Summary
IgA glomerulonephritis (MONDO:0005342) is a disease with 33 cohort genes (268 GWAS associations across 15 studies) and 173 clinical trials. The dominant Reactome pathway is Interferon gamma signaling (8 cohort genes). Top therapeutic interventions include hydroxychloroquine, rituximab, and aliskiren.
At a glance
- Cohort genes: 33
- GWAS associations: 268
- ClinVar variants: 1
- Phenotypes (HPO): 17
- Clinical trials: 173
Clinical features
Signs & symptoms
Clinical features (HPO)
17 HPO clinical features (Orphanet curated; top 17 by frequency):
| HPO ID | Term | Frequency |
|---|
| HP:0000794 | IgA deposition in the glomerulus | Frequent (30-79%) |
| HP:0001919 | Acute kidney injury | Frequent (30-79%) |
| HP:0002907 | Microscopic hematuria | Frequent (30-79%) |
| HP:0012587 | Macroscopic hematuria | Frequent (30-79%) |
| HP:0012595 | Mild proteinuria | Frequent (30-79%) |
| HP:0000083 | Renal insufficiency | Occasional (5-29%) |
| HP:0000099 | Glomerulonephritis | Occasional (5-29%) |
| HP:0000282 | Facial edema | Occasional (5-29%) |
| HP:0000822 | Hypertension | Occasional (5-29%) |
| HP:0001394 | Cirrhosis | Occasional (5-29%) |
| HP:0001541 | Ascites | Occasional (5-29%) |
| HP:0002608 | Celiac disease | Occasional (5-29%) |
| HP:0003261 | Increased circulating IgA level | Occasional (5-29%) |
| HP:0030830 | Crackles | Occasional (5-29%) |
| HP:0031504 | Foamy urine | Occasional (5-29%) |
| HP:0033316 | Glomerular crescent formation | Occasional (5-29%) |
| HP:0012593 | Nephrotic range proteinuria | Very rare (<1-4%) |
Identifiers
Disease identifiers
| Field | Value |
|---|
| Canonical name | IgA glomerulonephritis |
| Mondo ID | MONDO:0005342 |
| EFO | EFO:0004194 |
| MeSH | D005922 |
| Orphanet | 34145 |
| DOID | DOID:2986 |
| NCIT | C34643 |
| SNOMED CT | 68779003 |
| UMLS | C0017661 |
| MedGen | 9032 |
| GARD | 0000863 |
| NORD | 1298 |
| Is cancer (heuristic) | no |
Also known as: Berger’s disease · IgA glomerulonephritis · IgA Nephropathy · IgA nephropathy
Data availability: 1 ClinVar variant · 268 GWAS associations (15 studies) · 19 cell lines.
Disease family
Classification path: disease › human disease › disease by body system or component › urinary system disorder › kidney disorder › nephritis › glomerulonephritis › IgA glomerulonephritis
Related subtypes (19): acute poststreptococcal glomerulonephritis, membranoproliferative glomerulonephritis, exudative glomerulonephritis, proliferative glomerulonephritis, focal embolic glomerulonephritis, anti-basement membrane glomerulonephritis, diffuse glomerulonephritis, subacute glomerulonephritis, mesangial proliferative glomerulonephritis, immune-complex glomerulonephritis, membranous glomerulonephritis, lupus nephritis, minimal change disease, granulomatosis with polyangiitis, rapidly progressive glomerulonephritis, primary membranoproliferative glomerulonephritis, Pauci-immune glomerulonephritis, immunotactoid glomerulopathy, autoimmune glomerulonephritis
Genetics & variants
GWAS landscape
268 GWAS associations across 15 studies. Top hits map to 32 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|
| rs9268557 | 5e-47 | TSBP1-AS1 - HLA-DRA | C | 1.24 |
| rs5828672 | 1e-46 | ZNF787 | ? | |
| rs35591339 | 1e-46 | TENM3 | ? | |
| rs143409664 | 5e-41 | PRAG1 | ? | |
| rs7763262 | 2e-38 | HLA-DRA - HLA-DRB9 | C | 1.41 |
| rs9275596 | 3e-31 | MTCO3P1 - HLA-DQB3 | T | 1.44 |
| rs9275224 | 6e-30 | HLA-DQB1 - MTCO3P1 | G | 1.36 |
| rs9270599 | 4e-28 | HLA-DRB1 - HLA-DQA1 | A | 1.55 |
| rs2738058 | 2e-27 | DEFA9P - DEFA10P | T | 1.27 |
| rs34527214 | 2e-27 | CYTH2 | ? | |
| rs9266216 | 5e-27 | HLA-B | T | 0.13 |
| rs767448033 | 3e-24 | TRBV5-4 | ? | |
| rs4803184 | 6e-24 | FBXO27 | ? | |
| chr6:37138023 | 2e-23 | | ? | |
| rs9314614 | 5e-22 | GS1-24F4.2; DEFA9P - DEFA10P; DEFA7P - DEFA5 | T | 1.26 |
| rs660895 | 4e-20 | HLA-DRB1 - HLA-DQA1 | G | 1.34 |
| rs7190997 | 2e-19 | ITGAX | C | 1.22 |
| rs12716641 | 1e-18 | DEFA7P - DEFA5 | T | 1.23 |
| rs35666756 | 1e-18 | MISP3 | ? | |
| chr3:27763427 | 2e-18 | | ? | |
| rs954638 | 5e-18 | MDN1 | ? | |
| rs6677604 | 2e-17 | CFH | G | 1.21 |
| rs11137085 | 3e-17 | DEFA3 - DEFA11P | C | 1.33 |
| rs56254331 | 2e-16 | CCDC97, TGFB1 | C | 0.13 |
| rs2348459 | 4e-16 | PKD1L1, PKD1L1-AS1 | ? | |
| rs2466264 | 7e-16 | TRMT9B | ? | |
| rs2856717 | 1e-15 | HLA-DQB1 - MTCO3P1 | G | 1.27 |
| rs7944434 | 3e-15 | OR10G6 | ? | |
| rs10533306 | 4e-15 | SH3PXD2A | ? | |
| chr15:78913067 | 7e-15 | | ? | |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|
| GCST90018866 | Sakaue S | 2021 | 15,587 | 462,197 | A cross-population atlas of genetic associations for 220 human phenotypes. |
| GCST90308722 | Kiryluk K | 2023 | 5,556 | 21,178 | Genome-wide association analyses define pathogenic signaling pathways and prioritize drug targets for IgA nephropathy. |
| GCST90308723 | Kiryluk K | 2023 | 5,556 | 21,178 | Genome-wide association analyses define pathogenic signaling pathways and prioritize drug targets for IgA nephropathy. |
