Gastric carcinoma
diseaseOn this page
Also known as Ca fundus - stomachcancer of fundus of stomachcancer of stomachcancer of the stomachcarcinoma of stomachcarcinoma of the stomachfundus of stomach cancergastric (stomach) cancergastric cancergastric cancer, NOSgastric fundus cancermalignant fundus of stomach neoplasmmalignant neoplasm of fundus of stomachmalignant tumor of fundus of stomachmalignant tumour of fundus of stomachstomach cancerstomach carcinoma
Summary
Gastric carcinoma (MONDO:0004950) is a cancer (an umbrella term covering 12 Mondo subtypes) with 36 cohort genes (138 GWAS associations across 28 studies; 18 CIViC-evidence somatic drivers) and 2,388 clinical trials. The dominant Reactome pathway is Developmental Lineage of Mammary Gland Luminal Epithelial Cells (4 cohort genes). Molecularly, ERBB2 Amplification confers sensitivity to Pembrolizumab + Trastuzumab + Chemotherapy in Stomach Cancer (CIViC Level A); 35 further subtype–drug associations are mapped below. Top therapeutic interventions include irinotecan, epirubicin, and ramucirumab.
At a glance
- Classification: Cancer
- Umbrella term: 12 Mondo subtypes
- Cohort genes: 36
- GWAS associations: 138
- Clinical trials: 2,388
- Precision-medicine evidence (CIViC): 36 subtype–drug associations
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | gastric carcinoma |
| Mondo ID | MONDO:0004950 |
| EFO | EFO:0000178 |
| DOID | DOID:10538, DOID:5517 |
| ICD-11 | 1503707183 |
| NCIT | C4911 |
| SNOMED CT | 187741001 |
| UMLS | C0699791 |
| MedGen | 147066 |
| GARD | 0027710 |
| Anatomy (UBERON) | UBERON:0000945 |
| Is cancer (heuristic) | yes |
Also known as: Ca fundus - stomach · cancer of fundus of stomach · cancer of stomach · cancer of the stomach · carcinoma of stomach · carcinoma of the stomach · fundus of stomach cancer · gastric (stomach) cancer · gastric cancer · gastric cancer, NOS · gastric carcinoma · gastric fundus cancer · malignant fundus of stomach neoplasm · malignant neoplasm of fundus of stomach · malignant tumor of fundus of stomach · malignant tumour of fundus of stomach · stomach cancer · stomach carcinoma
Data availability: 138 GWAS associations (28 studies) · 1 GenCC gene-disease record · 47 cell lines.
Disease family
An umbrella term covering 12 Mondo subtypes.
Classification path: disease › human disease › disease by body system or component › digestive system disorder › digestive system cancer › gastric cancer › gastric carcinoma
Related subtypes (8): malignant gastric granular cell tumor, gastric lymphoma, pylorus cancer, cardia cancer, malignant gastric germ cell tumor, gastric leiomyosarcoma, gastric liposarcoma, diffuse gastric cancer
Subtypes (12): gastric cardia carcinoma, gastric fundus carcinoma, gastric pylorus carcinoma, gastric body carcinoma, stomach carcinoma in situ, gastric adenocarcinoma, gastric small cell neuroendocrine carcinoma, gastric squamous cell carcinoma, Epstein-Barr virus-associated gastric carcinoma, hereditary gastric cancer, carcinoma of stomach, salivary gland type, undifferentiated carcinoma of stomach
Genetics & variants
GWAS landscape
138 GWAS associations across 28 studies. Top hits map to 23 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|---|---|---|---|
| rs2920280 | 4e-49 | JRK, PSCA | C | 0.23 |
| chr8:143779622 | 4e-46 | ? | 0.24 | |
| rs372173246 | 8e-46 | JRK, PSCA | C | 0.24 |
| rs2294008 | 1e-44 | JRK, PSCA | T | 1.31 |
| rs2978977 | 3e-43 | PSCA, JRK | A | 1.29 |
| rs760077 | 2e-40 | THBS3, MTX1 | T | 0.33 |
| chr1:155184975 | 1e-39 | ? | 0.32 | |
| rs7366775 | 1e-34 | THBS3-AS1, THBS3 | A | 1.41 |
| rs1057941 | 2e-33 | GBA1LP, GBA1LP | A | 1.33 |
| rs2920293 | 3e-32 | PSCA - LY6K | G | 1.39 |
| rs10074991 | 3e-30 | PRKAA1 | A | 0.78 |
| chr5:40726138 | 3e-29 | ? | 0.18 | |
| rs13361707 | 8e-29 | PRKAA1 | ? | 1.41 |
| rs57067284 | 3e-26 | TTC33 | TGAACAGAC | 0.18 |
| rs59585832 | 1e-25 | TTC33 | T | 0.18 |
| rs10509670 | 2e-22 | PLCE1 | A | 0.78 |
| rs3805495 | 9e-20 | TTC33 | T | 0.85 |
| rs80142782 | 2e-19 | ASH1L | T | 1.61 |
| rs4072037 | 6e-17 | MUC1 | T | 1.35 |
| rs2285947 | 1e-16 | DNAH11 | A | 1.17 |
| rs72706172 | 1e-15 | GON4L | A | 1.29 |
| rs138554234 | 4e-15 | LMNA | A | 0.64 |
| rs1205527 | 9e-14 | RNU6-309P - GAPDHP77 | C | 0.09 |
| rs2976394 | 2e-13 | PSCA | C | 0.7 |
| rs2585177 | 2e-13 | PSCA - LY6K | A | 0.8 |
| rs7849280 | 3e-13 | ABO | G | 1.15 |
| rs67579710 | 6e-13 | THBS3-AS1, THBS3 | G | 1.21 |
| rs2494938 | 1e-12 | LRFN2 | A | 1.15 |
| chr8:143703571 | 1e-12 | ? | 0.14 | |
| chr1:156045662 | 2e-12 | ? | 0.16 |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|---|---|---|---|---|
| GCST90432138 | Jiang Y | 2023 | 116,382 | 213,325 | A cross-disorder study to identify causal relationships, shared genetic variants, and genes across 21 digestive disorders. |
| GCST012016 | Jin G | 2020 | 10,254 | 10,914 | Genetic risk, incident gastric cancer, and healthy lifestyle: a meta-analysis of genome-wide association studies and prospective cohort study. |
| GCST90018629 | Sakaue S | 2021 | 7,921 | 159,201 | A cross-population atlas of genetic associations for 220 human phenotypes. |
| GCST90013700 | Ishigaki K | 2020 | 6,563 | 195,745 | Large-scale genome-wide association study in a Japanese population identifies novel susceptibility loci across different diseases. |
| GCST006707 | Tanikawa C | 2018 | 6,171 | 27,178 | A GWAS identifies gastric cancer susceptibility loci at 12q24.11-12 and 20q11.21. |
| GCST90296724 | Hess T | 2023 | 5,815 | 10,999 | Dissecting the genetic heterogeneity of gastric cancer. |
| GCST90013739 | Ishigaki K | 2020 | 4,885 | 97,655 | Large-scale genome-wide association study in a Japanese population identifies novel susceptibility loci across different diseases. |
| GCST008646 | Yan C | 2019 | 3,771 | 5,426 | Meta-analysis of genome-wide association studies and functional assays decipher susceptibility genes for gastric cancer in Chinese populations. |
| GCST90296726 | Hess T | 2023 | 3,183 | 10,999 | Dissecting the genetic heterogeneity of gastric cancer. |
| GCST002992 | Helgason H | 2015 | 2,500 | 205,652 | Loss-of-function variants in ATM confer risk of gastric cancer. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|---|
| Tier 1: coding | 2 |
| Tier 2: splice/UTR | 3 |
| Tier 3: regulatory | 1 |
| Tier 4: intronic/intergenic | 44 |
