delayed myelination and development, glycosylphosphatidylinositol biosynthesis defect 21, spastic tetraplegia and axial hypotonia, progressive, snijders blok-fisher syndrome, intellectual developmental disorder with nasal speech, dysmorphic facies, and variable skeletal anomalies, lower urinary tract obstruction, congenital, Usher syndrome, type 1M, Siddiqi syndrome, oculopharyngeal myopathy with leukoencephalopathy 1, neurooculocardiogenitourinary syndrome, intellectual developmental disorder with impaired language and dysmorphic facies, hydrocephalus, congenital communicating, 1, intellectual developmental disorder with speech delay, autism, and dysmorphic facies, lessel-kubisch syndrome, intellectual developmental disorder with short stature and behavioral abnormalities, short stature and microcephaly with genital anomalies, megabladder, congenital, Heyn-Sproul-Jackson syndrome, intellectual developmental disorder with behavioral abnormalities and craniofacial dysmorphism with or without seizures, ectodermal dysplasia with facial dysmorphism and acral, ocular, and brain anomalies, Liang-Wang syndrome, neuromuscular disease and ocular or auditory anomalies with or without seizures, structural brain anomalies with impaired intellectual development and craniosynostosis, pachygyria, microcephaly, developmental delay, and dysmorphic facies, with or without seizures, intellectual developmental disorder with hypotonia and behavioral abnormalities, Catifa syndrome, CEBALID syndrome, congenital heart defects, multiple types, 7, Imagawa-Matsumoto syndrome, juvenile arthritis due to defect in LACC1, Beck-Fahrner syndrome, respiratory papillomatosis, juvenile recurrent, congenital, sandestig-stefanova syndrome, triokinase and FMN cyclase deficiency syndrome, T-cell lymphopenia, infantile, with or without nail dystrophy, autosomal dominant, intellectual developmental disorder with poor growth and with or without seizures or ataxia, pontocerebellar hypoplasia, hypotonia, and respiratory insufficiency syndrome, neonatal lethal, chromosome 1p36.33 duplication syndrome, atad3 gene cluster, autosomal dominant, genitourinary and/or brain malformation syndrome, rhizomelic limb shortening with dysmorphic features, Suleiman-El-Hattab syndrome, cone-rod synaptic disorder syndrome, congenital nonprogressive, Tolchin-Le Caignec syndrome, Li-Ghorbani-Weisz-Hubshman syndrome, autoinflammation, immune dysregulation, and eosinophilia, intellectual developmental disorder with seizures and language delay, mitochondrial complex 1 deficiency, nuclear type 35, deeah syndrome, combined oxidative phosphorylation deficiency 49, combined oxidative phosphorylation deficiency 50, Vissers-Bodmer syndrome, spinal muscular atrophy, infantile, James type, vitamin D-dependent rickets, type 3, cleft palate, proliferative retinopathy, and developmental delay, microcornea, rod-cone dystrophy, cataract, and posterior staphyloma 1, congenital cataract-severe neonatal hepatopathy-global developmental delay syndrome, microcephaly-facial dysmorphism-ocular anomalies-multiple congenital anomalies syndrome, early-onset familial hypoaldosteronism, chronic mast cell leukemia, DONSON-related microcephaly-short stature-limb abnormalities spectrum, choanal atresia-athelia-hypothyroidism-delayed puberty-short stature syndrome, CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome, cerebellar hypoplasia-intellectual disability-congenital microcephaly-dystonia-anemia-growth retardation syndrome, KLHL7-related Bohring-Opitz-like syndrome, oculogastrointestinal-neurodevelopmental syndrome, spastic paraparesis-cataracts-speech delay syndrome, inherited auditory system disease, Y chromosome infertility due to DAZ1 deletion, familial osteosclerosis, foveal hypoplasia, congenital heart defects, dysmorphic facial features, and intellectual developmental disorder, congenital heart defects and ectodermal dysplasia, brachycephaly, trichomegaly, and developmental delay, thrombocytopenia, anemia, and myelofibrosis, structural heart defects and renal anomalies syndrome, Rahman syndrome, retinitis pigmentosa-hearing loss-premature aging-short stature-facial dysmorphism syndrome, familial monosomy 7 syndrome, menstrual cycle-dependent periodic fever, Gabriele de Vries syndrome, Lopes-Maciel-Rodan syndrome, Skraban-Deardorff syndrome, amyotonia congenita, cerebral sclerosis, diffuse, scholz type, autoinflammation with arthritis and dyskeratosis, retinal dystrophy with or without macular staphyloma, Cohen-Gibson syndrome, maleylacetoacetate isomerase deficiency, congenital heart defects and skeletal malformations syndrome, microcephaly, short stature, and limb abnormalities, congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, cerebellar atrophy, developmental delay, and seizures, platelet abnormalities with eosinophilia and immune-mediated inflammatory disease, facial palsy, congenital, with ptosis and velopharyngeal dysfunction, immunodeficiency, developmental delay, and hypohomocysteinemia, Sweeney-Cox syndrome, combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia, Alkuraya-Kucinskas syndrome, Diamond-Blackfan anemia-like, hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, chromosome 