| GCST90308724 | Kiryluk K | 2023 | 4,590 | 7,573 | Genome-wide association analyses define pathogenic signaling pathways and prioritize drug targets for IgA nephropathy. |
| GCST90454539 | Li M | 2024 | 3,616 | 10,417 | Identification of susceptibility loci and relevant cell type for IgA nephropathy in Han Chinese by integrative genome-wide analysis. |
| GCST90308721 | Kiryluk K | 2023 | 3,549 | 10,140 | Genome-wide association analyses define pathogenic signaling pathways and prioritize drug targets for IgA nephropathy. |
| GCST011781 | Li M | 2020 | 2,628 | 11,563 | Genome-Wide Meta-Analysis Identifies Three Novel Susceptibility Loci and Reveals Ethnic Heterogeneity of Genetic Susceptibility for IgA Nephropathy. |
| GCST90428872 | Li M | 2023 | 2,378 | 15,642 | Genome-Wide Association Analysis of Protein-Coding Variants in IgA Nephropathy. |
| GCST002943 | Li M | 2015 | 1,434 | 10,661 | Identification of new susceptibility loci for IgA nephropathy in Han Chinese. |
| GCST001364 | Yu XQ | 2011 | 1,434 | 4,270 | A genome-wide association study in Han Chinese identifies multiple susceptibility loci for IgA nephropathy. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|
| Tier 1: coding | 2 |
| Tier 2: splice/UTR | 4 |
| Tier 3: regulatory | 2 |
| Tier 4: intronic/intergenic | 42 |
MAF distribution
| Bucket | Variants |
|---|
| common (>=0.05) | 44 |
| low_freq (0.01-0.05) | 0 |
| rare (<0.01) | 0 |
| unknown | 6 |
Functional consequences
| Consequence | Count |
|---|
| intron_variant | 20 |
| intergenic_variant | 12 |
| non_coding_transcript_exon_variant | 4 |
| unknown | 4 |
| inframe_insertion | 2 |
| regulatory_region_variant | 2 |
| 3_prime_UTR_variant | 2 |
| 5_prime_UTR_variant | 2 |
| intron_variant; intergenic_variant; intergenic_variant | 1 |
| synonymous_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|
| rs9268557 | 6 | 32421528 | T>A,C,G | 0.05 | intron_variant | TSBP1-AS1 - HLA-DRA | 5e-47 | Tier 4: intronic/intergenic |
| rs5828672 | 19 | 56088072 | CTCGTCGTCG>C,CTCG,CTCGTCG,CTCGTCGTCGTCG,CTCGTCGTCGTCGTCG,CTCGTCGTCGTCGTCGTCG,CTCGTCGTCGTCGTCGTCGTCG | 0.05 | inframe_insertion | ZNF787 | 1e-46 | Tier 1: coding |
| rs35591339 | 4 | 182449092 | AGCGGCGGCGGCG>A,AGCG,AGCGGCG,AGCGGCGGCG,AGCGGCGGCGGCGGCG,AGCGGCGGCGGCGGCGGCG | 0.05 | intron_variant | TENM3 | 1e-46 | Tier 4: intronic/intergenic |
| rs143409664 | 8 | 8318866 | CGGGGCGGGGGCG>C,CGGGGCG,CGGGGCGGGGGCGGGGGCG,CGGGGCGGGGGCGGGGGCGGGGGCG | 0.05 | inframe_insertion | PRAG1 | 5e-41 | Tier 1: coding |
| rs7763262 | 6 | 32457105 | T>A,C,G | 0.31 | intron_variant | HLA-DRA - HLA-DRB9 | 2e-38 | Tier 4: intronic/intergenic |
| rs9275596 | 6 | 32713854 | C>A,G,T | 0.35 | intergenic_variant | MTCO3P1 - HLA-DQB3 | 3e-31 | Tier 4: intronic/intergenic |
| rs9275224 | 6 | 32692101 | A>C,G | 0.49 | regulatory_region_variant | HLA-DQB1 - MTCO3P1 | 6e-30 | Tier 3: regulatory |
| rs9270599 | 6 | 32593879 | G>A,C,T | 0.428 | intergenic_variant | HLA-DRB1 - HLA-DQA1 | 4e-28 | Tier 4: intronic/intergenic |
| rs2738058 | 8 | 6964095 | T>A,C,G | 0.334 | intergenic_variant | DEFA9P - DEFA10P | 2e-27 | Tier 4: intronic/intergenic |
| rs34527214 | 19 | 48481922 | TA>T | 0.05 | 3_prime_UTR_variant | CYTH2 | 2e-27 | Tier 2: splice/UTR |
| rs9266216 | 6 | 31357313 | C>G,T | 0.05 | non_coding_transcript_exon_variant | HLA-B | 5e-27 | Tier 4: intronic/intergenic |
| rs767448033 | 7 | 142463071 | G>A | 0.05 | 5_prime_UTR_variant | TRBV5-4 | 3e-24 | Tier 2: splice/UTR |
| rs4803184 | 19 | 39014471 | G>A,C,T | 0.05 | non_coding_transcript_exon_variant | FBXO27 | 6e-24 | Tier 4: intronic/intergenic |
| chr6:37138023 | | | | | | | 2e-23 | Tier 4: intronic/intergenic |
| rs9314614 | 8;8;8 | 6840209 | C>G,T | 0.246 | intron_variant; intergenic_variant; intergenic_variant | GS1-24F4.2; DEFA9P - DEFA10P; DEFA7P - DEFA5 | 5e-22 | Tier 4: intronic/intergenic |
| rs660895 | 6 | 32609603 | A>G | 0.24 | regulatory_region_variant | HLA-DRB1 - HLA-DQA1 | 4e-20 | Tier 3: regulatory |
| rs7190997 | 16 | 31356857 | T>A,C,G | 0.308 | intron_variant | ITGAX | 2e-19 | Tier 4: intronic/intergenic |
| rs12716641 | 8 | 7041476 | T>A,C | 0.257 | intergenic_variant | DEFA7P - DEFA5 | 1e-18 | Tier 4: intronic/intergenic |
| rs35666756 | 19 | 14073902 | C>CG,CGGG | 0.05 | intron_variant | MISP3 | 1e-18 | Tier 4: intronic/intergenic |
| chr3:27763427 | | | | | | | 2e-18 | Tier 4: intronic/intergenic |
| rs954638 | 6 | 89690573 | C>A,G,T | 0.05 | intron_variant | MDN1 | 5e-18 | Tier 4: intronic/intergenic |
| rs6677604 | 1 | 196717788 | G>A | 0.05 | intron_variant | CFH | 2e-17 | Tier 4: intronic/intergenic |
| rs11137085 | 8 | 7019946 | G>A,C,T | 0.496 | intergenic_variant | DEFA3 - DEFA11P | 3e-17 | Tier 4: intronic/intergenic |
| rs56254331 | 19 | 41320115 | A>C,G,T | 0.05 | intron_variant | CCDC97, TGFB1 | 2e-16 | Tier 4: intronic/intergenic |
| rs2348459 | 7 | 47795518 | T>A,C,G | 0.05 | intron_variant | PKD1L1, PKD1L1-AS1 | 4e-16 | Tier 4: intronic/intergenic |
| rs2466264 | 8 | 13012929 | C>G | 0.05 | intron_variant | TRMT9B | 7e-16 | Tier 4: intronic/intergenic |