MAF distribution
| Bucket | Variants |
|---|---|
| common (>=0.05) | 40 |
| low_freq (0.01-0.05) | 0 |
| rare (<0.01) | 0 |
| unknown | 10 |
Functional consequences
| Consequence | Count |
|---|---|
| intron_variant | 23 |
| unknown | 10 |
| intergenic_variant | 9 |
| missense_variant | 2 |
| 3_prime_UTR_variant | 2 |
| 5_prime_UTR_variant | 1 |
| regulatory_region_variant | 1 |
| non_coding_transcript_exon_variant | 1 |
| synonymous_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|---|---|---|---|---|---|---|---|
| rs2920280 | 8 | 142679726 | G>A,C,T | 0.05 | intergenic_variant | JRK, PSCA | 4e-49 | Tier 4: intronic/intergenic |
| chr8:143779622 | 4e-46 | Tier 4: intronic/intergenic | ||||||
| rs372173246 | 8 | 142678701 | CACCACCACCCAGCCACTGGCAGCAGAGCTTGGGCCTGCTCTAGAGGGTCCTAGCCACTGCT>C | 0.473 | intergenic_variant | JRK, PSCA | 8e-46 | Tier 4: intronic/intergenic |
| rs2294008 | 8 | 142680513 | C>T | 0.05 | 5_prime_UTR_variant | JRK, PSCA | 1e-44 | Tier 2: splice/UTR |
| rs2978977 | 8 | 142674302 | C>A,G,T | 0.491 | regulatory_region_variant | PSCA, JRK | 3e-43 | Tier 3: regulatory |
| rs760077 | 1 | 155208991 | T>A,C,G | 0.15 | missense_variant | THBS3, MTX1 | 2e-40 | Tier 1: coding |
| chr1:155184975 | 1e-39 | Tier 4: intronic/intergenic | ||||||
| rs7366775 | 1 | 155199139 | G>A,C | 0.2 | intron_variant | THBS3-AS1, THBS3 | 1e-34 | Tier 4: intronic/intergenic |
| rs1057941 | 1 | 155216951 | G>A,C,T | 0.05 | non_coding_transcript_exon_variant | GBA1LP, GBA1LP | 2e-33 | Tier 4: intronic/intergenic |
| rs2920293 | 8 | 142683996 | C>A,G,T | 0.05 | intergenic_variant | PSCA - LY6K | 3e-32 | Tier 4: intronic/intergenic |
| rs10074991 | 5 | 40790449 | G>A | 0.49 | intron_variant | PRKAA1 | 3e-30 | Tier 4: intronic/intergenic |
| chr5:40726138 | 3e-29 | Tier 4: intronic/intergenic | ||||||
| rs13361707 | 5 | 40791782 | C>T | 0.05 | intron_variant | PRKAA1 | 8e-29 | Tier 4: intronic/intergenic |
| rs57067284 | 5 | 40734315 | T>TGAACAGAC,TGAACAGACGGAACAGAC,TGAACAGACTAACAGAC,TGAACAGACTG,TGAACAGACTGAACAGAC,TGAGCAGAC | 0.05 | intron_variant | TTC33 | 3e-26 | Tier 4: intronic/intergenic |
| rs59585832 | 5 | 40743936 | C>T | 0.413 | intron_variant | TTC33 | 1e-25 | Tier 4: intronic/intergenic |
| rs10509670 | 10 | 94308190 | A>G | 0.21 | intron_variant | PLCE1 | 2e-22 | Tier 4: intronic/intergenic |
| rs3805495 | 5 | 40755466 | C>T | 0.42 | intron_variant | TTC33 | 9e-20 | Tier 4: intronic/intergenic |
| rs80142782 | 1 | 155515236 | T>C | 0.07 | intron_variant | ASH1L | 2e-19 | Tier 4: intronic/intergenic |
| rs4072037 | 1 | 155192276 | C>A,G,T | 0.16 | synonymous_variant | MUC1 | 6e-17 | Tier 4: intronic/intergenic |
| rs2285947 | 7 | 21544470 | G>A | 0.27 | intron_variant | DNAH11 | 1e-16 | Tier 4: intronic/intergenic |
| rs72706172 | 1 | 155827701 | A>C,G | 0.18 | intron_variant | GON4L | 1e-15 | Tier 4: intronic/intergenic |
| rs138554234 | 1 | 156119243 | G>A,C,T | 0.05 | intron_variant | LMNA | 4e-15 | Tier 4: intronic/intergenic |
| rs1205527 | X | 109299580 | G>A,C | 0.05 | intergenic_variant | RNU6-309P - GAPDHP77 | 9e-14 | Tier 4: intronic/intergenic |
| rs2976394 | 8 | 142682204 | C>A,T | 0.48 | 3_prime_UTR_variant | PSCA | 2e-13 | Tier 2: splice/UTR |
| rs2585177 | 8 | 142695299 | A>C,T | 0.16 | intergenic_variant | PSCA - LY6K | 2e-13 | Tier 4: intronic/intergenic |
| rs7849280 | 9 | 133251249 | A>G | 0.05 | 3_prime_UTR_variant | ABO | 3e-13 | Tier 2: splice/UTR |
| rs67579710 | 1 | 155203736 | G>A | 0.05 | intron_variant | THBS3-AS1, THBS3 | 6e-13 | Tier 4: intronic/intergenic |
| rs2494938 | 6 | 40568389 | G>A | 0.23 | intron_variant | LRFN2 | 1e-12 | Tier 4: intronic/intergenic |
| chr8:143703571 | 1e-12 | Tier 4: intronic/intergenic | ||||||
| chr1:156045662 | 2e-12 | Tier 4: intronic/intergenic |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 14 · Orphanet: 95 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 1
Dual-evidence genes (GWAS + Mendelian — highest-confidence targets)
| Gene | HGNC | Evidence routes |
|---|---|---|
| ATM | ATM | GWAS, GenCC, Orphanet |
Somatic driver evidence (intOGen + CIViC, cohort fanout)
| Gene | intOGen role | Cancer types | CIViC |
|---|---|---|---|
| ATM | LoF | BLCA,BRCA,CCRCC,CHOL,CLLSLL,COAD,COADREAD,ESCA,HCC,LUAD,LUSC,MEL,NSCLC,PAAD,PANCREAS,PANET,PCM,PLMESO,PRAD,PROSTATE,STAD,UCEC,UTUC,WDTC | CIViC #69 |
| ARID1A | LoF | BL,BLCA,BRCA,CCRCC,CESC,CHOL,CLLSLL,COAD,COADREAD,DLBCLNOS,EGC,ESCA,ESCC,GBC,GBM,HCC,LGGNOS,LUAD,LUNG,LUSC,MBL,MLYM,MT,NHL,NSCLC,OS,OVT,PAAD,PANCREAS,PAST,PRAD,RCC,SCLC,SKIN,STAD,UCEC,UCS,UTUC | CIViC #6559 |
| TP53 | LoF | ACC,ALL,AML,ANGS,ANSC,BCC,BL,BLADDER,BLCA,BRCA,CCRCC,CEAD,CESC,CHOL,CHRCC,CLLSLL,COAD,COADREAD,CSCC,DLBCLNOS,EGC,ES,ESCA,ESCC,GB,GBC,GBM,GIST,HCC,HGGNOS,HNSC,LGGNOS,LIPO,LMS,LNM,LUAD,LUSC,MBL,MEL,MLYM,MT,NBL,NETNOS,NHL,NPC,NSCLC,OS,OVT,PAAD,PANCREAS,PAST,PCM,PLMESO,PRAD,PRCC,PROSTATE,RCC,READ,SACA,SARCNOS,SCLC,SIC,SKCM,SKIN,SOFT_TISSUE,STAD,STOMACH,THYM,UCEC,UCS,UTUC,VULVA,WDTC,WT | CIViC #45 |
| CCND2 | LoF | AML,CLLSLL | CIViC #9 |
| CCNE1 | CIViC #11 | ||
| CD44 | CIViC #855 | ||
| CDH1 | LoF | BLCA,BRCA,CSCC,DLBCLNOS,ESCA,STAD | CIViC #888 |
| CD274 | LoF | DLBCLNOS | CIViC #11335 |
| SLTM | Act | CCRCC,LGGNOS,LUAD,NSCLC,OS,PRCC,RCC | CIViC #52 |
| BCOR | LoF | ACC,AML,CHOL,CLLSLL,COADREAD,GBM,LGGNOS,LUAD,MBL,PAAD,PAST,PGNG,PLMESO,SIC,STAD,THYM,UCEC,UCS | CIViC #12555 |
| ERBB2 | Act | BLCA,BRCA,CESC,CHOL,COADREAD,EGC,ESCA,ESCC,LMS,LUAD,NSCLC,OVT,PRCC,READ,STAD,UCEC | CIViC #20 |
| FGFR2 | Act | BRCA,CHOL,LUSC,SACA,UCEC | CIViC #22 |
| RHOA | Act | BL,BLCA,DLBCLNOS,HNSC,MLYM,NHL,PLMESO,PRAD,SKCM,STAD | CIViC #399 |
| MLH1 | CIViC #3532 | ||
| MTHFR | CIViC #3672 | ||
| PIK3CA | Act | ACYC,ANGS,ANSC,BCC,BLADDER,BLCA,BRCA,CCRCC,CEAD,CESC,CHOL,COAD,COADREAD,EPM,ESCA,ESCC,GB,GBM,HCC,HGGNOS,HNSC,LGGNOS,LIPO,LMS,LUAD,LUSC,MBL,MGCT,NPC,NSCLC,OVT,PAAD,PAST,PLMESO,PRAD,PRCC,PROSTATE,RCC,SACA,SKCM,SOFT_TISSUE,STAD,UCEC,UCS,UTUC,VULVA,WDTC | CIViC #37 |
| PTEN | LoF | ANGS,BLCA,BRCA,CCRCC,CEAD,CESC,CHOL,CHRCC,COADREAD,CSCC,ESCA,GB,GBM,HCC,HGGNOS,HNSC,LGGNOS,LIPO,LUAD,LUSC,MBL,MEL,MT,NSCLC,OVT,PANET,PAST,PRAD,PRCC,PROSTATE,RCC,SCLC,SKCM,SOFT_TISSUE,STAD,UCEC,UCS,WDTC | CIViC #41 |
| ZBTB20 | LoF | LGGNOS |
GenCC gene–disease validity (cohort genes)
the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.