1p35 deletion syndrome, hyperthyroxinemia, euthyroid, caused by generalized 5-prime-deiodinase deficiency, Jaberi-Elahi syndrome, deafness, congenital heart defects, and posterior embryotoxon, humerofemoral hypoplasia with radiotibial ray deficiency, intellectual developmental disorder with or without epilepsy or cerebellar ataxia, CDKL5 disorder, GATA1-Related X-Linked Cytopenia, focal segmental glomerulosclerosis and neurodevelopmental syndrome, hereditary skin disorder, AP-4 deficiency syndrome, inherited kidney disorder, Mendelian encephalopathy, X inactivation, familial skewed, growth hormone insensitivity syndrome with immune dysregulation, DICER1-related tumor predisposition, A20 haploinsufficiency, LTBP2-related ocular dysgenesis, inherited cutis laxa, inherited hypertrophic pyloric stenosis, inherited thrombocytopenia, multiple congenital anomalies-hypotonia-seizures syndrome, 46,XX sex reversal 1, microcephaly, epilepsy, and diabetes syndrome, SEC61A1 deficiency, achalasia, familial esophageal, MECOM-associated syndrome, TPM4-related platelet disorder, TRAF3 haploinsufficiency, NKX2-1 related choreoathetosis and congenital hypothyroidism with or without pulmonary dysfunction, hereditary neurological disease, cardiogenetic disease, hereditary narcolepsy, RNU4ATAC spectrum disorder, CTNNB1-related neurodevelopmental disorder and/or vitreoretinopathy, MTOR-related overgrowth spectrum, TOR1AIP1-related nuclear envelopathy, BMP4-related ocular growth disorder, CSF1R-related disorder, acinar dysplasia caused by mutation in FGF10, acinar dysplasia caused by mutation in FGFR2, acinar dysplasia caused by mutation in TBX4, EPHB4-associated vascular malformation spectrum, BAFopathy, hereditary skeletal muscle disorder, hereditary gallbladder disorder, prostate cancer, hereditary, POLR3A-related disorder, POLR3B-related disorder, POLR1C-related disorder, WFS1-related disorder, CACNA1C-related disorder, SMAD6-related disease, central hypoventilation syndrome, congenital, autoinflammatory-pancytopenia syndrome due to DNASE2 deficiency, alopecia universalis, microcornea, rod-cone dystrophy, cataract, and posterior staphyloma 2, myopathy, congenital, with excess of muscle spindles, pregnancy loss, recurrent, 4, urogenital adysplasia, yakut short stature syndrome, microcephaly, short stature, and impaired glucose metabolism, NR2F2 related multiple congenital anomalies/dysmorphic syndrome, ACD-related telomere biology disorder, AKT3-related overgrowth spectrum, rhabdomyosarcoma, embryonal, 2, blepharophimosis-impaired intellectual development syndrome, Radio-Tartaglia syndrome, Buratti-Harel syndrome, growth restriction, hypoplastic kidneys, alopecia, and distinctive facies, fibromuscular dysplasia, multifocal, dysostosis multiplex, Ain-Naz type, ataxia, intention tremor, and hypotonia syndrome, childhood-onset, deafness, cataract, impaired intellectual development, and polyneuropathy, onychodystrophy, osteodystrophy, impaired intellectual development, and seizures syndrome, Faundes-Banka syndrome, osteootohepatoenteric syndrome, hypokalemic tubulopathy and deafness, White-Kernohan syndrome, retinal dystrophy and microvillus inclusion disease, Luo-Schoch-Yamamoto syndrome, Usmani-Riazuddin syndrome, autosomal dominant, VISS syndrome, developmental delay, impaired speech, and behavioral abnormalities, bile acid malabsorption, primary, 2, DEGCAGS syndrome, Short stature, Dauber-Argente type, ventriculomegaly and arthrogryposis, Chopra-Amiel-Gordon syndrome, muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, biliary, renal, neurologic, and skeletal syndrome, Boudin-Mortier syndrome, Usmani-Riazuddin syndrome, autosomal recessive, intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, short stature, impaired intellectual development, microcephaly, hypotonia, and ocular anomalies, developmental delay with or without intellectual impairment or behavioral abnormalities, cerebellar ataxia, brain abnormalities, and cardiac conduction defects, developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities, fetal akinesia, respiratory insufficiency, microcephaly, polymicrogyria, and dysmorphic facies, delayed puberty, self-limited, Hengel-Maroofian-Schols syndrome, Zaki syndrome, dystonia, early-onset, and/or spastic paraplegia, developmental delay with variable neurologic and brain abnormalities, Rauch-Steindl syndrome, intellectual disability and myopathy syndrome, cerebellar dysfunction, impaired intellectual development, and hypogonadotropic hypogonadism, Kury-Isidor syndrome, macrocephaly, neurodevelopmental delay, lymphoid hyperplasia, and persistent fetal hemoglobin, intellectual developmental disorder with or without peripheral neuropathy, neurocardiofaciodigital syndrome, corneal dystrophy, punctiform and polychromatic pre-descemet, osteoporosis, childhood- or juvenile-onset, with developmental delay, hepatorenocardiac degenerative fibrosis, ACCES syndrome, developmental delay, impaired speech, and behavioral abnormalities, with or without seizures, liver disease, severe congenital, primordial dwarfism-immunodeficiency-lipodystrophy syndrome, intellectual developmental disorder