| rs2856717 | 6 | 32702531 | A>C,G,T | 0.38 | intergenic_variant | HLA-DQB1 - MTCO3P1 | 1e-15 | Tier 4: intronic/intergenic |
| rs7944434 | 11 | 123994379 | A>C,G,T | 0.05 | synonymous_variant | OR10G6 | 3e-15 | Tier 4: intronic/intergenic |
| rs10533306 | 10 | 103668696 | CAG>C | 0.05 | intron_variant | SH3PXD2A | 4e-15 | Tier 4: intronic/intergenic |
| chr15:78913067 | | | | | | | 7e-15 | Tier 4: intronic/intergenic |
ClinVar germline variants
1 retrieved; paginated sample, class counts are floors:
1 uncertain significance
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|
| 13526 | NM_002644.4(PIGR):c.1739C>T (p.Ala580Val) | PIGR | Uncertain significance | no assertion criteria provided |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 42 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 2
Dual-evidence genes (GWAS + Mendelian — highest-confidence targets)
| Gene | HGNC | Evidence routes |
|---|
| CFHR3 | CFHR3 | GWAS, Orphanet |
| CFHR1 | CFHR1 | GWAS, Orphanet |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|
| CARD9 | Orphanet:457088 | Predisposition to invasive fungal disease due to CARD9 deficiency |
| CFHR3 | Orphanet:329931 | C3 glomerulonephritis |
| PADI3 | Orphanet:1410 | Uncombable hair syndrome |
| TAP1 | Orphanet:34592 | Immunodeficiency by defective expression of MHC class I |
| TAP2 | Orphanet:34592 | Immunodeficiency by defective expression of MHC class I |
| CFHR1 | Orphanet:329931 | C3 glomerulonephritis |
| CFHR1 | Orphanet:93571 | Dense deposit disease |
| HLA-A | Orphanet:179 | Birdshot chorioretinopathy |
| HLA-B | Orphanet:117 | Behçet disease |
| HLA-B | Orphanet:275798 | Pulmonary arterial hypertension associated with connective tissue disease |
| HLA-B | Orphanet:29207 | Reactive arthritis |
| HLA-B | Orphanet:3287 | Takayasu arteritis |
| HLA-B | Orphanet:36426 | Stevens-Johnson syndrome |
| HLA-B | Orphanet:397 | Giant cell arteritis |
| HLA-DPA1 | Orphanet:900 | Granulomatosis with polyangiitis |
| HLA-DPB1 | Orphanet:133 | Chronic beryllium disease |
| HLA-DPB1 | Orphanet:900 | Granulomatosis with polyangiitis |
| HLA-DQA1 | Orphanet:391490 | Adult-onset myasthenia gravis |
| HLA-DQA1 | Orphanet:930 | Idiopathic achalasia |
| HLA-DQB1 | Orphanet:2073 | Narcolepsy type 1 |
| HLA-DQB1 | Orphanet:477738 | Pediatric multiple sclerosis |
| HLA-DQB1 | Orphanet:703 | Bullous pemphigoid |
| HLA-DQB1 | Orphanet:83465 | Narcolepsy type 2 |
| HLA-DQB1 | Orphanet:930 | Idiopathic achalasia |
| HLA-DRB1 | Orphanet:2073 | Narcolepsy type 1 |
| HLA-DRB1 | Orphanet:220393 | Diffuse cutaneous systemic sclerosis |
| HLA-DRB1 | Orphanet:220402 | Limited cutaneous systemic sclerosis |
| HLA-DRB1 | Orphanet:220407 | Limited systemic sclerosis |
| HLA-DRB1 | Orphanet:3437 | Vogt-Koyanagi-Harada disease |
| HLA-DRB1 | Orphanet:397 | Giant cell arteritis |
| HLA-DRB1 | Orphanet:477738 | Pediatric multiple sclerosis |
| HLA-DRB1 | Orphanet:536 | Systemic lupus erythematosus |
| HLA-DRB1 | Orphanet:545 | Follicular lymphoma |
| HLA-DRB1 | Orphanet:703 | Bullous pemphigoid |
| HLA-DRB1 | Orphanet:747 | Autoimmune pulmonary alveolar proteinosis |
| HLA-DRB1 | Orphanet:797 | Sarcoidosis |
| HLA-DRB1 | Orphanet:83465 | Narcolepsy type 2 |
| HLA-DRB1 | Orphanet:85414 | Systemic-onset juvenile idiopathic arthritis |
| IRF4 | Orphanet:3452 | Whipple disease |
| ITGAM | Orphanet:536 | Systemic lupus erythematosus |
| MPDU1 | Orphanet:79323 | MPDU1-CDG |
| PSMB8 | Orphanet:324977 | Proteasome-associated autoinflammatory syndrome |
Cohort genes → proteins
33 cohort genes, 32 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|
| gwas_only | 32 |
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|
| ST6GAL1 | HGNC:10860 | ENSG00000073849 | P15907 | Beta-galactoside alpha-2,6-sialyltransferase 1 | gwas |
| KLF10 | HGNC:11810 | ENSG00000155090 | Q13118 | Krueppel-like factor 10 | gwas |
| TNFSF13 | HGNC:11928 | ENSG00000161955 | O75888 | Tumor necrosis factor ligand superfamily member 13 | gwas |
| VAV3 | HGNC:12659 | ENSG00000134215 | Q9UKW4 | Guanine nucleotide exchange factor VAV3 | gwas |
| CARD9 | HGNC:16391 | ENSG00000187796 | Q9H257 | Caspase recruitment domain-containing protein 9 | gwas |
| CFHR3 | HGNC:16980 | ENSG00000116785 | Q02985 | Complement factor H-related protein 3 | gwas |
| PADI3 | HGNC:18337 | ENSG00000142619 | Q9ULW8 | Protein-arginine deiminase type-3 | gwas |
| PADI1 | HGNC:18367 | ENSG00000142623 | Q9ULC6 | Protein-arginine deiminase type-1 | gwas |
| PADI4 | HGNC:18368 | ENSG00000159339 | Q9UM07 | Protein-arginine deiminase type-4 | gwas |
| FCRL3 | HGNC:18506 | ENSG00000160856 | Q96P31 | Fc receptor-like protein 3 | gwas |
| ACCS | HGNC:23989 | ENSG00000110455 | Q96QU6 | 1-aminocyclopropane-1-carboxylate synthase-like protein 1 | gwas |
| ACOXL | HGNC:25621 | ENSG00000153093 | Q9NUZ1 | Acyl-coenzyme A oxidase-like protein | gwas |
| HORMAD2 | HGNC:28383 | ENSG00000176635 | Q8N7B1 | HORMA domain-containing protein 2 | gwas |
| TAP1 | HGNC:43 | ENSG00000168394 | Q03518 | Antigen peptide transporter 1 | gwas |