| Gene | Classification | Inheritance | Disease | Records |
|---|---|---|---|---|
| ATM | Limited | Autosomal dominant | gastric carcinoma | 14 |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| ATM | Orphanet:100 | Ataxia-telangiectasia |
| ATM | Orphanet:1331 | Familial prostate cancer |
| ATM | Orphanet:145 | Hereditary breast and/or ovarian cancer syndrome |
| ATM | Orphanet:227535 | Hereditary breast cancer |
| ATM | Orphanet:370109 | Ataxia-telangiectasia variant |
| ATM | Orphanet:440437 | Familial colorectal cancer Type X |
| ATM | Orphanet:52416 | Mantle cell lymphoma |
| ATM | Orphanet:67038 | B-cell chronic lymphocytic leukemia |
| ARID1A | Orphanet:1465 | Coffin-Siris syndrome |
| TP53 | Orphanet:1333 | Familial pancreatic carcinoma |
| TP53 | Orphanet:145 | Hereditary breast and/or ovarian cancer syndrome |
| TP53 | Orphanet:1501 | Adrenocortical carcinoma |
| TP53 | Orphanet:210159 | Adult hepatocellular carcinoma |
| TP53 | Orphanet:251576 | Gliosarcoma |
| TP53 | Orphanet:251579 | Giant cell glioblastoma |
| TP53 | Orphanet:251899 | Choroid plexus carcinoma |
| TP53 | Orphanet:2807 | Papilloma of choroid plexus |
| TP53 | Orphanet:293199 | Pleomorphic rhabdomyosarcoma |
| TP53 | Orphanet:3318 | Essential thrombocythemia |
| TP53 | Orphanet:524 | Li-Fraumeni syndrome |
| TP53 | Orphanet:52688 | Myelodysplastic syndrome |
| TP53 | Orphanet:585909 | B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2) |
| TP53 | Orphanet:667662 | Breast implant-associated anaplastic large cell lymphoma |
| TP53 | Orphanet:668 | Osteosarcoma |
| TP53 | Orphanet:67038 | B-cell chronic lymphocytic leukemia |
| TP53 | Orphanet:70573 | Small cell lung cancer |
| TP53 | Orphanet:96253 | Cushing disease |
| TP53 | Orphanet:99756 | Alveolar rhabdomyosarcoma |
| TP53 | Orphanet:99757 | Embryonal rhabdomyosarcoma |
| CCND2 | Orphanet:83473 | Megalencephaly-polymicrogyria-postaxial polydactyly-hydrocephalus syndrome |
| CDH1 | Orphanet:1331 | Familial prostate cancer |
| CDH1 | Orphanet:199306 | Cleft lip/palate |
| CDH1 | Orphanet:1997 | Blepharo-cheilo-odontic syndrome |
| CDH1 | Orphanet:227535 | Hereditary breast cancer |
| CDH1 | Orphanet:26106 | Hereditary diffuse gastric cancer |
| BCOR | Orphanet:2712 | Oculofaciocardiodental syndrome |
| BCOR | Orphanet:457246 | Clear cell sarcoma of kidney |
| BCOR | Orphanet:520 | Acute promyelocytic leukemia |
| BCOR | Orphanet:568 | Microphthalmia, Lenz type |
| ERBB2 | Orphanet:213726 | Serous carcinoma of the corpus uteri |
| ERBB2 | Orphanet:2800 | Extramammary Paget disease |
| ERBB2 | Orphanet:388 | Hirschsprung disease |
| ERBB2 | Orphanet:99976 | Adenocarcinoma of the oesophagus and oesophagogastric junction |
| FGFR2 | Orphanet:1540 | Jackson-Weiss syndrome |
| FGFR2 | Orphanet:1555 | Cutis gyrata-acanthosis nigricans-craniosynostosis syndrome |
| FGFR2 | Orphanet:168624 | Familial scaphocephaly syndrome, McGillivray type |
| FGFR2 | Orphanet:207 | Crouzon syndrome |
| FGFR2 | Orphanet:2363 | Lacrimoauriculodentodigital syndrome |
| FGFR2 | Orphanet:313855 | FGFR2-related bent bone dysplasia |
| FGFR2 | Orphanet:596008 | Antley-Bixler syndrome without genital anomaly or disorder of steroidogenesis |
Cohort genes → proteins
36 cohort genes, 36 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| gwas_only | 19 |
| civic_only | 16 |
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| ATM | HGNC:795 | ENSG00000149311 | Q13315 | Serine-protein kinase ATM | gwas,gencc,civic_evidence |
| ARID1A | HGNC:11110 | ENSG00000117713 | O14497 | AT-rich interactive domain-containing protein 1A | civic_evidence |
| TP53 | HGNC:11998 | ENSG00000141510 | P04637 | Cellular tumor antigen p53 | civic_evidence |
| CCND2 | HGNC:1583 | ENSG00000118971 | P30279 | G1/S-specific cyclin-D2 | civic_evidence |
| CCNE1 | HGNC:1589 | ENSG00000105173 | P24864 | G1/S-specific cyclin-E1 | civic_evidence |
| CD44 | HGNC:1681 | ENSG00000026508 | P16070 | CD44 antigen | civic_evidence |
| CDH1 | HGNC:1748 | ENSG00000039068 | P12830 | Cadherin-1 | civic_evidence |
| CD274 | HGNC:17635 | ENSG00000120217 | Q9NZQ7 | Programmed cell death 1 ligand 1 | civic_evidence |
| SLTM | HGNC:20709 | ENSG00000137776 | Q9NWH9 | SAFB-like transcription modulator | civic_evidence |
| BCOR | HGNC:20893 | ENSG00000183337 | Q6W2J9 | BCL-6 corepressor | civic_evidence |
| ERBB2 | HGNC:3430 | ENSG00000141736 | P04626 | Receptor tyrosine-protein kinase erbB-2 | civic_evidence |
| FGFR2 | HGNC:3689 | ENSG00000066468 | P21802 | Fibroblast growth factor receptor 2 | civic_evidence |
| RHOA | HGNC:667 | ENSG00000067560 | P61586 | Transforming protein RhoA | civic_evidence |
| MLH1 | HGNC:7127 | ENSG00000076242 | P40692 | DNA mismatch repair protein Mlh1 | civic_evidence |
| MTHFR | HGNC:7436 | ENSG00000177000 | P42898 | Methylenetetrahydrofolate reductase (NADPH) | civic_evidence |
| PIK3CA | HGNC:8975 | ENSG00000121879 | P42336 | Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform | civic_evidence |
| PTEN | HGNC:9588 | ENSG00000171862 | P60484 | Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN | civic_evidence |
| SP4 | HGNC:11209 | ENSG00000105866 | Q02446 | Transcription factor Sp4 | gwas |
| ZBTB20 | HGNC:13503 | ENSG00000181722 | Q9HC78 | Zinc finger and BTB domain-containing protein 20 | gwas |
| PLCE1 | HGNC:17175 | ENSG00000138193 | Q9P212 | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase epsilon-1 | gwas |
| ASH1L | HGNC:19088 | ENSG00000116539 | Q9NR48 | Histone-lysine N-methyltransferase ASH1L | gwas |
| HCN3 | HGNC:19183 | ENSG00000143630 | Q9P1Z3 | Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 | gwas |
| UNC5CL | HGNC:21203 | ENSG00000124602 | Q8IV45 | UNC5C-like protein | gwas |
| LRFN2 | HGNC:21226 | ENSG00000156564 | Q9ULH4 | Leucine-rich repeat and fibronectin type-III domain-containing protein 2 | gwas |
| TSPO2 | HGNC:21256 | ENSG00000112212 | Q5TGU0 | Translocator protein 2 | gwas |
| NOC3L | HGNC:24034 | ENSG00000173145 | Q8WTT2 | Nucleolar complex protein 3 homolog | gwas |
| NSUN3 | HGNC:26208 | ENSG00000178694 | Q9H649 | tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial | gwas |
| ANKRD50 | HGNC:29223 | ENSG00000151458 | Q9ULJ7 | Ankyrin repeat domain-containing protein 50 | gwas |
| DNAH11 | HGNC:2942 | ENSG00000105877 | Q96DT5 | Dynein axonemal heavy chain 11 | gwas |
| TTC33 | HGNC:29959 | ENSG00000113638 | Q6PID6 | Tetratricopeptide repeat protein 33 | gwas |
| MTX1 | HGNC:7504 | ENSG00000173171 | Q13505 | Metaxin-1 | gwas |
| MUC1 | HGNC:7508 | ENSG00000185499 | P15941 | Mucin-1 | gwas |
| OPCML | HGNC:8143 | ENSG00000183715 | Q14982 | Opioid-binding protein/cell adhesion molecule | gwas |
| PRKAA1 | HGNC:9376 | ENSG00000132356 | Q13131 | 5’-AMP-activated protein kinase catalytic subunit alpha-1 | gwas |
| PSCA | HGNC:9500 | ENSG00000167653 | O43653 | Prostate stem cell antigen | gwas |
| PTGER4 | HGNC:9596 | ENSG00000171522 | P35408 | Prostaglandin E2 receptor EP4 subtype | gwas |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| ATM | Serine-protein kinase ATM | Serine/threonine protein kinase which activates checkpoint signaling upon double strand breaks (DSBs), apoptosis and genotoxic stresses such as ionizing ultraviolet A light (UVA), thereby acting as a DNA damage sensor. |
| ARID1A | AT-rich interactive domain-containing protein 1A | Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). |
| TP53 | Cellular tumor antigen p53 | Multifunctional transcription factor that induces cell cycle arrest, DNA repair or apoptosis upon binding to its target DNA sequence. |
| CCND2 | G1/S-specific cyclin-D2 | Regulatory component of the cyclin D2-CDK4 (DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family including RB1 and regulates the cell-cycle during G(1)/S transition. |
| CCNE1 | G1/S-specific cyclin-E1 | Essential for the control of the cell cycle at the G1/S (start) transition. |