with muscle tone abnormalities and distal skeletal defects, keratoderma-ichthyosis-deafness syndrome, autosomal recessive, developmental delay, hypotonia, and impaired language, intellectual developmental disorder with autism and dysmorphic facies, bone marrow failure and diabetes mellitus syndrome, developmental delay, behavioral abnormalities, and neuropsychiatric disorders, hypermetabolism due to uncoupled mitochondrial oxidative phosphorylation 2, intellectual developmental disorder with ocular anomalies and distinctive facial features, developmental delay with variable intellectual disability and dysmorphic facies, myopathy with myalgia, increased serum creatine kinase, and with or without episodic rhabdomyolysis 1, developmental delay, language impairment, and ocular abnormalities, Rabin-Pappas syndrome, muscular dystrophy, congenital, with or without seizures, obesity and hypopigmentation, joint contractures, osteochondromas, and B-cell lymphoma, respiratory infections, recurrent, and failure to thrive with or without diarrhea, developmental delay with hypotonia, myopathy, and brain abnormalities, Atelis syndrome, hereditary neuro-ophthalmological disease, autoinflammation with pulmonary and cutaneous vasculitis, neurooculorenal syndrome, combined low LDL and fibrinogen, hypersulfaturia, woolly hair-skin fragility syndrome, hematuria, benign familial, cataracts, hearing impairment, nephrotic syndrome, and enterocolitis, disabling pansclerotic morphea of childhood, Houge-Janssens syndrome, hearing loss, noise-induced, susceptibility to, encephalitis, acute, infection-induced, susceptibility to, 12, cranial dysinnervation disorder, congenital, with absent corneal reflex and developmental delay, congenital smooth muscle hamartoma, with or without hemihypertrophy, amegakaryocytic thrombocytopenia, congenital, 2, epilepsy, early-onset, xerosis and growth failure with immune and pulmonary dysfunction syndrome, Fliedner-Zweier syndrome, immune dysregulation, autoimmunity, and autoinflammation, arrhythmogenic cardiomyopathy with variable ectodermal abnormalities, developmental delay, dysmorphic facies, and brain anomalies, developmental delay with or without epilepsy, craniometadiaphyseal osteosclerosis with hip dysplasia, Lui-Jee-Baron syndrome, Long-Olsen-Distelmaier syndrome, Tan-Almurshedi syndrome, diabetes, deafness, developmental delay, and short stature syndrome, Alfadhel syndrome, Hoxha-Aliu syndrome, congenital insensitivity to pain syndrome, Marsili type, Yuksel-Vogel-Bauer syndrome, polydactyly-macrocephaly syndrome, isolated hyperferritinemia, megalencephaly-polydactyly syndrome, autoinflammation with episodic fever and immune dysregulation, autoinflammation with arthritis and vasculitis, myelofibrosis, congenital, with anemia, neutropenia, developmental delay, and ocular abnormalities, brain malformation renal syndrome, short stature with nonspecific skeletal abnormalities, bronchiectasis and nasal polyposis, neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, spastic paraplegia, mitochondrial, Pan-Chung-Bellen syndrome, autoinflammation, panniculitis, and dermatosis syndrome, telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature, Muggenthaler-Chowdhury-Chioza syndrome, ocular pterygium-digital keloid dysplasia syndrome, Tayoun-Maawali syndrome, craniofaciocardiohepatic syndrome, FICUS syndrome, Guillouet-Gordon syndrome, immunodysregulation with variable immunodeficiency and autoimmunity, ICHAD syndrome, cataract, alopecia, oral mucosal disorder, and psoriasis-like syndrome, immune dysregulation with immunodeficiency due to AIOLOS haploinsufficiency, ADNP-related blepharophimosis-intellectual disability syndrome, oculovertebral syndrome, Ververi-Brady syndrome, immune dysregulation, neurodevelopmental defects, and colitis, dyschromatosis, ichthyosis, deafness, and atopic disease, developmental delay with variable cardiac and renal congenital anomalies and dysmorphic facies, developmental delay with sleep apnea, Pitt-Hopkins or Pitt-Hopkins-like syndrome, intellectual developmental disorder, autosomal recessive 84, intellectual developmental disorder, autosomal dominant 77, periodontitis, aggressive, dental radicular dysplasia, intellectual developmental disorder with seizures and dysmorphic facies, STAD syndrome, craniosynostosis-scoliosis syndrome, COL4A1/A2-related disorder, TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, PI4KA-related disorder, NDUFB11-related disorders, EN1-related dorsoventral syndrome, DHDDS-CDG, PLEC-related muscular dystrophy-epidermolysis bullosa simplex spectrum disorder, FDXR-related optic atrophy mitochondrial dysfunction syndrome, PIK3R1-related immunodeficiency and SHORT syndrome, ACAN-related short stature spectrum, ELANE-related neutropenia, NR5A1-related sex development disorder, CRYAB-related myofibrillar myopathy-cataract-cardiomyopathy spectrum disorder, SYCE1-related gametogenic failure, RNU12-related minor spliceopathy disorder, MCM9-related gametogenic failure, CFTR-related disorder
Subtypes (1): melanoma, malignant familial intraocular
Genetics & variants
GWAS landscape
No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.
