Hirschsprung disease, susceptibility to, 4
disease diseaseOn this page
Also known as EDN3 Hirschsprung diseaseHirschsprung disease caused by mutation in EDN3Hirschsprung disease, susceptibility to, type 4HSCR4
Summary
Hirschsprung disease, susceptibility to, 4 (MONDO:0013384) is a disease with 1 cohort gene.
At a glance
- Cohort genes: 1
- ClinVar variants: 70
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | Hirschsprung disease, susceptibility to, 4 |
| Mondo ID | MONDO:0013384 |
| OMIM | 613712 |
| UMLS | C3150975 |
| MedGen | 462325 |
| Is cancer (heuristic) | no |
Also known as: EDN3 Hirschsprung disease · Hirschsprung disease caused by mutation in EDN3 · Hirschsprung disease, susceptibility to, 4 · Hirschsprung disease, susceptibility to, type 4 · HSCR4
Data availability: 70 ClinVar variants · 2 GenCC gene-disease records.
Disease family
Classification path: disease susceptibility › inherited disease susceptibility › Hirschsprung disease, susceptibility to › Hirschsprung disease, susceptibility to, 4
Related subtypes (8): Hirschsprung disease, susceptibility to, 1, Hirschsprung disease, susceptibility to, 2, Hirschsprung disease, susceptibility to, 5, Hirschsprung disease, susceptibility to, 6, Hirschsprung disease, susceptibility to, 7, Hirschsprung disease, susceptibility to, 8, Hirschsprung disease, susceptibility to, 9, Hirschsprung disease, susceptibility to, 3
Genetics & variants
GWAS landscape
No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.
Variant details and genetic-evidence tiers
ClinVar germline variants
70 retrieved; paginated sample, class counts are floors:
45 uncertain significance, 11 likely benign, 9 benign, 2 conflicting classifications of pathogenicity, 2 benign/likely benign, 1 risk factor
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 16648 | NM_207034.3(EDN3):c.262dup (p.Ala88fs) | EDN3 | risk factor | no assertion criteria provided |
| 16646 | NM_207034.3(EDN3):c.49G>A (p.Ala17Thr) | EDN3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 339123 | NM_207034.3(EDN3):c.293C>A (p.Thr98Lys) | EDN3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 1803101 | NM_207034.3(EDN3):c.377C>G (p.Pro126Arg) | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339116 | NM_207034.3(EDN3):c.-164G>A | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339117 | NM_207034.3(EDN3):c.-120C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339118 | NM_207034.3(EDN3):c.-85G>A | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339121 | NM_207034.3(EDN3):c.43T>G (p.Ser15Ala) | EDN3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 339122 | NM_207034.3(EDN3):c.257A>G (p.Glu86Gly) | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339125 | NM_207034.3(EDN3):c.543-7C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339126 | NM_207034.3(EDN3):c.688C>T (p.Arg230Cys) | EDN3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 339127 | NM_207034.3(EDN3):c.689G>A (p.Arg230His) | EDN3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 339129 | NM_207034.3(EDN3):c.*96G>A | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339135 | NM_207034.3(EDN3):c.*143C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339136 | NM_207034.3(EDN3):c.*144C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339137 | NM_207034.3(EDN3):c.*145C>A | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339139 | NM_207034.3(EDN3):c.*147C>G | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339144 | NM_207034.3(EDN3):c.*571A>G | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339145 | NM_207034.3(EDN3):c.*585C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339146 | NM_207034.3(EDN3):c.*586G>A | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339148 | NM_207034.3(EDN3):c.*679A>G | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339149 | NM_207034.3(EDN3):c.*756C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339152 | NM_207034.3(EDN3):c.*904A>G | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339157 | NM_207034.3(EDN3):c.*1111G>A | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339158 | NM_207034.3(EDN3):c.*1147A>G | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339159 | NM_207034.3(EDN3):c.*1255C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339160 | NM_207034.3(EDN3):c.*1271A>G | EDN3 | Uncertain significance | criteria provided, single submitter |
| 339162 | NM_207034.3(EDN3):c.*1398C>T | EDN3 | Uncertain significance | criteria provided, single submitter |
| 3892384 | NM_207034.3(EDN3):c.646A>C (p.Met216Leu) | EDN3 | Uncertain significance | criteria provided, single submitter |
| 523332 | NM_207034.3(EDN3):c.143AGACTGTGGCTGGCCCTGGCGAGG[3] (p.48ETVAGPGE[3]) | EDN3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 12 · Orphanet: 3 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
GenCC gene–disease validity (cohort genes)
the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.