| CD44 | CD44 antigen | Cell-surface receptor that plays a role in cell-cell interactions, cell adhesion and migration, helping them to sense and respond to changes in the tissue microenvironment. |
| CDH1 | Cadherin-1 | Cadherins are calcium-dependent cell adhesion proteins. |
| CD274 | Programmed cell death 1 ligand 1 | Plays a critical role in induction and maintenance of immune tolerance to self. |
| SLTM | SAFB-like transcription modulator | When overexpressed, acts as a general inhibitor of transcription that eventually leads to apoptosis. |
| BCOR | BCL-6 corepressor | Transcriptional corepressor. |
| ERBB2 | Receptor tyrosine-protein kinase erbB-2 | Protein tyrosine kinase that is part of several cell surface receptor complexes, but that apparently needs a coreceptor for ligand binding. |
| FGFR2 | Fibroblast growth factor receptor 2 | Tyrosine-protein kinase that acts as a cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic de… |
| RHOA | Transforming protein RhoA | Small GTPase which cycles between an active GTP-bound and an inactive GDP-bound state. |
| MLH1 | DNA mismatch repair protein Mlh1 | Heterodimerizes with PMS2 to form MutL alpha, a component of the post-replicative DNA mismatch repair system (MMR). |
| MTHFR | Methylenetetrahydrofolate reductase (NADPH) | Catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a cosubstrate for homocysteine remethylation to methionine. |
| PIK3CA | Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform | Phosphoinositide-3-kinase (PI3K) phosphorylates phosphatidylinositol (PI) and its phosphorylated derivatives at position 3 of the inositol ring to produce 3-phosphoinositides. |
| PTEN | Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN | Dual-specificity protein phosphatase, dephosphorylating tyrosine-, serine- and threonine-phosphorylated proteins. |
| SP4 | Transcription factor Sp4 | Binds to GT and GC boxes promoters elements. |
| ZBTB20 | Zinc finger and BTB domain-containing protein 20 | May be a transcription factor that may be involved in hematopoiesis, oncogenesis, and immune responses. |
| PLCE1 | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase epsilon-1 | The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes. |
| ASH1L | Histone-lysine N-methyltransferase ASH1L | Histone methyltransferase specifically trimethylating ‘Lys-36’ of histone H3 forming H3K36me3. |
| HCN3 | Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 | Hyperpolarization-activated ion channel that are permeable to sodium and potassium ions, with an about 3:1 preference for potassium ions. |
| UNC5CL | UNC5C-like protein | Inhibits NF-kappa-B-dependent transcription by impairing NF-kappa-B binding to its targets. |
| LRFN2 | Leucine-rich repeat and fibronectin type-III domain-containing protein 2 | Promotes neurite outgrowth in hippocampal neurons. |
| TSPO2 | Translocator protein 2 | Cholesterol-binding protein involved in the redistribution of cholesterol from lipid droplets to the endoplasmic reticulum. |
| NOC3L | Nucleolar complex protein 3 homolog | May be required for adipogenesis. |
| NSUN3 | tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrial | Mitochondrial tRNA methyltransferase that mediates methylation of cytosine to 5-methylcytosine (m5C) at position 34 of mt-tRNA(Met). mt-tRNA(Met) methylation at cytosine(34) takes place at the wobble position of the anticodon and initiates… |
| ANKRD50 | Ankyrin repeat domain-containing protein 50 | Involved in the endosome-to-plasma membrane trafficking and recycling of SNX27-retromer-dependent cargo proteins, such as GLUT1. |
| DNAH11 | Dynein axonemal heavy chain 11 | Force generating protein required for cilia beating in respiratory epithelia. |
| MTX1 | Metaxin-1 | Involved in transport of proteins into the mitochondrion. |
| MUC1 | Mucin-1 | The alpha subunit has cell adhesive properties. |
| OPCML | Opioid-binding protein/cell adhesion molecule | Binds opioids in the presence of acidic lipids; probably involved in cell contact. |
| PRKAA1 | 5’-AMP-activated protein kinase catalytic subunit alpha-1 | Catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism. |
| PSCA | Prostate stem cell antigen | May be involved in the regulation of cell proliferation. |
| PTGER4 | Prostaglandin E2 receptor EP4 subtype | Receptor for prostaglandin E2 (PGE2). |
Protein-family classification
Druggable: 15 · Difficult: 6 · Unknown: 15 · Druggable fraction: 0.42
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Kinase | 5 | 3.9× | 0.081 |
| Antibody/Immunoglobulin | 3 | 2.4× | 0.561 |
| Ion channel | 1 | 3.1× | 0.636 |
| Phosphatase | 1 | 2.3× | 0.636 |
| Enzyme (other) | 4 | 1.3× | 0.636 |
| Scaffold/PPI | 2 | 1.0× | 0.835 |
| Transcription factor | 4 | 0.9× | 0.835 |
| GPCR | 1 | 0.7× | 0.883 |
| Other/Unknown | 15 | 0.8× | 0.970 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| ATM | Kinase | yes | 2.7.11.1 | PI3/4_kinase_cat_dom, PIK-rel_kinase_FAT, FATC_dom |
| ARID1A | Other/Unknown | no | ARID_dom, ARM-like, ARM-type_fold | |
| TP53 | Transcription factor | no | p53_tumour_suppressor, p53-like_TF_DNA-bd_sf, p53_tetrameristn | |
| CCND2 | Other/Unknown | no | Cyclin_C-dom, Cyclin_N, Cyclin-like_dom | |
| CCNE1 | Other/Unknown | no | Cyclin_C-dom, Cyclin_N, Cyclin-like_dom | |
| CD44 | Other/Unknown | no | Link_dom, CD44_antigen, C-type_lectin-like/link_sf | |
| CDH1 | Other/Unknown | no | Cadherin_Y-type_LIR, Cadherin-like_dom, Cadherin_pro_dom | |
| CD274 | Antibody/Immunoglobulin | yes | Ig_sub, Ig-like_dom, Ig_V-set | |
| SLTM | Other/Unknown | no | RRM_dom, SAP_dom, Nucleotide-bd_a/b_plait_sf | |
| BCOR | Scaffold/PPI | no | Ankyrin_rpt, BCOR, PUFD | |
| ERBB2 | Kinase | yes | 2.7.10.1 | Rcpt_L-dom, Prot_kinase_dom, Ser-Thr/Tyr_kinase_cat_dom |
| FGFR2 | Kinase | yes | 2.7.10.1 | Prot_kinase_dom, Ser-Thr/Tyr_kinase_cat_dom, Ig_sub2 |
| RHOA | Enzyme (other) | yes | 3.6.5.2 | Small_GTPase, Small_GTPase_Rho, Small_GTP-bd |
| MLH1 | Other/Unknown | no | MutL/Mlh/PMS, DNA_mismatch_S5_2-like, Ribsml_uS5_D2-typ_fold_subgr | |
| MTHFR | Enzyme (other) | yes | 1.5.1.20 | Mehydrof_redctse-like, Fadh2_euk, FAD-linked_oxidoreductase-like |
| PIK3CA | Kinase | yes | 2.7.1.137 | PI3K_Ras-bd_dom, PI3/4_kinase_cat_dom, PI3K_accessory_dom |
| PTEN | Phosphatase | yes | 3.1.3.16 | Tyr_Pase_dom, Tyr_Pase_cat, Tensin_C2-dom |
| SP4 | Transcription factor | no | Znf_C2H2_type, Znf_C2H2_sf, Sp4-like | |
| ZBTB20 | Transcription factor | no | BTB/POZ_dom, SKP1/BTB/POZ_sf, Znf_C2H2_type | |
| PLCE1 | Enzyme (other) | yes | 3.1.4.11 | C2_dom, RA_dom, PLipase_C_PInositol-sp_X_dom |
| ASH1L | Transcription factor | no | 2.1.1.357 | BAH_dom, SET_dom, Bromodomain |
| HCN3 | Ion channel | yes | cNMP-bd_dom, K_chnl_volt-dep_EAG/ELK/ERG, Ion_trans_dom | |
| UNC5CL | Other/Unknown | no | Death_dom, ZU5_dom, DEATH-like_dom_sf | |
| LRFN2 | Antibody/Immunoglobulin | yes | Cys-rich_flank_reg_C, Leu-rich_rpt, Leu-rich_rpt_typical-subtyp | |
| TSPO2 | Other/Unknown | no | TspO_MBR, TspO/MBR-related_sf | |
| NOC3L | Other/Unknown | no | CCAAT-binding_factor, Noc3_N, ARM-type_fold | |
| NSUN3 | Enzyme (other) | yes | 2.1.1.203 | MeTrfase_RsmB-F_NOP2_dom, RCMT, SAM-dependent_MTases_sf |
| ANKRD50 | Scaffold/PPI | no | Ankyrin_rpt, Ankyrin_rpt-contain_sf, NPHP3-like_N | |
| DNAH11 | Other/Unknown | no | AAA+_ATPase, Dhc_D6_P-loop, Dynein_heavy_tail | |
| TTC33 | Other/Unknown | no | TPR-like_helical_dom_sf, TPR_rpt, TPR-containing | |
| MTX1 | Other/Unknown | no | Sam37/metaxin_N, Metaxin_GST, Glutathione-S-Trfase_C_sf | |
| MUC1 | Other/Unknown | no | SEA_dom, SEA_dom_sf | |
| OPCML | Antibody/Immunoglobulin | yes | Ig_sub2, Ig_sub, Ig-like_dom | |
| PRKAA1 | Kinase | yes | 2.7.11.1 | Prot_kinase_dom, Ser/Thr_kinase_AS, Kinase-like_dom_sf |
| PSCA | Other/Unknown | no | LY6_UPA_recep-like, Toxin/TOLIP, Snake_toxin-like_sf | |
| PTGER4 | GPCR | yes | GPCR_Rhodpsn, Prostglndn_DP_rcpt, Prost_EP4_rcpt |
Expression context
Cohort genes with no expression data: 0.