| TAP2 | HGNC:44 | ENSG00000204267 | Q03519 | Antigen peptide transporter 2 | gwas |
| CFHR1 | HGNC:4888 | ENSG00000244414 | Q03591 | Complement factor H-related protein 1 | gwas |
| HLA-A | HGNC:4931 | ENSG00000206503 | P04439 | HLA class I histocompatibility antigen, A alpha chain | gwas |
| HLA-B | HGNC:4932 | ENSG00000234745 | P01889 | HLA class I histocompatibility antigen, B alpha chain | gwas |
| HLA-DPA1 | HGNC:4938 | ENSG00000231389 | P20036 | HLA class II histocompatibility antigen, DP alpha 1 chain | gwas |
| HLA-DPB1 | HGNC:4940 | ENSG00000223865 | P04440 | HLA class II histocompatibility antigen, DP beta 1 chain | gwas |
| HLA-DPB2 | HGNC:4941 | ENSG00000224557 | | major histocompatibility complex, class II, DP beta 2 (pseudogene) | gwas |
| HLA-DQA1 | HGNC:4942 | ENSG00000196735 | P01909 | HLA class II histocompatibility antigen, DQ alpha 1 chain | gwas |
| HLA-DQB1 | HGNC:4944 | ENSG00000179344 | P01920 | HLA class II histocompatibility antigen, DQ beta 1 chain | gwas |
| HLA-DRB1 | HGNC:4948 | ENSG00000196126 | P01911 | HLA class II histocompatibility antigen, DRB1 beta chain | gwas |
| IRF4 | HGNC:6119 | ENSG00000137265 | Q15306 | Interferon regulatory factor 4 | gwas |
| ITGAM | HGNC:6149 | ENSG00000169896 | P11215 | Integrin alpha-M | gwas |
| ITGAX | HGNC:6152 | ENSG00000140678 | P20702 | Integrin alpha-X | gwas |
| MPDU1 | HGNC:7207 | ENSG00000129255 | O75352 | Mannose-P-dolichol utilization defect 1 protein | gwas |
| MTMR3 | HGNC:7451 | ENSG00000100330 | Q13615 | Phosphatidylinositol-3,5-bisphosphate 3-phosphatase MTMR3 | gwas |
| ODF1 | HGNC:8113 | ENSG00000155087 | Q14990 | Outer dense fiber protein 1 | gwas |
| PIGR | HGNC:8968 | ENSG00000162896 | P01833 | Polymeric immunoglobulin receptor | clinvar |
| PSMB8 | HGNC:9545 | ENSG00000204264 | P28062 | Proteasome subunit beta type-8 | gwas |
| PSMB9 | HGNC:9546 | ENSG00000240065 | P28065 | Proteasome subunit beta type-9 | gwas |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|
| ST6GAL1 | Beta-galactoside alpha-2,6-sialyltransferase 1 | Transfers sialic acid from CMP-sialic acid to galactose-containing acceptor substrates. |
| KLF10 | Krueppel-like factor 10 | Transcriptional repressor which binds to the consensus sequence 5’-GGTGTG-3'. |
| TNFSF13 | Tumor necrosis factor ligand superfamily member 13 | Cytokine that binds to TNFRSF13B/TACI and to TNFRSF17/BCMA. |
| VAV3 | Guanine nucleotide exchange factor VAV3 | Exchange factor for GTP-binding proteins RhoA, RhoG and, to a lesser extent, Rac1. |
| CARD9 | Caspase recruitment domain-containing protein 9 | Adapter protein that plays a key role in innate immune response against fungi by forming signaling complexes downstream of C-type lectin receptors. |
| CFHR3 | Complement factor H-related protein 3 | Might be involved in complement regulation. |
| PADI3 | Protein-arginine deiminase type-3 | Catalyzes the deimination of arginine residues of proteins. |
| PADI1 | Protein-arginine deiminase type-1 | Catalyzes the deimination of arginine residues of proteins. |
| PADI4 | Protein-arginine deiminase type-4 | Catalyzes the citrullination/deimination of arginine residues of proteins such as histones, thereby playing a key role in histone code and regulation of stem cell maintenance. |
| FCRL3 | Fc receptor-like protein 3 | Promotes TLR9-induced B-cell proliferation, activation and survival but inhibits antibody production and suppresses plasma cell differentiation. |
| ACCS | 1-aminocyclopropane-1-carboxylate synthase-like protein 1 | Does not catalyze the synthesis of 1-aminocyclopropane-1-carboxylate but is capable of catalyzing the deamination of L-vinylglycine. |
| HORMAD2 | HORMA domain-containing protein 2 | Essential for synapsis surveillance during meiotic prophase via the recruitment of ATR activity. |
| TAP1 | Antigen peptide transporter 1 | ABC transporter associated with antigen processing. |
| TAP2 | Antigen peptide transporter 2 | ABC transporter associated with antigen processing. |
| CFHR1 | Complement factor H-related protein 1 | Involved in complement regulation. |
| HLA-A | HLA class I histocompatibility antigen, A alpha chain | Antigen-presenting major histocompatibility complex class I (MHCI) molecule. |
| HLA-B | HLA class I histocompatibility antigen, B alpha chain | Antigen-presenting major histocompatibility complex class I (MHCI) molecule. |
| HLA-DPA1 | HLA class II histocompatibility antigen, DP alpha 1 chain | Binds peptides derived from antigens that access the endocytic route of antigen presenting cells (APC) and presents them on the cell surface for recognition by the CD4 T-cells. |
| HLA-DPB1 | HLA class II histocompatibility antigen, DP beta 1 chain | Binds peptides derived from antigens that access the endocytic route of antigen presenting cells (APC) and presents them on the cell surface for recognition by the CD4 T-cells. |
| HLA-DQA1 | HLA class II histocompatibility antigen, DQ alpha 1 chain | Binds peptides derived from antigens that access the endocytic route of antigen presenting cells (APC) and presents them on the cell surface for recognition by the CD4 T-cells. |