| Gene | Classification | Inheritance | Disease | Records |
|---|---|---|---|---|
| EDN3 | Limited | Autosomal dominant | Hirschsprung disease, susceptibility to, 4 | 12 |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| EDN3 | Orphanet:388 | Hirschsprung disease |
| EDN3 | Orphanet:661 | Congenital central hypoventilation syndrome |
| EDN3 | Orphanet:897 | Waardenburg-Shah syndrome |
Cohort genes → proteins
1 cohort genes, 1 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| EDN3 | HGNC:3178 | ENSG00000124205 | P14138 | Endothelin-3 | gencc,clinvar |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| EDN3 | Endothelin-3 | Endothelins are endothelium-derived vasoconstrictor peptides. |
Protein-family classification
Druggable: 0 · Difficult: 0 · Unknown: 1 · Druggable fraction: 0.0
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Other/Unknown | 1 | 1.8× | 0.558 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| EDN3 | Other/Unknown | no | Endothln-like_toxin, Endothelin_toxin_CS, Endothelin |
Expression context
Cohort genes with no expression data: 0.
1 cohort gene are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 1 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| jejunal mucosa | 1 |
| penis | 1 |
| primordial germ cell in gonad | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| EDN3 | 175 | broad | marker | penis, jejunal mucosa, primordial germ cell in gonad |
Protein interactions among cohort
Intra-cohort edges: 0.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| EDN3 | 1,376 |
Structural data
PDB: 1 · AlphaFold-only: 0 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| EDN3 | P14138 | 1 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 3. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Transcriptional and post-translational regulation of MITF-M expression and activity | 1 | 178.4× | 0.017 | EDN3 |
| Peptide ligand-binding receptors | 1 | 74.2× | 0.017 | EDN3 |
| G alpha (q) signalling events | 1 | 57.4× | 0.017 | EDN3 |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| regulation of developmental pigmentation | 1 | 5617.3× | 0.002 | EDN3 |
| vein smooth muscle contraction | 1 | 4213.0× | 0.002 | EDN3 |
| regulation of systemic arterial blood pressure by endothelin | 1 | 2808.7× | 0.002 | EDN3 |
| intracellular magnesium ion homeostasis | 1 | 2808.7× | 0.002 | EDN3 |
| peptide hormone secretion | 1 | 2808.7× | 0.002 | EDN3 |
| positive regulation of hormone secretion | 1 | 1685.2× | 0.003 | EDN3 |
| positive regulation of leukocyte chemotaxis | 1 | 1296.3× | 0.003 | EDN3 |
| positive regulation of potassium ion transmembrane transport | 1 | 991.3× | 0.003 | EDN3 |
| positive regulation of smooth muscle contraction | 1 | 936.2× | 0.003 | EDN3 |
| vasoconstriction | 1 | 887.0× | 0.003 | EDN3 |
| regulation of vasoconstriction | 1 | 802.5× | 0.003 | EDN3 |
| melanocyte differentiation | 1 | 802.5× | 0.003 | EDN3 |
| positive regulation of heart rate | 1 | 702.2× | 0.003 | EDN3 |
| positive regulation of mitotic nuclear division | 1 | 543.6× | 0.004 | EDN3 |
| blood circulation | 1 | 510.7× | 0.004 | EDN3 |
| axon extension | 1 | 495.6× | 0.004 | EDN3 |
| neural crest cell migration | 1 | 337.0× | 0.005 | EDN3 |
| neutrophil chemotaxis | 1 | 285.6× | 0.006 | EDN3 |
| positive regulation of cell differentiation | 1 | 267.5× | 0.006 | EDN3 |
| establishment of localization in cell | 1 | 160.5× | 0.009 | EDN3 |
| intracellular calcium ion homeostasis | 1 | 145.3× | 0.010 | EDN3 |
| potassium ion transmembrane transport | 1 | 135.9× | 0.010 | EDN3 |
| cell population proliferation | 1 | 102.8× | 0.013 | EDN3 |
| axon guidance | 1 | 90.6× | 0.014 | EDN3 |
| regulation of gene expression | 1 | 83.4× | 0.014 | EDN3 |
| positive regulation of MAPK cascade | 1 | 80.6× | 0.014 | EDN3 |
| cell-cell signaling | 1 | 69.6× | 0.016 | EDN3 |
| cell surface receptor signaling pathway | 1 | 64.1× | 0.017 | EDN3 |
| positive regulation of cell population proliferation | 1 | 33.6× | 0.031 | EDN3 |
| signal transduction | 1 | 16.1× | 0.062 | EDN3 |
Therapeutics
Drug target analysis
Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1
Druggability breadth: 0 of 1 evidence-associated genes (0%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| EDN3 | 0 | 0 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 0.
Pharmacogenomics
Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 0 | |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 0 | |
| D | Druggable family + AlphaFold only, no drug | 0 | |
| E | Difficult family or no structure, no drug | 1 | EDN3 |
Undrugged target profiles
1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| EDN3 | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 0.
Related Atlas pages
- Cohort genes: EDN3