33 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 36 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| calcaneal tendon | 8 |
| cortical plate | 4 |
| sperm | 4 |
| ventricular zone | 3 |
| adrenal tissue | 3 |
| sural nerve | 3 |
| colonic epithelium | 2 |
| corpus callosum | 2 |
| bone marrow cell | 2 |
| ganglionic eminence | 2 |
| cauda epididymis | 2 |
| secondary oocyte | 2 |
| jejunal mucosa | 2 |
| lower esophagus mucosa | 2 |
| right uterine tube | 2 |
| corpus epididymis | 2 |
| endothelial cell | 2 |
| renal glomerulus | 2 |
| Brodmann (1909) area 23 | 2 |
| pylorus | 2 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| ATM | 286 | ubiquitous | marker | calcaneal tendon, colonic epithelium, corpus callosum |
| ARID1A | 286 | ubiquitous | marker | bone marrow cell, ventricular zone, embryo |
| TP53 | 223 | ubiquitous | marker | ventricular zone, ganglionic eminence, tendon of biceps brachii |
| CCND2 | 293 | ubiquitous | marker | adrenal tissue, seminal vesicle, cauda epididymis |
| CCNE1 | 201 | ubiquitous | marker | secondary oocyte, oocyte, adrenal tissue |
| CD44 | 294 | ubiquitous | marker | parotid gland, stromal cell of endometrium, mammalian vulva |
| CDH1 | 245 | broad | marker | jejunal mucosa, esophagus squamous epithelium, gingival epithelium |
| CD274 | 208 | ubiquitous | marker | cartilage tissue, placenta, lower lobe of lung |
| SLTM | 291 | ubiquitous | marker | calcaneal tendon, sural nerve, tibia |
| BCOR | 265 | ubiquitous | marker | buccal mucosa cell, ganglionic eminence, cortical plate |
| ERBB2 | 276 | ubiquitous | marker | lower esophagus mucosa, right uterine tube, sural nerve |
| FGFR2 | 272 | broad | marker | C1 segment of cervical spinal cord, spinal cord, corpus callosum |
| RHOA | 295 | ubiquitous | marker | monocyte, leukocyte, mononuclear cell |
| MLH1 | 296 | ubiquitous | marker | tibialis anterior, skeletal muscle tissue of rectus abdominis, deltoid |
| MTHFR | 254 | ubiquitous | marker | corpus epididymis, sural nerve, apex of heart |
| PIK3CA | 284 | ubiquitous | marker | calcaneal tendon, adrenal tissue, tendon |
| PTEN | 256 | ubiquitous | marker | sperm, endothelial cell, calcaneal tendon |
| SP4 | 265 | ubiquitous | marker | cerebellar vermis, germinal epithelium of ovary, superficial temporal artery |
| ZBTB20 | 292 | ubiquitous | marker | corpus epididymis, caput epididymis, cauda epididymis |
| PLCE1 | 271 | broad | marker | renal glomerulus, metanephric glomerulus, ventricular zone |
| ASH1L | 267 | ubiquitous | marker | Brodmann (1909) area 23, pylorus, cardia of stomach |
| HCN3 | 132 | ubiquitous | marker | cortical plate, right hemisphere of cerebellum, cerebellum |
| UNC5CL | 180 | tissue_specific | yes | epithelial cell of pancreas, pancreatic ductal cell, kidney epithelium |
| LRFN2 | 66 | tissue_specific | yes | cortical plate, prefrontal cortex, right frontal lobe |
| TSPO2 | 140 | tissue_specific | marker | trabecular bone tissue, bone marrow, bone marrow cell |
| NOC3L | 276 | ubiquitous | marker | secondary oocyte, calcaneal tendon, male germ line stem cell (sensu Vertebrata) in testis |
| NSUN3 | 231 | ubiquitous | marker | sperm, male germ cell, calcaneal tendon |
| ANKRD50 | 246 | ubiquitous | marker | sperm, skin of hip, upper leg skin |
| DNAH11 | 163 | broad | marker | right uterine tube, bronchial epithelial cell, bronchus |
| TTC33 | 270 | ubiquitous | yes | calcaneal tendon, colonic epithelium, cortical plate |
Protein interactions among cohort
Intra-cohort edges: 20.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| TP53 | 22,736 |
| PTEN | 11,626 |
| ERBB2 | 9,659 |
| CDH1 | 8,738 |
| ATM | 7,383 |
| CD44 | 6,810 |
| PIK3CA | 5,157 |
| CD274 | 5,012 |
| MLH1 | 4,435 |
| CCNE1 | 3,811 |
Intra-cohort edges
| A | B | Sources |
|---|---|---|
| ATM | MLH1 | string_interaction |
| ATM | TP53 | biogrid_interaction, string_interaction |
| CCNE1 | TP53 | string_interaction |
| CD44 | ERBB2 | string_interaction |
| CDH1 | ERBB2 | string_interaction |
| CDH1 | PTEN | string_interaction |
| ERBB2 | MUC1 | biogrid_interaction |
| ERBB2 | OPCML | biogrid_interaction |
| ERBB2 | PIK3CA | string_interaction |
| LRFN2 | UNC5CL | string_interaction |
| NOC3L | PLCE1 | string_interaction |
| PIK3CA | PTEN | string_interaction |
| PIK3CA | SLTM | intact |
| PLCE1 | TP53 | biogrid_interaction |
| PLCE1 | UNC5CL | string_interaction |
| PRKAA1 | TTC33 | string_interaction |
| PRKAA1 | UNC5CL | string_interaction |
| PSCA | UNC5CL | string_interaction |
| PTEN | TP53 | string_interaction |
| UNC5CL | ZBTB20 | string_interaction |
Structural data
PDB: 26 · AlphaFold-only: 10 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| TP53 | P04637 | 313 |
| PIK3CA | P42336 | 135 |
| RHOA | P61586 | 131 |
| CD274 | Q9NZQ7 | 76 |
| ERBB2 | P04626 | 63 |
| FGFR2 | P21802 | 63 |
| MUC1 | P15941 | 23 |
| CCNE1 | P24864 | 22 |
| CDH1 | P12830 | 22 |
| ASH1L | Q9NR48 | 16 |
| ATM | Q13315 | 14 |
| PTEN | P60484 | 12 |
| PRKAA1 | Q13131 | 12 |
| PTGER4 | P35408 | 10 |
| ARID1A | O14497 | 7 |
| MLH1 | P40692 | 7 |
| CD44 | P16070 | 6 |
| BCOR | Q6W2J9 | 5 |
| MTHFR | P42898 | 4 |
| NOC3L | Q8WTT2 | 4 |
| PLCE1 | Q9P212 | 3 |
| HCN3 | Q9P1Z3 | 3 |
| ZBTB20 | Q9HC78 | 2 |
| CCND2 | P30279 | 1 |
| OPCML | Q14982 | 1 |
| PSCA | O43653 | 1 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|---|---|
| NSUN3 | Q9H649 | 90.97 |
| TTC33 | Q6PID6 | 80.26 |
| UNC5CL | Q8IV45 | 80.18 |
| ANKRD50 | Q9ULJ7 | 74.26 |
| MTX1 | Q13505 | 71.83 |
| LRFN2 | Q9ULH4 | 70.36 |
| TSPO2 | Q5TGU0 | 68.09 |
| SLTM | Q9NWH9 | 52.38 |
| SP4 | Q02446 | 39.58 |
| DNAH11 | Q96DT5 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 363. Enrichment computed across 36 evidence-associated genes (25 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 25 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Developmental Lineage of Mammary Gland Luminal Epithelial Cells | 4 | 73.1× | 8e-05 | CD44, CDH1, ERBB2, MUC1 |
| Developmental Lineage of Mammary Stem Cells | 3 | 91.4× | 8e-04 | CD44, CDH1, ERBB2 |
| Developmental Lineage of Mammary Gland Myoepithelial Cells | 3 | 65.3× | 0.001 | CD44, CDH1, ERBB2 |
| Ovarian tumor domain proteases | 3 | 33.4× | 0.008 | TP53, RHOA, PTEN |
| PI3K/AKT activation | 2 | 101.5× | 0.012 | RHOA, PIK3CA |
| TP53 Regulates Transcription of Caspase Activators and Caspases | 2 | 76.1× | 0.012 | ATM, TP53 |
| Positive Regulation of CDH1 Gene Transcription | 2 | 76.1× | 0.012 | ARID1A, CDH1 |
| Aberrant regulation of mitotic G1/S transition in cancer due to RB1 defects | 2 | 70.3× | 0.012 | CCND2, CCNE1 |
| Stabilization of p53 | 2 | 60.9× | 0.012 | ATM, TP53 |
| ERBB2 Regulates Cell Motility | 2 | 57.1× | 0.012 | ERBB2, RHOA |
| TP53 Regulates Transcription of Genes Involved in G1 Cell Cycle Arrest | 2 | 57.1× | 0.012 | TP53, CCNE1 |
| p53-Dependent G1 DNA Damage Response | 2 | 57.1× | 0.012 | ATM, CCNE1 |
| p53-Dependent G1/S DNA damage checkpoint | 2 | 57.1× | 0.012 | ATM, CCNE1 |
| PI3K events in ERBB2 signaling | 2 | 53.7× | 0.012 | ERBB2, PIK3CA |
| G1/S DNA Damage Checkpoints | 2 | 53.7× | 0.012 | ATM, CCNE1 |
| Signaling by ERBB2 ECD mutants | 2 | 53.7× | 0.012 | ERBB2, PIK3CA |
| TP53 Regulates Transcription of DNA Repair Genes | 3 | 21.8× | 0.012 | ATM, TP53, MLH1 |
| DNA Damage/Telomere Stress Induced Senescence | 3 | 19.6× | 0.012 | ATM, TP53, CCNE1 |
| Transcriptional Regulation by TP53 | 4 | 9.9× | 0.012 | ATM, CCNE1, MLH1, PRKAA1 |
| RNA Polymerase II Transcription | 6 | 5.4× | 0.012 | ATM, ARID1A, CCND2, CCNE1, MLH1, PRKAA1 |
| Defective binding of RB1 mutants to E2F1,(E2F2, E2F3) | 2 | 50.8× | 0.012 | CCND2, CCNE1 |
| Sema4D induced cell migration and growth-cone collapse | 2 | 45.7× | 0.013 | ERBB2, RHOA |
| Diseases of DNA repair | 2 | 45.7× | 0.013 | ATM, MLH1 |
| TP53 Regulates Transcription of Genes Involved in Cytochrome C Release | 2 | 43.5× | 0.013 | ATM, TP53 |
| Regulation of TP53 Activity through Methylation | 2 | 43.5× | 0.013 | ATM, TP53 |