| HLA-DQB1 | HLA class II histocompatibility antigen, DQ beta 1 chain | Binds peptides derived from antigens that access the endocytic route of antigen presenting cells (APC) and presents them on the cell surface for recognition by the CD4 T-cells. |
| HLA-DRB1 | HLA class II histocompatibility antigen, DRB1 beta chain | A beta chain of antigen-presenting major histocompatibility complex class II (MHCII) molecule. |
| IRF4 | Interferon regulatory factor 4 | Transcriptional activator. |
| ITGAM | Integrin alpha-M | Integrin ITGAM/ITGB2 is implicated in various adhesive interactions of monocytes, macrophages and granulocytes as well as in mediating the uptake of complement-coated particles and pathogens. |
| ITGAX | Integrin alpha-X | Integrin alpha-X/beta-2 is a receptor for fibrinogen. |
| MPDU1 | Mannose-P-dolichol utilization defect 1 protein | Required for normal utilization of mannose-dolichol phosphate (Dol-P-Man) in the synthesis of N-linked and O-linked oligosaccharides and GPI anchors. |
| MTMR3 | Phosphatidylinositol-3,5-bisphosphate 3-phosphatase MTMR3 | Lipid phosphatase that specifically dephosphorylates the D-3 position of phosphatidylinositol 3-phosphate and phosphatidylinositol 3,5-bisphosphate, generating phosphatidylinositol and phosphatidylinositol 5-phosphate. |
| ODF1 | Outer dense fiber protein 1 | Component of the outer dense fibers (ODF) of spermatozoa. |
| PIGR | Polymeric immunoglobulin receptor | Mediates selective transcytosis of polymeric IgA and IgM across mucosal epithelial cells. |
| PSMB8 | Proteasome subunit beta type-8 | The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. |
| PSMB9 | Proteasome subunit beta type-9 | The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. |
Protein-family classification
Druggable: 20 · Difficult: 2 · Unknown: 11 · Druggable fraction: 0.61
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|
| Antibody/Immunoglobulin | 11 | 9.7× | 5e-08 |
| Complement | 2 | 16.2× | 0.027 |
| Transporter | 2 | 4.7× | 0.179 |
| Phosphatase | 1 | 2.5× | 0.523 |
| Enzyme (other) | 4 | 1.4× | 0.523 |
| Other/Unknown | 11 | 0.6× | 0.997 |
| Scaffold/PPI | 1 | 0.5× | 0.997 |
| Transcription factor | 1 | 0.2× | 0.997 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|
| ST6GAL1 | Enzyme (other) | yes | 2.4.99.1 | Glyco_trans_29, Sialyl_trans, GT29-like_sf |
| KLF10 | Transcription factor | no | | Znf_C2H2_type, Znf_C2H2_sf |
| TNFSF13 | Other/Unknown | no | | TNF_dom, Tumour_necrosis_fac-like_dom, TNF_CS |
| VAV3 | Scaffold/PPI | no | | DH_dom, SH2, GDS_CDC24_CS |
| CARD9 | Other/Unknown | no | | CARD, DEATH-like_dom_sf, CARD_CARD9 |
| CFHR3 | Complement | yes | | Sushi_SCR_CCP_dom, Sushi/SCR/CCP_sf, ComplSys_Reg/VirEntry_Med |
| PADI3 | Enzyme (other) | yes | 3.5.3.15 | PAD, Cupredoxin, PAD_C |
| PADI1 | Enzyme (other) | yes | 3.5.3.15 | PAD, Cupredoxin, PAD_C |
| PADI4 | Enzyme (other) | yes | 3.5.3.15 | PAD, Cupredoxin, PAD_C |
| FCRL3 | Antibody/Immunoglobulin | yes | | Ig_sub2, Ig_sub, Ig-like_dom |
| ACCS | Other/Unknown | no | | Aminotransferase_I/II_large, PyrdxlP-dep_Trfase_major, PyrdxlP-dep_Trfase_small |
| ACOXL | Other/Unknown | no | | Acyl-CoA_oxidase_C, AcylCoA_DH/ox_M, AcylCoA_DH/oxidase_NM_dom_sf |
| HORMAD2 | Other/Unknown | no | | HORMA_dom, HORMA_dom_sf, HORMA_MeioticProgression |
| TAP1 | Transporter | yes | 7.4.2.14 | ABC_transporter-like_ATP-bd, AAA+_ATPase, ABC1_TM_dom |
| TAP2 | Transporter | yes | 7.4.2.14 | ABC_transporter-like_ATP-bd, AAA+_ATPase, Tap2/ABCB3 |
| CFHR1 | Complement | yes | | Sushi_SCR_CCP_dom, Sushi/SCR/CCP_sf, ComplSys_Reg/VirEntry_Med |
| HLA-A | Antibody/Immunoglobulin | yes | | MHC_I_a_a1/a2, Ig/MHC_CS, Ig_C1-set |
| HLA-B | Antibody/Immunoglobulin | yes | | MHC_I_a_a1/a2, Ig/MHC_CS, Ig_C1-set |
| HLA-DPA1 | Antibody/Immunoglobulin | yes | | MHC_II_a_N, Ig/MHC_CS, Ig_C1-set |
| HLA-DPB1 | Antibody/Immunoglobulin | yes | | MHC_II_b_N, Ig/MHC_CS, Ig_C1-set |
| HLA-DPB2 | Other/Unknown | no | | |
| HLA-DQA1 | Antibody/Immunoglobulin | yes | | MHC_II_a_N, Ig/MHC_CS, Ig_C1-set |
| HLA-DQB1 | Antibody/Immunoglobulin | yes | | MHC_II_b_N, Ig/MHC_CS, Ig_C1-set |
| HLA-DRB1 | Antibody/Immunoglobulin | yes | | MHC_II_b_N, Ig/MHC_CS, Ig_C1-set |
| IRF4 | Other/Unknown | no | | Interferon_reg_fact_DNA-bd_dom, SMAD_FHA_dom_sf, SMAD-like_dom_sf |
| ITGAM | Antibody/Immunoglobulin | yes | | Integrin_alpha, VWF_A, FG-GAP |
| ITGAX | Antibody/Immunoglobulin | yes | | Integrin_alpha, VWF_A, FG-GAP |
| MPDU1 | Other/Unknown | no | | PQ-loop_rpt, MannP-dilichol_defect-1 |
| MTMR3 | Phosphatase | yes | 3.1.3.95 | Znf_FYVE, Tyr_Pase_cat, Myotubularin-like_Pase_dom |
| ODF1 | Other/Unknown | no | | A-crystallin/Hsp20_dom, HSP20-like_chaperone, ODFP |
| PIGR | Antibody/Immunoglobulin | yes | | Ig_sub, Ig-like_dom, Ig_V-set |
| PSMB8 | Other/Unknown | no | | Pept_T1A_subB, Proteasome_sua/b, Proteasome_bsu_CS |
| PSMB9 | Other/Unknown | no | | Pept_T1A_subB, Proteasome_sua/b, Proteasome_bsu_CS |
Expression context
Cohort genes with no expression data: 0.