Variant details and genetic-evidence tiers
ClinVar germline variants
600 retrieved; paginated sample, class counts are floors:
268 uncertain significance, 140 likely benign, 95 benign/likely benign, 63 conflicting classifications of pathogenicity, 20 pathogenic, 6 likely pathogenic, 5 pathogenic/likely pathogenic, 3 benign
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 16928 | NM_000075.4(CDK4):c.70C>T (p.Arg24Cys) | CDK4 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 16929 | NM_000075.4(CDK4):c.71G>A (p.Arg24His) | CDK4 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 1068946 | NM_000077.5(CDKN2A):c.34del (p.Ser12fs) | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1069074 | NM_000077.5(CDKN2A):c.126dup (p.Ser43Ter) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 1070481 | NC_000009.11:g.(?21968228)(22160087_?)del | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1072356 | NM_058195.4(CDKN2A):c.126_127insCA (p.Val43fs) | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1075589 | NM_000077.5(CDKN2A):c.204_205delinsTT (p.Glu69Ter) | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1076895 | NC_000009.11:g.(?21994128)(21994330_?)del | CDKN2A | Pathogenic | criteria provided, single submitter |
| 135827 | NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 1409909 | NM_000077.5(CDKN2A):c.95_112del (p.Leu32_Leu37del) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 141882 | NM_058195.4(CDKN2A):c.193+5G>A | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 142061 | NM_000077.5(CDKN2A):c.47_50del (p.Leu16fs) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 142882 | NM_000077.5(CDKN2A):c.251A>C (p.Asp84Ala) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 1454814 | NM_000077.5(CDKN2A):c.76G>T (p.Glu26Ter) | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1456941 | NM_000077.5(CDKN2A):c.151-861_252del | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1457805 | NC_000009.11:g.(?21970891)(21975027_?)del | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1504229 | NM_058195.4(CDKN2A):c.193G>C (p.Gly65Arg) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 1510258 | NM_000077.5(CDKN2A):c.457+2T>G | CDKN2A | Pathogenic | criteria provided, single submitter |
| 1782299 | NM_000077.5(CDKN2A):c.19_22dup (p.Ser8fs) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 182409 | NM_000077.5(CDKN2A):c.131_132insAA (p.Tyr44Ter) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 182411 | NM_000077.5(CDKN2A):c.225_243del (p.Ala76fs) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 182412 | NM_000077.5(CDKN2A):c.240_253del (p.Pro81fs) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 182414 | NM_058195.4(CDKN2A):c.194-3653G>T | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 182416 | NM_000077.5(CDKN2A):c.151-1G>C | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 183759 | NM_000077.5(CDKN2A):c.335_337dup (p.Arg112dup) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 1345910 | NC_000009.11:g.(?21990646)(21994323_?)del | CDKN2A | Likely pathogenic | criteria provided, single submitter |
| 1347045 | NM_058195.4(CDKN2A):c.87_99del (p.Leu30fs) | CDKN2A | Likely pathogenic | criteria provided, single submitter |
| 1491259 | NM_058195.4(CDKN2A):c.193+2T>C | CDKN2A | Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 1497087 | NM_058195.4(CDKN2A):c.55C>T (p.Arg19Ter) | CDKN2A | Likely pathogenic | criteria provided, single submitter |
| 182423 | NM_000077.5(CDKN2A):c.322G>T (p.Asp108Tyr) | CDKN2A | Likely pathogenic | criteria provided, multiple submitters, no conflicts |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 46 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Somatic driver evidence (intOGen + CIViC, cohort fanout)
| Gene | intOGen role | Cancer types | CIViC |
|---|---|---|---|
| TP53 | LoF | ACC,ALL,AML,ANGS,ANSC,BCC,BL,BLADDER,BLCA,BRCA,CCRCC,CEAD,CESC,CHOL,CHRCC,CLLSLL,COAD,COADREAD,CSCC,DLBCLNOS,EGC,ES,ESCA,ESCC,GB,GBC,GBM,GIST,HCC,HGGNOS,HNSC,LGGNOS,LIPO,LMS,LNM,LUAD,LUSC,MBL,MEL,MLYM,MT,NBL,NETNOS,NHL,NPC,NSCLC,OS,OVT,PAAD,PANCREAS,PAST,PCM,PLMESO,PRAD,PRCC,PROSTATE,RCC,READ,SACA,SARCNOS,SCLC,SIC,SKCM,SKIN,SOFT_TISSUE,STAD,STOMACH,THYM,UCEC,UCS,UTUC,VULVA,WDTC,WT | CIViC #45 |
| POT1 | Act | ANGS,CLLSLL,LGGNOS,MEL,SOFT_TISSUE | CIViC #9935 |
| CDK4 | LoF | MEL | CIViC #13 |
| CDKN2A | LoF | ACYC,BLCA,BRCA,CHOL,COAD,COADREAD,CSCC,EGC,ESCA,ESCC,GBM,HCC,HNSC,LGGNOS,LUAD,LUSC,MEL,MLYM,NPC,NSCLC,OS,PAAD,PANCREAS,RCC,SKCM,SKIN,STAD,STOMACH,WDTC | CIViC #14 |
| MITF | CIViC #3527 |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| TP53 | Orphanet:1333 | Familial pancreatic carcinoma |
| TP53 | Orphanet:145 | Hereditary breast and/or ovarian cancer syndrome |
| TP53 | Orphanet:1501 | Adrenocortical carcinoma |
| TP53 | Orphanet:210159 | Adult hepatocellular carcinoma |
| TP53 | Orphanet:251576 | Gliosarcoma |
| TP53 | Orphanet:251579 | Giant cell glioblastoma |
| TP53 | Orphanet:251899 | Choroid plexus carcinoma |
| TP53 | Orphanet:2807 | Papilloma of choroid plexus |
| TP53 | Orphanet:293199 | Pleomorphic rhabdomyosarcoma |
| TP53 | Orphanet:3318 | Essential thrombocythemia |
| TP53 | Orphanet:524 | Li-Fraumeni syndrome |
| TP53 | Orphanet:52688 | Myelodysplastic syndrome |
| TP53 | Orphanet:585909 | B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2) |
| TP53 | Orphanet:667662 | Breast implant-associated anaplastic large cell lymphoma |
| TP53 | Orphanet:668 | Osteosarcoma |
| TP53 | Orphanet:67038 | B-cell chronic lymphocytic leukemia |