| TP53 Regulates Metabolic Genes | 3 | 15.6× | 0.013 | TP53, PRKAA1, PTEN |
| Constitutive Signaling by Aberrant PI3K in Cancer | 3 | 15.2× | 0.013 | ERBB2, FGFR2, PIK3CA |
| PI-3K cascade:FGFR2 | 2 | 39.7× | 0.015 | FGFR2, PIK3CA |
| Regulation of TP53 Activity through Phosphorylation | 3 | 14.1× | 0.015 | ATM, TP53, PRKAA1 |
| Synthesis of IP3 and IP4 in the cytosol | 2 | 33.8× | 0.018 | PLCE1, PTEN |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 35 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| regulation of osteoblast proliferation | 2 | 321.0× | 0.009 | FGFR2, RHOA |
| odontogenesis | 3 | 45.1× | 0.013 | BCOR, FGFR2, RHOA |
| meiotic telomere clustering | 2 | 107.0× | 0.021 | ATM, MLH1 |
| negative regulation of cell size | 2 | 96.3× | 0.021 | RHOA, PTEN |
| cellular response to X-ray | 2 | 96.3× | 0.021 | ATM, CCND2 |
| DNA damage response, signal transduction by p53 class mediator | 3 | 30.7× | 0.021 | ATM, TP53, MUC1 |
| positive regulation of protein localization | 2 | 80.2× | 0.023 | CDH1, PRKAA1 |
| cellular response to glucose stimulus | 3 | 22.9× | 0.023 | ZBTB20, PIK3CA, PRKAA1 |
| cell migration | 5 | 8.8× | 0.023 | CD44, CDH1, RHOA, PIK3CA, PTEN |
| cardiac septum morphogenesis | 2 | 68.8× | 0.023 | TP53, DNAH11 |
| epidermal growth factor receptor signaling pathway | 3 | 21.2× | 0.023 | PLCE1, ERBB2, PIK3CA |
| wound healing, spreading of cells | 2 | 64.2× | 0.024 | CD44, RHOA |
| mitotic G1 DNA damage checkpoint signaling | 2 | 60.2× | 0.024 | TP53, MUC1 |
| negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator | 2 | 60.2× | 0.024 | CD44, MUC1 |
| replicative senescence | 2 | 56.6× | 0.025 | ATM, TP53 |
| phosphatidylinositol 3-kinase/protein kinase B signal transduction | 3 | 18.1× | 0.026 | ERBB2, PIK3CA, PTEN |
| post-embryonic development | 3 | 17.6× | 0.026 | ATM, ASH1L, FGFR2 |
| angiotensin-mediated vasoconstriction involved in regulation of systemic arterial blood pressure | 1 | 481.5× | 0.027 | RHOA |
| tRNA wobble base cytosine methylation | 1 | 481.5× | 0.027 | NSUN3 |
| alpha-beta T cell lineage commitment | 1 | 481.5× | 0.027 | RHOA |
| response to muscle inactivity | 1 | 481.5× | 0.027 | PIK3CA |
| fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow cell | 1 | 481.5× | 0.027 | FGFR2 |
| fibroblast growth factor receptor signaling pathway involved in hemopoiesis | 1 | 481.5× | 0.027 | FGFR2 |
| fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow | 1 | 481.5× | 0.027 | FGFR2 |
| meiotic metaphase I homologous chromosome alignment | 1 | 481.5× | 0.027 | MLH1 |
| negative regulation of glucosylceramide biosynthetic process | 1 | 481.5× | 0.027 | PRKAA1 |
| negative regulation of helicase activity | 1 | 481.5× | 0.027 | TP53 |
| lateral sprouting from an epithelium | 1 | 481.5× | 0.027 | FGFR2 |
| specification of axis polarity | 1 | 481.5× | 0.027 | BCOR |
| cellular response to actinomycin D | 1 | 481.5× | 0.027 | TP53 |
Therapeutics
Drugs indicated for this disease
3 approved, 14 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
| Drug | Development status |
|---|---|
| Capecitabine | Approved (phase 4) |
| Ramucirumab | Approved (phase 4) |
| Trastuzumab | Approved (phase 4) |
| Bevacizumab | Phase 3 (in late-stage trials) |
| Camrelizumab | Phase 3 (in late-stage trials) |
| Cisplatin | Phase 3 (in late-stage trials) |
| Ferric Carboxymaltose | Phase 3 (in late-stage trials) |
| Fluorouracil | Phase 3 (in late-stage trials) |
| Gimeracil | Phase 3 (in late-stage trials) |
| Irinotecan | Phase 3 (in late-stage trials) |
| Oteracil | Phase 3 (in late-stage trials) |
| Oxaliplatin | Phase 3 (in late-stage trials) |
| Paclitaxel | Phase 3 (in late-stage trials) |
| Pemetrexed | Phase 3 (in late-stage trials) |
| Rivoceranib | Phase 3 (in late-stage trials) |
| Sintilimab | Phase 3 (in late-stage trials) |
| Tegafur | Phase 3 (in late-stage trials) |
Earlier-phase candidates (phase 2, investigational — efficacy not yet established): ANTINEOPLASTON A10, Gefitinib, Lenvatinib, Penpulimab, Tesetaxel.
Drug target analysis
Approved (phase 4): 11 · Phase ≥3: 11 · Phased (≥1): 11 · Undrugged: 25
Druggability breadth: 23 of 36 evidence-associated genes (64%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|---|
| ATM | AMIODARONE HYDROCHLORIDE |
| TP53 | NITROFURANTOIN |
| CCND2 | PALBOCICLIB |
| CCNE1 | PALBOCICLIB |
| CD274 | MOCLOBEMIDE |
| SLTM | CABOZANTINIB |
| ERBB2 | CLOTRIMAZOLE |
| FGFR2 | PONATINIB |
| PIK3CA | IDELALISIB |
| PRKAA1 | ADENOSINE PHOSPHATE |
| PTGER4 | DINOPROSTONE |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| TP53 | 196 | 4 |
| ERBB2 | 83 | 4 |
| PIK3CA | 67 | 4 |
| FGFR2 | 59 | 4 |
| PRKAA1 | 46 | 4 |
| CCNE1 | 38 | 4 |
| ATM | 35 | 4 |
| PTGER4 | 9 | 4 |
| CD274 | 4 | 4 |
| CCND2 | 3 | 4 |
Drugs targeting cohort genes (top 30)
| Molecule | Max phase | Targets in cohort |
|---|---|---|
| AMIODARONE HYDROCHLORIDE | 4 | ATM, TP53 |
| FURAZOLIDONE | 4 | ATM, TP53 |
| ESTRADIOL ACETATE | 4 | ATM |
| NAFTIFINE HYDROCHLORIDE | 4 | ATM |
| METHYSERGIDE MALEATE | 4 | ATM |
| AMITRIPTYLINE HYDROCHLORIDE | 4 | ATM, TP53 |
| XYLOMETAZOLINE HYDROCHLORIDE | 4 | ATM |
| FLUVOXAMINE MALEATE | 4 | ATM |
| ESTRADIOL VALERATE | 4 | ATM |
| PERMETHRIN | 4 | ATM |
| MITOTANE | 4 | ATM |
| TICLOPIDINE HYDROCHLORIDE | 4 | ATM |
| ENOXIMONE | 4 | ATM |
| METHYLENE BLUE ANHYDROUS | 4 | ATM |
| DITHIAZANINE IODIDE | 4 | ATM |
| ETHACRYNIC ACID | 4 | ATM, TP53 |
| SECNIDAZOLE | 4 | ATM |
| MENADIONE | 4 | ATM, TP53 |
| FENOFIBRATE | 4 | ATM |
| DIPYRIDAMOLE | 4 | ATM |
| NITROFURANTOIN | 4 | TP53 |
| DIOSMIN | 4 | TP53 |
| VERTEPORFIN | 4 | TP53 |
| CANDESARTAN CILEXETIL | 4 | TP53 |
| DIENESTROL | 4 | TP53 |
| CLOTRIMAZOLE | 4 | ERBB2, TP53 |
| COLCHICINE | 4 | TP53 |
| NABUMETONE | 4 | TP53 |
| SALMETEROL XINAFOATE | 4 | TP53 |
| AMOXAPINE | 4 | TP53 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 11.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| PIK3CA | 2,034 | Binding:2009, ADMET:19, Toxicity:4, Functional:2 |
| ERBB2 | 1,221 | Binding:1136, Functional:79, ADMET:6 |
| FGFR2 | 966 | Binding:940, Functional:22, ADMET:4 |
| TP53 | 869 | Binding:775, ADMET:83, Functional:10, Toxicity:1 |
| PRKAA1 | 738 | Binding:734, Functional:4 |
| CCNE1 | 691 | Binding:690, ADMET:1 |
| CD274 | 525 | Binding:520, Functional:5 |
| PTGER4 | 288 | Binding:207, Functional:80, ADMET:1 |
| ATM | 240 | Binding:233, Functional:5, ADMET:2 |
| ASH1L | 65 | Binding:63, ADMET:1, Functional:1 |
| RHOA | 48 | Binding:48 |
| CCND2 | 28 | Binding:28 |
| CDH1 | 18 | Binding:18 |
| SLTM | 14 | Binding:14 |
| MUC1 | 13 | Binding:13 |
| CD44 | 9 | Binding:9 |
| PTEN | 8 | Binding:8 |
| ARID1A | 6 | Binding:6 |
| NSUN3 | 5 | Binding:5 |
| HCN3 | 3 | Binding:1, ADMET:1, Functional:1 |
| BCOR | 2 | Binding:2 |
| MTX1 | 1 | Binding:1 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|---|---|
| ATM | 2.7.11.1 | non-specific serine/threonine protein kinase |
| ERBB2 | 2.7.10.1 | receptor protein-tyrosine kinase |
| FGFR2 | 2.7.10.1 | receptor protein-tyrosine kinase |
| RHOA | 3.6.5.2 | small monomeric GTPase |
| MTHFR | 1.5.1.20, 1.5.1.53 | methylenetetrahydrofolate reductase [NAD(P)H], methylenetetrahydrofolate reductase (NADPH) |
| PIK3CA | 2.7.1.137, 2.7.1.153, 2.7.11.1 | phosphatidylinositol 3-kinase, phosphatidylinositol-4,5-bisphosphate 3-kinase, non-specific serine/threonine protein kinase |
| PTEN | 3.1.3.16, 3.1.3.67 | protein-serine/threonine phosphatase, phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase |
| PLCE1 | 3.1.4.11 | phosphoinositide phospholipase C |
| ASH1L | 2.1.1.357 | [histone H3]-lysine36 N-dimethyltransferase |
| NSUN3 | 2.1.1.203 | tRNA (cytosine34-C5)-methyltransferase |
| PRKAA1 | 2.7.11.1, 2.7.11.31 | non-specific serine/threonine protein kinase, [hydroxymethylglutaryl-CoA reductase (NADPH)] kinase |
Cohort genes with high screening signal
≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.