30 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 33 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|
| granulocyte | 13 |
| monocyte | 8 |
| leukocyte | 6 |
| lymph node | 6 |
| vermiform appendix | 5 |
| male germ line stem cell (sensu Vertebrata) in testis | 4 |
| blood | 4 |
| liver | 3 |
| right lobe of liver | 3 |
| mononuclear cell | 3 |
| spleen | 3 |
| renal medulla | 2 |
| esophagus mucosa | 2 |
| lower esophagus mucosa | 2 |
| right testis | 2 |
| rectum | 2 |
| right lung | 2 |
| mucosa of transverse colon | 2 |
| mucosa of paranasal sinus | 1 |
| skin of hip | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|
| ST6GAL1 | 294 | ubiquitous | marker | liver, right lobe of liver, renal medulla |
| KLF10 | 288 | ubiquitous | marker | mucosa of paranasal sinus, skin of hip, upper leg skin |
| TNFSF13 | 134 | ubiquitous | marker | monocyte, leukocyte, granulocyte |
| VAV3 | 258 | ubiquitous | marker | tongue squamous epithelium, renal medulla, esophagus squamous epithelium |
| CARD9 | 172 | broad | marker | monocyte, mononuclear cell, leukocyte |
| CFHR3 | 127 | tissue_specific | marker | right lobe of liver, liver, male germ line stem cell (sensu Vertebrata) in testis |
| PADI3 | 43 | tissue_specific | marker | lower esophagus mucosa, esophagus mucosa, urinary bladder |
| PADI1 | 97 | tissue_specific | yes | lower esophagus mucosa, esophagus mucosa, vagina |
| PADI4 | 123 | tissue_specific | marker | blood, bone marrow, bone marrow cell |
| FCRL3 | 167 | tissue_specific | marker | ileal mucosa, granulocyte, lymph node |
| ACCS | 188 | ubiquitous | marker | right uterine tube, right adrenal gland cortex, granulocyte |
| ACOXL | 168 | broad | marker | primordial germ cell in gonad, male germ line stem cell (sensu Vertebrata) in testis, buccal mucosa cell |
| HORMAD2 | 66 | tissue_specific | marker | right testis, left testis, testis |
| TAP1 | 134 | ubiquitous | marker | granulocyte, vermiform appendix, lymph node |
| TAP2 | 134 | ubiquitous | yes | vermiform appendix, lymph node, monocyte |
| CFHR1 | 125 | | marker | right lobe of liver, liver, male germ line stem cell (sensu Vertebrata) in testis |
| HLA-A | 134 | ubiquitous | marker | blood, granulocyte, stromal cell of endometrium |
| HLA-B | 134 | ubiquitous | marker | blood, spleen, granulocyte |
| HLA-DPA1 | 133 | ubiquitous | marker | monocyte, leukocyte, granulocyte |
| HLA-DPB1 | 135 | ubiquitous | marker | granulocyte, lymph node, vermiform appendix |
| HLA-DPB2 | 121 | tissue_specific | marker | male germ line stem cell (sensu Vertebrata) in testis, lymph node, granulocyte |
| HLA-DQA1 | 244 | broad | marker | gall bladder, rectum, monocyte |
| HLA-DQB1 | 268 | broad | marker | right lung, spleen, upper lobe of left lung |
| HLA-DRB1 | 131 | tissue_specific | marker | vermiform appendix, granulocyte, right lung |
| IRF4 | 180 | broad | marker | lymph node, endocervix, vermiform appendix |
| ITGAM | 236 | broad | marker | monocyte, mononuclear cell, leukocyte |
| ITGAX | 174 | broad | marker | granulocyte, monocyte, mononuclear cell |
| MPDU1 | 234 | ubiquitous | marker | rectum, mucosa of transverse colon, islet of Langerhans |
| MTMR3 | 282 | ubiquitous | marker | oocyte, secondary oocyte, blood |
| ODF1 | 130 | tissue_specific | yes | sperm, male germ cell, right testis |
Protein interactions among cohort
Intra-cohort edges: 22.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|
| ITGAM | 4,816 |
| CARD9 | 3,636 |
| IRF4 | 3,450 |
| HLA-DRB1 | 3,448 |
| ITGAX | 3,332 |
| HLA-B | 3,209 |
| PSMB8 | 3,188 |
| PSMB9 | 2,896 |
| TAP1 | 2,139 |
| PIGR | 2,121 |
Intra-cohort edges
| A | B | Sources |
|---|
| FCRL3 | HLA-DRB1 | string_interaction |
| FCRL3 | PADI4 | string_interaction |
| FCRL3 | PIGR | string_interaction |
| HLA-A | HLA-B | biogrid_interaction, intact |
| HLA-A | HLA-DPA1 | biogrid_interaction |
| HLA-A | HLA-DQA1 | biogrid_interaction |
| HLA-A | HLA-DQB1 | biogrid_interaction |
| HLA-B | ST6GAL1 | biogrid_interaction, intact, string_interaction |
| HLA-B | TAP1 | biogrid_interaction, string_interaction |
| HLA-B | TAP2 | string_interaction |
| HLA-DPA1 | HLA-DPB1 | intact |
| HLA-DPA1 | HLA-DQB1 | intact |
| HLA-DQA1 | HLA-DQB1 | biogrid_interaction, intact |
| HORMAD2 | MTMR3 | string_interaction |
| PADI1 | PADI3 | biogrid_interaction, intact |
| PADI3 | PADI4 | biogrid_interaction, intact |
| PSMB8 | PSMB9 | intact, string_interaction |
| PSMB8 | TAP1 | intact, string_interaction |
| PSMB8 | TAP2 | intact, string_interaction |
| PSMB9 | TAP1 | string_interaction |
| PSMB9 | TAP2 | string_interaction |
| TAP1 | TAP2 | biogrid_interaction, intact, string_interaction |
Structural data
PDB: 24 · AlphaFold-only: 8 · No structure: 1
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|
| HLA-A | P04439 | 403 |
| HLA-B | P01889 | 237 |
| HLA-DRB1 | P01911 | 108 |
| ITGAM | P11215 | 31 |
| PADI4 | Q9UM07 | 28 |
| HLA-DQA1 | P01909 | 28 |
| TAP1 | Q03518 | 22 |
| PSMB8 | P28062 | 22 |