| TP53 | Orphanet:70573 | Small cell lung cancer |
| TP53 | Orphanet:96253 | Cushing disease |
| TP53 | Orphanet:99756 | Alveolar rhabdomyosarcoma |
| TP53 | Orphanet:99757 | Embryonal rhabdomyosarcoma |
| POT1 | Orphanet:251627 | Oligodendroglioma |
| POT1 | Orphanet:251630 | Anaplastic oligodendroglioma |
| POT1 | Orphanet:618 | Familial melanoma |
| POT1 | Orphanet:67038 | B-cell chronic lymphocytic leukemia |
| CDK4 | Orphanet:618 | Familial melanoma |
| CDK4 | Orphanet:99970 | Dedifferentiated liposarcoma |
| CDK4 | Orphanet:99971 | Well-differentiated liposarcoma |
| CDKN2A | Orphanet:1333 | Familial pancreatic carcinoma |
| CDKN2A | Orphanet:1501 | Adrenocortical carcinoma |
| CDKN2A | Orphanet:252206 | Melanoma and neural system tumor syndrome |
| CDKN2A | Orphanet:404560 | Familial atypical multiple mole melanoma syndrome |
| CDKN2A | Orphanet:524 | Li-Fraumeni syndrome |
| CDKN2A | Orphanet:585909 | B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2) |
| CDKN2A | Orphanet:618 | Familial melanoma |
| CDKN2A | Orphanet:99861 | Precursor T-cell acute lymphoblastic leukemia |
| DNAH1 | Orphanet:244 | Primary ciliary dyskinesia |
| DNAH1 | Orphanet:276234 | Non-syndromic male infertility due to sperm motility disorder |
| MC1R | Orphanet:618 | Familial melanoma |
| MC1R | Orphanet:79432 | Oculocutaneous albinism type 2 |
| MITF | Orphanet:293822 | MITF-related melanoma and renal cell carcinoma predisposition syndrome |
| MITF | Orphanet:319298 | Papillary renal cell carcinoma |
| MITF | Orphanet:404511 | Clear cell papillary renal cell carcinoma |
| MITF | Orphanet:42665 | Tietz syndrome |
| MITF | Orphanet:618 | Familial melanoma |
| MITF | Orphanet:895 | Waardenburg syndrome type 2 |
| MITF | Orphanet:897 | Waardenburg-Shah syndrome |
Cohort genes → proteins
11 cohort genes, 9 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| multi_evidence | 11 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| TSPAN31 | HGNC:10539 | ENSG00000135452 | Q12999 | Tetraspanin-31 | clinvar |
| TP53 | HGNC:11998 | ENSG00000141510 | P04637 | Cellular tumor antigen p53 | clinvar |
| AGAP2 | HGNC:16921 | ENSG00000135439 | Q99490 | Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 2 | clinvar |
| POT1 | HGNC:17284 | ENSG00000128513 | Q9NUX5 | Protection of telomeres protein 1 | clinvar |
| CDK4 | HGNC:1773 | ENSG00000135446 | P11802 | Cyclin-dependent kinase 4 | clinvar |
| CDKN2A | HGNC:1787 | ENSG00000147889 | P42771 | Cyclin-dependent kinase inhibitor 2A | clinvar |
| DNAH1 | HGNC:2940 | ENSG00000114841 | Q9P2D7 | Dynein axonemal heavy chain 1 | clinvar |
| CDKN2B-AS1 | HGNC:34341 | ENSG00000240498 | CDKN2B and CDKN2A antisense cis and trans regulatory RNA 1 | clinvar | |
| MIR6759 | HGNC:50063 | ENSG00000283621 | microRNA 6759 | clinvar | |
| MC1R | HGNC:6929 | ENSG00000258839 | Q01726 | Melanocyte-stimulating hormone receptor | clinvar |
| MITF | HGNC:7105 | ENSG00000187098 | O75030 | Microphthalmia-associated transcription factor | clinvar |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| TP53 | Cellular tumor antigen p53 | Multifunctional transcription factor that induces cell cycle arrest, DNA repair or apoptosis upon binding to its target DNA sequence. |
| AGAP2 | Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 2 | GTPase-activating protein (GAP) for ARF1 and ARF5, which also shows strong GTPase activity. |
| POT1 | Protection of telomeres protein 1 | Component of the telomerase ribonucleoprotein (RNP) complex that is essential for the replication of chromosome termini. |
| CDK4 | Cyclin-dependent kinase 4 | Ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. |
| CDKN2A | Cyclin-dependent kinase inhibitor 2A | Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. |
| DNAH1 | Dynein axonemal heavy chain 1 | Force generating protein of cilia required for sperm flagellum motility. |
| MC1R | Melanocyte-stimulating hormone receptor | G protein-coupled receptor that binds melanocyte-stimulating hormones (alpha, beta, and gamma-MSH) and adrenocorticotropic hormone/ACTH, which are peptide products of the POMC precursor protein. |
| MITF | Microphthalmia-associated transcription factor | Transcription factor that acts as a master regulator of melanocyte survival and differentiation as well as melanosome biogenesis. |
Protein-family classification
Druggable: 2 · Difficult: 4 · Unknown: 5 · Druggable fraction: 0.18
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Scaffold/PPI | 2 | 3.1× | 0.490 |
| Kinase | 1 | 2.5× | 0.490 |
| GPCR | 1 | 2.2× | 0.490 |
| Transcription factor | 2 | 1.5× | 0.490 |
| Other/Unknown | 5 | 0.8× | 0.840 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| TSPAN31 | Other/Unknown | no | Tetraspanin_animals, Tetraspanin/Peripherin | |
| TP53 | Transcription factor | no | p53_tumour_suppressor, p53-like_TF_DNA-bd_sf, p53_tetrameristn | |
| AGAP2 | Scaffold/PPI | no | ArfGAP_dom, Small_GTPase, PH_domain | |
| POT1 | Other/Unknown | no | Telomer_end-bd_POT1/Cdc13, NA-bd_OB-fold, POT1 | |
| CDK4 | Kinase | yes | 2.7.11.22 | Prot_kinase_dom, Ser/Thr_kinase_AS, Kinase-like_dom_sf |
| CDKN2A | Scaffold/PPI | no | Ankyrin_rpt-contain_sf, Ank_Repeat/CDKN_Inhibitor, Tumor_suppres_ARF | |
| DNAH1 | Other/Unknown | no | Dhc_D6_P-loop, Dhc_linker, Dhc_D4 | |
| CDKN2B-AS1 | Other/Unknown | no | ||
| MIR6759 | Other/Unknown | no | ||
| MC1R | GPCR | yes | GPCR_Rhodpsn, MSH_rcpt, Melcrt_ACTH_rcpt | |
| MITF | Transcription factor | no | bHLH_dom, MiT/TFE_C, MiT/TFE_N |
Expression context
Cohort genes with no expression data: 0.