| Symbol | ChEMBL assays |
|---|---|
| ATM | 240 |
| TP53 | 869 |
| CCNE1 | 691 |
| CD274 | 525 |
| ERBB2 | 1,221 |
| FGFR2 | 966 |
| PIK3CA | 2,034 |
| PRKAA1 | 738 |
| PTGER4 | 288 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 36; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Drug repurposing candidates
29 approved/phased drugs hit cohort targets but don’t yet appear in disease-level clinical trials. Target-inhibition rationale is strongest for cancer driver genes; a bioactivity hit is a screening signal, not a treatment claim.
| Compound | Max phase | Cohort target (bioactivity) |
|---|---|---|
| AMIODARONE HYDROCHLORIDE | 4 | ATM, TP53 |
| ESTRADIOL ACETATE | 4 | ATM |
| NAFTIFINE HYDROCHLORIDE | 4 | ATM |
| METHYSERGIDE MALEATE | 4 | ATM |
| AMITRIPTYLINE HYDROCHLORIDE | 4 | ATM, TP53 |
| XYLOMETAZOLINE HYDROCHLORIDE | 4 | ATM |
| FLUVOXAMINE MALEATE | 4 | ATM |
| ESTRADIOL VALERATE | 4 | ATM |
| PERMETHRIN | 4 | ATM |
| MITOTANE | 4 | ATM |
| TICLOPIDINE HYDROCHLORIDE | 4 | ATM |
| ENOXIMONE | 4 | ATM |
| METHYLENE BLUE ANHYDROUS | 4 | ATM |
| DITHIAZANINE IODIDE | 4 | ATM |
| ETHACRYNIC ACID | 4 | ATM, TP53 |
| SECNIDAZOLE | 4 | ATM |
| MENADIONE | 4 | ATM, TP53 |
| FENOFIBRATE | 4 | ATM |
| DIPYRIDAMOLE | 4 | ATM |
| NITROFURANTOIN | 4 | TP53 |
| DIOSMIN | 4 | TP53 |
| VERTEPORFIN | 4 | TP53 |
| CANDESARTAN CILEXETIL | 4 | TP53 |
| DIENESTROL | 4 | TP53 |
| CLOTRIMAZOLE | 4 | ERBB2, TP53 |
| COLCHICINE | 4 | TP53 |
| NABUMETONE | 4 | TP53 |
| SALMETEROL XINAFOATE | 4 | TP53 |
| AMOXAPINE | 4 | TP53 |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 11 | ATM, TP53, CCND2, CCNE1, CD274, SLTM, ERBB2, FGFR2, PIK3CA, PRKAA1 (+1 more) |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 6 | RHOA, MTHFR, PTEN, PLCE1, HCN3, OPCML |
| D | Druggable family + AlphaFold only, no drug | 2 | LRFN2, NSUN3 |
| E | Difficult family or no structure, no drug | 17 | ARID1A, CD44, CDH1, BCOR, MLH1, SP4, ZBTB20, ASH1L, UNC5CL, TSPO2 (+7 more) |
Undrugged target profiles
25 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| PTEN | 8 | TP53 |
| ARID1A | 6 | — |
| CD44 | 9 | — |
| CDH1 | 18 | — |
| BCOR | 2 | — |
| RHOA | 48 | — |
| MLH1 | 0 | — |
| MTHFR | 0 | — |
| SP4 | 0 | — |
| ZBTB20 | 0 | — |
| PLCE1 | 0 | — |
| ASH1L | 65 | — |
| HCN3 | 3 | — |
| UNC5CL | 0 | — |
| LRFN2 | 0 | — |
| TSPO2 | 0 | — |
| NOC3L | 0 | — |
| NSUN3 | 5 | — |
| ANKRD50 | 0 | — |
| DNAH11 | 0 | — |
| TTC33 | 0 | — |
| MTX1 | 1 | — |
| MUC1 | 13 | — |
| OPCML | 0 | — |
| PSCA | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 2,388.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| PHASE2 | 618 |
| PHASE3 | 202 |
| PHASE1/PHASE2 | 186 |
| PHASE4 | 49 |
| PHASE2/PHASE3 | 45 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT02047994 | PHASE4 | RECRUITING | Multicentric Randomized Study of H. Pylori Eradication and Pepsinogen Testing for Prevention of Gastric Cancer Mortality |
| NCT04168346 | PHASE4 | NOT_YET_RECRUITING | Preoperative Intravenous Iron Therapy in Patients With Gastric Cancer |
| NCT05183126 | PHASE4 | RECRUITING | Pharmacokinetic Study of Skeletal Muscle Area-based Paclitaxel Infusion in Patients With Cancer |
| NCT05498766 | PHASE4 | NOT_YET_RECRUITING | Effect and Safety of Huaier Granule Versus SOX Regimen in Gastric Cancer Patients |
| NCT06499610 | PHASE4 | NOT_YET_RECRUITING | Clinical Study of Irinotecan Liposome Combination Therapy for Advanced Gastric Cancer |
| NCT07124351 | PHASE4 | RECRUITING | Intraoperative Imaging of Gastrointestinal Malignancies Using Pafolacianine (CYTALUX™) |
| NCT07139366 | PHASE4 | RECRUITING | Saccharomyces Boulardii Combined With Bismuth Quadruple Therapy for Helicobacter Pylori Rescue Treatment |
| NCT07224035 | PHASE4 | ACTIVE_NOT_RECRUITING | Helicobacter Pylori Screening and Treatment in the At-risk South Florida Community- AIM 1 |
| NCT07224048 | PHASE4 | ACTIVE_NOT_RECRUITING | Helicobacter Pylori Screening and Treatment in the At-risk South Florida Community-AIM 2 |
| NCT07467174 | PHASE4 | NOT_YET_RECRUITING | RCT Comparing Reduced-port Robotic and Conventional Laparoscopic Subtotal Gastrectomy |
| NCT07502027 | PHASE4 | NOT_YET_RECRUITING | A Clinical Study of Iparomlimab and Tuvonralimab Combined With SOX Following Heterogeneous Radiotherapy as First-line Treatment for Unresectable Locally Advanced or Metastatic HER2-negative Gastric or Gastroesophageal Junction Adenocarcinoma |
| NCT00365508 | PHASE4 | COMPLETED | Counseling and Nicotine Replacement Therapy in Helping Adult Smokers Quit Smoking |
| NCT00558155 | PHASE4 | COMPLETED | The Impact of Immunostimulating Nutrition on the Outcome of Surgery |
| NCT00576940 | PHASE4 | COMPLETED | Standard and Immunostimulating Enteral Nutrition in Surgical Patients |
| NCT00666978 | PHASE4 | COMPLETED | Health Education Counseling With or Without Bupropion in Helping African Americans Stop Smoking |
| NCT01038154 | PHASE4 | UNKNOWN | Study to Evaluate the Efficacy of Pravastatin on Survival and Recurrence of Advanced Gastroesophageal Cancer |
| NCT01234272 | PHASE4 | COMPLETED | Comparison of the Analgesic Effect Between Intrathecal Morphine and IV-fentanyl Patient Controlled Analgesia (ITM-IVPCA) and Epidural PCA (PCEA) in Patients Undergoing Gastrectomy -Randomized Allocation Study- |
| NCT01260194 | PHASE4 | TERMINATED | A Study of Herceptin (Trastuzumab) in Combination With Standard Chemotherapy in Patients With HER Positive Metastatic Gastric Cancer |
| NCT01271582 | PHASE4 | UNKNOWN | Investigation of Association Between UGT1A1 Polymorphisms and Irinotecan Toxicity in Korean Patients |
| NCT01401075 | PHASE4 | COMPLETED | RCT With Adjuvant Mistletoe Treatment in Gastric Cancer Patients |
| NCT01471756 | PHASE4 | COMPLETED | Improving Complete Endoscopic Mucosal Resection (EMR) of Colorectal Neoplasia |
| NCT01766765 | PHASE4 | UNKNOWN | Early Jejunostomy Nutrition Minimizes Time to Chemotherapy |
| NCT01910948 | PHASE4 | UNKNOWN | Perioperative Application of Omega-3 Polyunsaturated Fatty Acids in Gastric Cancer Patients |
| NCT01927328 | PHASE4 | UNKNOWN | Iron Replacement in Oesophagogastric Neoplasia |
| NCT01962272 | PHASE4 | COMPLETED | The Effect of Nutritional Counseling for Cancer Patients |
| NCT01962376 | PHASE4 | UNKNOWN | Preoperative Chemotherapy With Bevacizumab For Potentially Resectable Gastric Cancer With Liver Metastasis |
| NCT02366819 | PHASE4 | SUSPENDED | Genetic Analysis-Guided Irinotecan Hydrochloride Dosing of mFOLFIRINOX in Treating Patients With Locally Advanced Gastroesophageal or Stomach Cancer |