| TAP2 | Q03519 | 21 |
| IRF4 | Q15306 | 19 |
| PIGR | P01833 | 16 |
| HLA-DPA1 | P20036 | 10 |
| HLA-DPB1 | P04440 | 10 |
| HLA-DQB1 | P01920 | 10 |
| ITGAX | P20702 | 9 |
| CARD9 | Q9H257 | 8 |
| PADI3 | Q9ULW8 | 7 |
| PSMB9 | P28065 | 7 |
| ST6GAL1 | P15907 | 4 |
| CFHR1 | Q03591 | 2 |
| KLF10 | Q13118 | 1 |
| TNFSF13 | O75888 | 1 |
| VAV3 | Q9UKW4 | 1 |
| PADI1 | Q9ULC6 | 1 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|
| ACOXL | Q9NUZ1 | 92.00 |
| CFHR3 | Q02985 | 91.93 |
| MPDU1 | O75352 | 88.57 |
| ACCS | Q96QU6 | 86.63 |
| FCRL3 | Q96P31 | 77.46 |
| HORMAD2 | Q8N7B1 | 72.61 |
| MTMR3 | Q13615 | 66.94 |
| ODF1 | Q14990 | 62.45 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 108. Enrichment computed across 33 evidence-associated genes (27 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 27 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|
| Interferon gamma signaling | 8 | 37.2× | 3e-09 | HLA-A, HLA-B, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1, IRF4 |
| ER-Phagosome pathway | 6 | 28.8× | 2e-06 | TAP1, TAP2, HLA-A, HLA-B, PSMB8, PSMB9 |
| Translocation of ZAP-70 to Immunological synapse | 4 | 94.0× | 3e-06 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRB1 |
| Phosphorylation of CD3 and TCR zeta chains | 4 | 80.6× | 4e-06 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRB1 |
| Co-inhibition by PD-1 | 4 | 76.9× | 4e-06 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRB1 |
| Antigen Presentation: Folding, assembly and peptide loading of class I MHC | 4 | 58.3× | 1e-05 | TAP1, TAP2, HLA-A, HLA-B |
| Generation of second messenger molecules | 4 | 51.3× | 1e-05 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRB1 |
| Interferon alpha/beta signaling | 4 | 22.6× | 4e-04 | HLA-A, HLA-B, IRF4, PSMB8 |
| Downstream TCR signaling | 4 | 19.0× | 6e-04 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRB1 |
| MHC class II antigen presentation | 4 | 13.2× | 0.002 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DRB1 |
| Endosomal/Vacuolar pathway | 2 | 76.9× | 0.003 | HLA-A, HLA-B |
| Antigen processing: Ub, ATP-independent proteasomal degradation | 2 | 42.3× | 0.009 | PSMB8, PSMB9 |
| Defective MPDU1 causes CDG-1f | 1 | 423.0× | 0.018 | MPDU1 |
| Interleukin-4 and Interleukin-13 signaling | 3 | 11.4× | 0.018 | IRF4, ITGAM, ITGAX |
| Antigen processing-Cross presentation | 2 | 23.5× | 0.023 | TAP1, TAP2 |
| Cross-presentation of soluble exogenous antigens (endosomes) | 2 | 18.8× | 0.034 | PSMB8, PSMB9 |
| Regulation of Complement cascade | 2 | 17.3× | 0.036 | CFHR3, CFHR1 |
| Chromatin modifying enzymes | 3 | 8.0× | 0.036 | PADI3, PADI1, PADI4 |
| Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein | 2 | 15.4× | 0.041 | ST6GAL1, MPDU1 |
| Proteasome assembly | 2 | 15.1× | 0.041 | PSMB8, PSMB9 |
| Signaling by Interleukins | 3 | 7.1× | 0.043 | IRF4, ITGAM, ITGAX |
| Immune System | 6 | 2.9× | 0.074 | CARD9, TAP1, TAP2, IRF4, ITGAM, ITGAX |
| Integrin cell surface interactions | 2 | 9.9× | 0.080 | ITGAM, ITGAX |
| HuR (ELAVL1) binds and stabilizes mRNA | 1 | 47.0× | 0.088 | TNFSF13 |
| Maturation of protein 3a | 1 | 47.0× | 0.088 | ST6GAL1 |
| Nef mediated downregulation of MHC class I complex cell surface expression | 1 | 42.3× | 0.090 | HLA-A |
| Beta-oxidation of pristanoyl-CoA | 1 | 42.3× | 0.090 | ACOXL |
| Cytokine Signaling in Immune system | 3 | 4.5× | 0.100 | IRF4, ITGAM, ITGAX |
| Neutrophil degranulation | 4 | 3.4× | 0.100 | HLA-B, ITGAM, ITGAX, PIGR |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 30 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|
| peptide antigen assembly with MHC class II protein complex | 5 | 175.5× | 1e-08 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1 |
| antigen processing and presentation of exogenous peptide antigen via MHC class II | 5 | 90.6× | 2e-07 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1 |
| positive regulation of immune response | 5 | 80.2× | 3e-07 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1 |
| positive regulation of T cell activation | 5 | 73.9× | 3e-07 | HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1 |
| immune response | 8 | 12.6× | 7e-06 | TNFSF13, FCRL3, HLA-A, HLA-B, HLA-DPA1, HLA-DQA1, HLA-DQB1, HLA-DRB1 |
| antigen processing and presentation of endogenous peptide antigen via MHC class I | 3 | 210.7× | 1e-05 | TAP1, TAP2, HLA-A |
| positive regulation of T cell mediated cytotoxicity | 4 | 68.1× | 1e-05 | TAP2, HLA-A, HLA-B, HLA-DRB1 |
| detection of bacterium | 3 | 140.4× | 3e-05 | HLA-A, HLA-B, HLA-DRB1 |
| adaptive immune response | 6 | 16.9× | 3e-05 | TAP1, HLA-B, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1 |
| antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent | 2 | 561.7× | 6e-05 | TAP2, HLA-A |
| cytosol to endoplasmic reticulum transport | 2 | 561.7× | 6e-05 | TAP1, TAP2 |
| regulation of T-helper cell differentiation | 2 | 280.9× | 3e-04 | HLA-DRB1, IRF4 |