9 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 1 |
| broad (>20) | 10 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| ganglionic eminence | 2 |
| ventricular zone | 2 |
| right uterine tube | 2 |
| islet of Langerhans | 1 |
| pancreatic ductal cell | 1 |
| pericardium | 1 |
| tendon of biceps brachii | 1 |
| cerebellar cortex | 1 |
| cerebellar hemisphere | 1 |
| right hemisphere of cerebellum | 1 |
| calcaneal tendon | 1 |
| germinal epithelium of ovary | 1 |
| secondary oocyte | 1 |
| embryo | 1 |
| cervix squamous epithelium | 1 |
| parotid gland | 1 |
| pituitary gland | 1 |
| bronchial epithelial cell | 1 |
| bronchus | 1 |
| mucosa of transverse colon | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| TSPAN31 | 288 | ubiquitous | marker | pancreatic ductal cell, islet of Langerhans, pericardium |
| TP53 | 223 | ubiquitous | marker | ventricular zone, ganglionic eminence, tendon of biceps brachii |
| AGAP2 | 212 | broad | marker | right hemisphere of cerebellum, cerebellar hemisphere, cerebellar cortex |
| POT1 | 279 | ubiquitous | marker | secondary oocyte, germinal epithelium of ovary, calcaneal tendon |
| CDK4 | 138 | ubiquitous | marker | embryo, ganglionic eminence, ventricular zone |
| CDKN2A | 220 | ubiquitous | marker | parotid gland, cervix squamous epithelium, pituitary gland |
| DNAH1 | 183 | tissue_specific | marker | right uterine tube, bronchial epithelial cell, bronchus |
| CDKN2B-AS1 | 169 | ubiquitous | marker | mucosa of transverse colon, rectum, transverse colon |
| MIR6759 | 11 | yes | colon, right atrium auricular region, gastrocnemius | |
| MC1R | 180 | broad | yes | granulocyte, right uterine tube, left testis |
| MITF | 293 | ubiquitous | marker | pigmented layer of retina, retina, skeletal muscle tissue of biceps brachii |
Protein interactions among cohort
Intra-cohort edges: 6.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| TP53 | 22,736 |
| CDKN2A | 9,311 |
| CDK4 | 8,412 |
| MITF | 2,908 |
| POT1 | 1,842 |
| DNAH1 | 1,699 |
| MC1R | 1,169 |
| AGAP2 | 989 |
| TSPAN31 | 593 |
| CDKN2B-AS1 | 0 |
Intra-cohort edges
| A | B | Sources |
|---|---|---|
| AGAP2 | CDK4 | biogrid_interaction |
| CDK4 | CDKN2A | biogrid_interaction, intact, string_interaction |
| CDK4 | TSPAN31 | string_interaction |
| CDKN2A | MC1R | string_interaction |
| CDKN2A | TP53 | string_interaction |
| MC1R | MITF | string_interaction |
Structural data
PDB: 8 · AlphaFold-only: 1 · No structure: 2
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| TP53 | P04637 | 313 |
| CDK4 | P11802 | 15 |
| POT1 | Q9NUX5 | 14 |
| MITF | O75030 | 12 |
| CDKN2A | P42771 | 5 |
| MC1R | Q01726 | 5 |
| AGAP2 | Q99490 | 3 |
| DNAH1 | Q9P2D7 | 2 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|---|---|
| TSPAN31 | Q12999 | 89.29 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 154. Enrichment computed across 11 evidence-associated genes (7 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 7 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 | 2 | 1631.4× | 1e-05 | CDK4, CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 | 2 | 1631.4× | 1e-05 | CDK4, CDKN2A |
| Diseases of Cellular Senescence | 2 | 1087.6× | 1e-05 | CDK4, CDKN2A |
| Evasion of Oncogene Induced Senescence Due to p16INK4A Defects | 2 | 1087.6× | 1e-05 | CDK4, CDKN2A |
| Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 | 2 | 1087.6× | 1e-05 | CDK4, CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to p16INK4A Defects | 2 | 1087.6× | 1e-05 | CDK4, CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 | 2 | 1087.6× | 1e-05 | CDK4, CDKN2A |
| Diseases of cellular response to stress | 2 | 1087.6× | 1e-05 | CDK4, CDKN2A |
| SUMOylation of transcription factors | 3 | 244.7× | 1e-05 | TP53, CDKN2A, MITF |
| Oncogene Induced Senescence | 3 | 143.9× | 1e-05 | TP53, CDK4, CDKN2A |
| MITF-M-regulated melanocyte development | 3 | 48.9× | 3e-04 | CDKN2A, MC1R, MITF |
| Developmental Biology | 5 | 10.3× | 4e-04 | AGAP2, CDK4, CDKN2A, MC1R, MITF |
| Stabilization of p53 | 2 | 217.5× | 4e-04 | TP53, CDKN2A |
| Oxidative Stress Induced Senescence | 3 | 38.8× | 5e-04 | TP53, CDK4, CDKN2A |