| NCT02401971 | PHASE4 | UNKNOWN | Irinotecan Plus Thalidomide in Second Line Advanced Gastric Cancer |
| NCT02458573 | PHASE4 | COMPLETED | Comparison of the Effects of Continuous Epidural Analgesia and Continuous Intravenous Analgesia on Postoperative Bowel Movement in Patients Undergoing Laparoscopic Gastrectomy |
| NCT02638584 | PHASE4 | COMPLETED | Effects of Ilaprazole on Ulcer Healing Rate and Prevention of Gastrointestinal Bleeding in the Patients Undergone ESD. |
| NCT02776527 | PHASE4 | UNKNOWN | A Clinical Trial of Maintenance Treatment of Apatinib in Advanced Gastric Cancer Patients Have Completed Postoprative Adjuvant Chemotherapy |
| NCT03384511 | PHASE4 | COMPLETED | The Use of 18F-ALF-NOTA-PRGD2 PET/CT Scan to Predict the Efficacy and Adverse Events of Apatinib in Malignancies. |
| NCT03550482 | PHASE4 | COMPLETED | Oncoxin® and Quality of Life in Cancer Patients |
| NCT03609892 | PHASE4 | COMPLETED | Helicobacter Rescue Therapy With Berberine Plus Amoxicillin Quadruple Therapy Versus Tetracycline Plus Furazolidone Quadruple Therapy |
| NCT03642093 | PHASE4 | UNKNOWN | HOPE - A Study to Evaluate the Effect of a Prehabilitation Program on GI Cancer Patients Planning to Undergo Surgery |
| NCT03733639 | PHASE4 | UNKNOWN | Tisseel® as a Reinforcement of Esophagojejunal Anastomoses |
| NCT04209933 | PHASE4 | COMPLETED | Helicobacter Pylori Eradication With Different Bismuth Quadruple Therapies |
| NCT04591028 | PHASE4 | WITHDRAWN | A Study to Evaluate Indocyanine Green Lymphangiography to Improve Lymphadenectomy in Gastric Cancer Patients |
| NCT04607057 | PHASE4 | UNKNOWN | Supplemental Parenteral Nutrition During Postgastrectomy in Nutritionally at Risk Patient |
| NCT04660123 | PHASE4 | COMPLETED | A Real World Study of Bismuth Colloidal Pectin Granules Quadruple Therapy for H. Pylori Eradication |
Drugs tested across these trials (top 30)
| Molecule | Max phase | Trials referencing |
|---|---|---|
| IRINOTECAN | 4 | 41 |
| EPIRUBICIN | 4 | 34 |
| RAMUCIRUMAB | 4 | 15 |
| FRUQUINTINIB | 4 | 11 |
| INDOCYANINE GREEN ACID FORM | 4 | 10 |
| FLOXURIDINE | 4 | 8 |
| LEUCOVORIN | 4 | 8 |
| TISLELIZUMAB | 4 | 6 |
| TEGAFUR | 4 | 5 |
| ZOLBETUXIMAB | 4 | 5 |
| AFATINIB | 4 | 4 |
| FLUOROURACIL | 4 | 4 |
| NIVOLUMAB | 4 | 4 |
| OLAPARIB | 4 | 4 |
| OXALIPLATIN | 4 | 4 |
| RELATLIMAB | 4 | 4 |
| TORIPALIMAB | 4 | 4 |
| TRASTUZUMAB | 4 | 4 |
| TRASTUZUMAB EMTANSINE | 4 | 4 |
| CABAZITAXEL | 4 | 3 |
| CISPLATIN | 4 | 3 |
| CLARITHROMYCIN | 4 | 3 |
| FURAZOLIDONE | 4 | 3 |
| MITOMYCIN | 4 | 3 |
| PERTUZUMAB | 4 | 3 |
| TETRACYCLINE | 4 | 3 |
| BERBERINE | 4 | 2 |
| CAPIVASERTIB | 4 | 2 |
| CATUMAXOMAB | 4 | 2 |
| EFLORNITHINE | 4 | 2 |
Precision-medicine subtype map (CIViC)
Drug × molecular subtype: 36 predictive associations from 38 curated evidence items; also 16 prognostic, 1 oncogenic, 1 diagnostic.
| Molecular subtype | Therapy | Effect | Level | CIViC |
|---|---|---|---|---|
| ERBB2 Amplification | Pembrolizumab + Trastuzumab + Chemotherapy | Sensitivity/Response | CIViC A | EID11251 |
| ERBB2 Amplification | Trastuzumab | Sensitivity/Response | CIViC A | EID11253 |
| ERBB2 Amplification OR ERBB2 Overexpression | Trastuzumab + Chemotherapy | Sensitivity/Response | CIViC A | EID11255 |
| ATM Underexpression | Paclitaxel + Olaparib | Sensitivity/Response | CIViC B | EID5215 +1 |
| ERBB2 Amplification | Trastuzumab Deruxtecan | Sensitivity/Response | CIViC B | EID7647 |
| ERBB2 Overexpression | Trastuzumab | Sensitivity/Response | CIViC B | EID7063 |
| FGFR2 Amplification | Fexagratinib | Sensitivity/Response | CIViC B | EID1990 |
| MET Amplification | Savolitinib | Sensitivity/Response | CIViC B | EID7729 |
| MET Exon 14 Skipping Mutation | Crizotinib | Sensitivity/Response | CIViC B | EID11377 |
| MET Exon 14 Skipping Mutation | SAIT301 | Sensitivity/Response | CIViC B | EID11378 |
| MET Overexpression | Rilotumumab | Sensitivity/Response | CIViC B | EID5835 |
| MTHFR A222V | Fluorouracil | Sensitivity/Response | CIViC B | EID669 |
| TP53 Overexpression | Cisplatin + Mitomycin + Etoposide | Sensitivity/Response | CIViC B | EID2799 |
| VEGFA Overexpression | Bevacizumab | Sensitivity/Response | CIViC B | EID7216 |
| VEGFA Overexpression of VEGF121 and VEGF110 | Bevacizumab | Sensitivity/Response | CIViC B | EID9298 |
| MLH1 METHYLATION | Oxaliplatin | Resistance | CIViC B | EID1315 |
| PTEN Loss | Chemotherapy | Resistance | CIViC B | EID1493 |
| TP53 Mutation | Cisplatin + Etoposide + Doxorubicin | Sensitivity/Response | CIViC C | EID2820 |
| TP53 R175H | EAP Protocol | Sensitivity/Response | CIViC C | EID2310 |
| TP53 R213P | EAP Protocol | Sensitivity/Response | CIViC C | EID2819 |
| TP53 R273C | Etoposide + Mitomycin + Cisplatin | Sensitivity/Response | CIViC C | EID2292 |
| TP53 R282L | EAP Protocol | Sensitivity/Response | CIViC C | EID2818 |
| TP53 Y220C | Mitomycin + Cisplatin + Etoposide | Sensitivity/Response | CIViC C | EID2306 |
| CRKL Amplification | Dasatinib | Sensitivity/Response | CIViC D | EID6398 |
| DDR2 High expression | Dasatinib | Sensitivity/Response | CIViC D | EID9853 |
| ERBB2 Amplification | Afatinib | Sensitivity/Response | CIViC D | EID7808 |
| FGFR2 Amplification | Erdafitinib | Sensitivity/Response | CIViC D | EID7953 |
| FGFR2 Amplification | Ponatinib | Sensitivity/Response | CIViC D | EID8062 |
| FGFR4 G636C | FGFR Inhibitor ASP5878 | Sensitivity/Response | CIViC D | EID8905 |
| NPTXR Overexpression | Cisplatin + Fluorouracil | Sensitivity/Response | CIViC D | EID12774 |
+6 more predictive associations (showing top 30 by evidence level).
Related Atlas pages
- Cohort genes: ATM, ARID1A, TP53, CCND2, CCNE1, CD44, CDH1, CD274, SLTM, BCOR, ERBB2, FGFR2, RHOA, MLH1, MTHFR, PIK3CA, PTEN, ZBTB20, SP4, PLCE1, ASH1L, HCN3, UNC5CL, LRFN2, TSPO2, NOC3L, NSUN3, ANKRD50, DNAH11, TTC33, MTX1, MUC1, OPCML, PRKAA1, PSCA, PTGER4
- Drugs: Irinotecan, Epirubicin, Ramucirumab, Fruquintinib, Indocyanine Green Acid Form, Floxuridine, Tislelizumab, Tegafur, Zolbetuximab, Afatinib, Fluorouracil, Nivolumab, Olaparib, Oxaliplatin, Relatlimab, Toripalimab, Trastuzumab, Trastuzumab Emtansine, Cabazitaxel, Cisplatin, Clarithromycin, Furazolidone, Mitomycin, Pertuzumab, Tetracycline, Berberine, Capivasertib, Catumaxomab, Eflornithine, Trastuzumab Deruxtecan, Savolitinib, Crizotinib, Rilotumumab, Bevacizumab, Dasatinib, Erdafitinib, Ponatinib
- Associated genes: MAP3K6