| Regulation of MITF-M-dependent genes involved in cell cycle and proliferation | 2 | 163.1× | 6e-04 | CDKN2A, MITF |
| G1 Phase | 2 | 112.5× | 0.001 | CDK4, CDKN2A |
| Regulation of TP53 Degradation | 2 | 83.7× | 0.002 | TP53, CDKN2A |
| Transcriptional Regulation by VENTX | 2 | 75.9× | 0.002 | TP53, CDKN2A |
| Cyclin D associated events in G1 | 2 | 66.6× | 0.003 | CDK4, CDKN2A |
| Evasion of Oncogene Induced Senescence Due to p14ARF Defects | 1 | 1631.4× | 0.004 | CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects | 1 | 1631.4× | 0.004 | CDKN2A |
| Loss of function of TP53 in cancer due to loss of tetramerization ability | 1 | 1631.4× | 0.004 | TP53 |
| Mitotic G1 phase and G1/S transition | 2 | 52.6× | 0.004 | CDK4, CDKN2A |
| SUMO E3 ligases SUMOylate target proteins | 2 | 51.0× | 0.004 | CDKN2A, MITF |
| Transcriptional and post-translational regulation of MITF-M expression and activity | 2 | 51.0× | 0.004 | MC1R, MITF |
| DNA Damage/Telomere Stress Induced Senescence | 2 | 46.6× | 0.004 | TP53, POT1 |
| SUMOylation | 2 | 46.6× | 0.004 | CDKN2A, MITF |
| Cellular Senescence | 2 | 39.3× | 0.006 | CDK4, CDKN2A |
| Regulation of TP53 Expression | 1 | 815.7× | 0.006 | TP53 |
| Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function | 1 | 815.7× | 0.006 | CDKN2A |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 9 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| rRNA transcription | 2 | 220.3× | 0.004 | TP53, CDKN2A |
| replicative senescence | 2 | 220.3× | 0.004 | TP53, CDKN2A |
| negative regulation of telomere maintenance via telomerase | 2 | 162.8× | 0.005 | TP53, POT1 |
| regulation of cell cycle | 3 | 24.9× | 0.010 | TP53, CDK4, CDKN2A |
| negative regulation of helicase activity | 1 | 1872.4× | 0.011 | TP53 |
| positive regulation of DNA strand elongation | 1 | 1872.4× | 0.011 | POT1 |
| cellular response to actinomycin D | 1 | 1872.4× | 0.011 | TP53 |
| regulation of intrinsic apoptotic signaling pathway by p53 class mediator | 1 | 1872.4× | 0.011 | TP53 |
| negative regulation of G1 to G0 transition | 1 | 1872.4× | 0.011 | TP53 |
| positive regulation of telomeric D-loop disassembly | 1 | 1872.4× | 0.011 | POT1 |
| cellular senescence | 2 | 65.7× | 0.011 | TP53, CDKN2A |
| nuclear body organization | 1 | 936.2× | 0.012 | CDKN2A |
| positive regulation of mitochondrial membrane permeability | 1 | 936.2× | 0.012 | TP53 |
| oligodendrocyte apoptotic process | 1 | 936.2× | 0.012 | TP53 |
| melanocyte apoptotic process | 1 | 936.2× | 0.012 | MITF |
| negative regulation of glucose catabolic process to lactate via pyruvate | 1 | 936.2× | 0.012 | TP53 |
| negative regulation of pentose-phosphate shunt | 1 | 936.2× | 0.012 | TP53 |
| regulation of RNA biosynthetic process | 1 | 936.2× | 0.012 | MITF |
| Ras protein signal transduction | 2 | 45.7× | 0.012 | TP53, CDKN2A |
| obsolete homolactic fermentation | 1 | 624.1× | 0.013 | TP53 |
| apoptotic process involved in mammary gland involution | 1 | 624.1× | 0.013 | CDKN2A |
| regulation of transcription initiation by RNA polymerase II | 1 | 624.1× | 0.013 | CDK4 |
| signal transduction by p53 class mediator | 1 | 624.1× | 0.013 | TP53 |
| negative regulation of miRNA processing | 1 | 624.1× | 0.013 | TP53 |
| intrinsic apoptotic signaling pathway in response to hypoxia | 1 | 624.1× | 0.013 | TP53 |
| positive regulation of macrophage apoptotic process | 1 | 624.1× | 0.013 | CDKN2A |
| regulation of fibroblast apoptotic process | 1 | 624.1× | 0.013 | TP53 |
| negative regulation of cell growth | 2 | 32.0× | 0.013 | TP53, CDKN2A |
| T cell proliferation involved in immune response | 1 | 468.1× | 0.013 | TP53 |
| telomere assembly | 1 | 468.1× | 0.013 | POT1 |
Therapeutics
Drug target analysis
Approved (phase 4): 4 · Phase ≥3: 4 · Phased (≥1): 4 · Undrugged: 7
Druggability breadth: 6 of 11 evidence-associated genes (55%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|---|
| TP53 | NITROFURANTOIN |
| CDK4 | PALBOCICLIB |
| MC1R | BREMELANOTIDE |
| MITF | PERHEXILINE MALEATE |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| TP53 | 196 | 4 |
| CDK4 | 56 | 4 |
| MC1R | 6 | 4 |
| MITF | 3 | 4 |
| TSPAN31 | 0 | 0 |
| AGAP2 | 0 | 0 |
| POT1 | 0 | 0 |
| CDKN2A | 0 | 0 |
| DNAH1 | 0 | 0 |
| CDKN2B-AS1 | 0 | 0 |
Drugs targeting cohort genes (top 30)
| Molecule | Max phase | Targets in cohort |
|---|---|---|
| NITROFURANTOIN | 4 | TP53 |
| DIOSMIN | 4 | TP53 |
| VERTEPORFIN | 4 | TP53 |
| CANDESARTAN CILEXETIL | 4 | TP53 |
| DIENESTROL | 4 | TP53 |
| CLOTRIMAZOLE | 4 | TP53 |
| COLCHICINE | 4 | TP53 |
| NABUMETONE | 4 | TP53 |
| SALMETEROL XINAFOATE | 4 | TP53 |
| AMIODARONE HYDROCHLORIDE | 4 | TP53 |
| FURAZOLIDONE | 4 | TP53 |
| AMOXAPINE | 4 | TP53 |
| RALOXIFENE HYDROCHLORIDE | 4 | TP53 |
| NICARDIPINE HYDROCHLORIDE | 4 | TP53 |
| SULCONAZOLE NITRATE | 4 | TP53 |
| PYRITHIONE ZINC | 4 | TP53 |
| LACTIC ACID | 4 | TP53 |
| OXYMETHOLONE | 4 | TP53 |
| CHLOROXINE | 4 | TP53 |
| PROPIOLACTONE | 4 | TP53 |
| CLOMIPRAMINE HYDROCHLORIDE | 4 | TP53 |
| PHENYL AMINOSALICYLATE | 4 | TP53 |
| THIORIDAZINE HYDROCHLORIDE | 4 | TP53 |
| AMITRIPTYLINE HYDROCHLORIDE | 4 | TP53 |
| ETHOPROPAZINE HYDROCHLORIDE | 4 | TP53 |
| MECHLORETHAMINE HYDROCHLORIDE | 4 | TP53 |
| ECONAZOLE NITRATE | 4 | TP53 |
| TRIFLUPROMAZINE HYDROCHLORIDE | 4 | TP53 |
| PROCHLORPERAZINE EDISYLATE | 4 | TP53 |
| DEQUALINIUM CHLORIDE | 4 | TP53 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 1.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| CDK4 | 1,142 | Binding:1086, Functional:53, ADMET:2, Toxicity:1 |
| TP53 | 869 | Binding:775, ADMET:83, Functional:10, Toxicity:1 |
| MC1R | 319 | Functional:164, Binding:155 |
| MITF | 10 | Functional:10 |
| CDKN2A | 2 | Binding:2 |
| POT1 | 1 | Binding:1 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|---|---|
| CDK4 | 2.7.11.22 | cyclin-dependent kinase |
Cohort genes with high screening signal
≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.
| Symbol | ChEMBL assays |
|---|---|
| TP53 | 869 |
| CDK4 | 1,142 |
| MC1R | 319 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 10; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Drug repurposing candidates
30 approved/phased drugs hit cohort targets but don’t yet appear in disease-level clinical trials. Target-inhibition rationale is strongest for cancer driver genes; a bioactivity hit is a screening signal, not a treatment claim.
| Compound | Max phase | Cohort target (bioactivity) |
|---|---|---|
| NITROFURANTOIN | 4 | TP53 |
| DIOSMIN | 4 | TP53 |
| VERTEPORFIN | 4 | TP53 |
| CANDESARTAN CILEXETIL | 4 | TP53 |
| DIENESTROL | 4 | TP53 |
| CLOTRIMAZOLE | 4 | TP53 |
| COLCHICINE | 4 | TP53 |
| NABUMETONE | 4 | TP53 |
| SALMETEROL XINAFOATE | 4 | TP53 |
| AMIODARONE HYDROCHLORIDE | 4 | TP53 |
| FURAZOLIDONE | 4 | TP53 |
| AMOXAPINE | 4 | TP53 |
| RALOXIFENE HYDROCHLORIDE | 4 | TP53 |
| NICARDIPINE HYDROCHLORIDE | 4 | TP53 |
| SULCONAZOLE NITRATE | 4 | TP53 |
| PYRITHIONE ZINC | 4 | TP53 |
| LACTIC ACID | 4 | TP53 |
| OXYMETHOLONE | 4 | TP53 |
| CHLOROXINE | 4 | TP53 |
| PROPIOLACTONE | 4 | TP53 |
| CLOMIPRAMINE HYDROCHLORIDE | 4 | TP53 |
| PHENYL AMINOSALICYLATE | 4 | TP53 |
| THIORIDAZINE HYDROCHLORIDE | 4 | TP53 |
| AMITRIPTYLINE HYDROCHLORIDE | 4 | TP53 |
| ETHOPROPAZINE HYDROCHLORIDE | 4 | TP53 |
| MECHLORETHAMINE HYDROCHLORIDE | 4 | TP53 |
| ECONAZOLE NITRATE | 4 | TP53 |
| TRIFLUPROMAZINE HYDROCHLORIDE | 4 | TP53 |
| PROCHLORPERAZINE EDISYLATE | 4 | TP53 |
| DEQUALINIUM CHLORIDE | 4 | TP53 |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 4 | TP53, CDK4, MC1R, MITF |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 0 | |
| D | Druggable family + AlphaFold only, no drug | 0 | |
| E | Difficult family or no structure, no drug | 7 | TSPAN31, AGAP2, POT1, CDKN2A, DNAH1, CDKN2B-AS1, MIR6759 |
Undrugged target profiles
7 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| CDKN2A | 2 | CDK4 |
| TSPAN31 | 0 | — |
| AGAP2 | 0 | — |
| POT1 | 1 | — |
| DNAH1 | 0 | — |
| CDKN2B-AS1 | 0 | — |
| MIR6759 | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 1.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| Not specified | 1 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT06767332 | Not specified | RECRUITING | EMDR for Fear of Cancer Recurrence in Patients with Familial Melanoma: a Waiting List Control Trial |