| protection from natural killer cell mediated cytotoxicity | 2 | 187.2× | 7e-04 | HLA-A, HLA-B |
| T cell receptor signaling pathway | 4 | 20.2× | 7e-04 | HLA-A, HLA-DPB1, HLA-DQB1, HLA-DRB1 |
| positive regulation of B cell proliferation | 3 | 34.4× | 0.001 | TNFSF13, VAV3, FCRL3 |
| antigen processing and presentation of endogenous peptide antigen via MHC class Ib | 2 | 86.4× | 0.003 | HLA-A, HLA-B |
| antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-independent | 2 | 86.4× | 0.003 | HLA-A, HLA-B |
| T cell mediated cytotoxicity | 2 | 74.9× | 0.004 | TAP2, HLA-A |
| positive regulation of type II interferon production | 3 | 22.5× | 0.004 | HLA-A, HLA-DPA1, HLA-DPB1 |
| integrin-mediated signaling pathway | 3 | 16.1× | 0.009 | VAV3, ITGAM, ITGAX |
| complement activation | 2 | 41.6× | 0.011 | CFHR3, CFHR1 |
| heterotypic cell-cell adhesion | 2 | 38.7× | 0.012 | ITGAM, ITGAX |
| antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent | 1 | 561.7× | 0.016 | TAP2 |
| regulation of interleukin-4 production | 1 | 561.7× | 0.016 | HLA-DRB1 |
| regulation of toll-like receptor 9 signaling pathway | 1 | 561.7× | 0.016 | FCRL3 |
| immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor | 1 | 280.9× | 0.022 | PIGR |
| antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent | 1 | 280.9× | 0.022 | TAP2 |
| antigen processing and presentation of endogenous peptide antigen via MHC class II | 1 | 280.9× | 0.022 | HLA-DRB1 |
| regulation of interleukin-10 production | 1 | 280.9× | 0.022 | HLA-DRB1 |
| regulation of interleukin-2 production | 1 | 280.9× | 0.022 | CARD9 |
Therapeutics
Drugs indicated for this disease
2 approved, 19 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
Earlier-phase candidates (phase 2, investigational — efficacy not yet established): Avacopan, Batiraxcept, Cemdisiran, Enalapril, Felzartamab, Fostamatinib, Hydroxychloroquine, OMEGA-3-ACID ETHYL ESTERS, Sirolimus, Tacrolimus Anhydrous.
Drug target analysis
Approved (phase 4): 5 · Phase ≥3: 5 · Phased (≥1): 7 · Undrugged: 26
Druggability breadth: 18 of 33 evidence-associated genes (55%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|
| KLF10 | TOLCAPONE |
| PADI4 | CHLORTETRACYCLINE |
| HLA-A | RALOXIFENE HYDROCHLORIDE |
| PSMB8 | BORTEZOMIB |
| PSMB9 | BORTEZOMIB |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|
| HLA-A | 8 | 4 |
| PSMB8 | 7 | 4 |
| PSMB9 | 7 | 4 |
| PADI4 | 3 | 4 |
| KLF10 | 2 | 4 |
| PADI3 | 1 | 2 |
| PADI1 | 1 | 2 |
| ST6GAL1 | 0 | 0 |
| TNFSF13 | 0 | 0 |
| VAV3 | 0 | 0 |
Drugs targeting cohort genes (top 30)
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 7.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|
| PSMB8 | 262 | Binding:250, ADMET:9, Functional:3 |
| PSMB9 | 220 | Binding:210, ADMET:7, Functional:3 |
| PADI4 | 86 | Binding:84, Functional:2 |
| PADI1 | 29 | Binding:28, Functional:1 |
| ST6GAL1 | 27 | Binding:27 |
| PADI3 | 27 | Binding:27 |
| HLA-DRB1 | 17 | Binding:17 |
| ITGAM | 14 | Binding:12, Functional:2 |
| KLF10 | 10 | Binding:10 |
| TAP1 | 4 | Binding:4 |
| HLA-A | 4 | Binding:4 |
| TAP2 | 3 | Binding:3 |
| IRF4 | 3 | Binding:3 |
| HLA-DQA1 | 2 | Binding:2 |
| HLA-B | 1 | Binding:1 |
| MPDU1 | 1 | Binding:1 |
| PIGR | 1 | Binding:1 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|
| ST6GAL1 | 2.4.99.1 | beta-galactoside alpha-(2,6)-sialyltransferase |
| PADI3 | 3.5.3.15 | protein-arginine deiminase |
| PADI1 | 3.5.3.15 | protein-arginine deiminase |
| PADI4 | 3.5.3.15 | protein-arginine deiminase |
| TAP1 | 7.4.2.14, 7.4.2.5 | ABC-type antigen peptide transporter, bacterial ABC-type protein transporter |
| TAP2 | 7.4.2.14, 7.4.2.5 | ABC-type antigen peptide transporter, bacterial ABC-type protein transporter |
| MTMR3 | 3.1.3.95 | phosphatidylinositol-3,5-bisphosphate 3-phosphatase |
Cohort genes with high screening signal
≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.
| Symbol | ChEMBL assays |
|---|
| PSMB8 | 262 |
| PSMB9 | 220 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 33; with CPIC/DPWG dosing guidelines: 2.
Cohort genes with a CPIC/DPWG dosing guideline
| Symbol | CPIC guidelines |
|---|
| HLA-A | 1 |
| HLA-B | 1 |
Chemical tractability of cohort targets
19 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
| Compound | Max phase | Cohort target (bioactivity) |
|---|
| TOLCAPONE | 4 | KLF10 |
| ATOMOXETINE | 4 | KLF10 |
| CHLORTETRACYCLINE | 4 | PADI4 |
| RALOXIFENE HYDROCHLORIDE | 4 | HLA-A |
| DOXAZOSIN MESYLATE | 4 | HLA-A |
| TRAZODONE HYDROCHLORIDE | 4 | HLA-A |
| ASTEMIZOLE | 4 | HLA-A |
| CARFILZOMIB | 4 | PSMB8, PSMB9 |
| VATALANIB | 3 | HLA-A |
| IXAZOMIB | 3 | PSMB8, PSMB9 |
| MARIZOMIB | 3 | PSMB8, PSMB9 |
| STREPTONIGRIN | 2 | PADI1, PADI3, PADI4 |
| PAPAVERINE HYDROCHLORIDE | 2 | PADI4 |
| DISOMOTIDE | 2 | HLA-A |
| OVEMOTIDE | 2 | HLA-A |
| SPIPERONE | 2 | HLA-A |
| OPROZOMIB | 2 | PSMB8, PSMB9 |
| DELANZOMIB | 2 | PSMB8, PSMB9 |
| ZETOMIPZOMIB | 2 | PSMB8, PSMB9 |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|
| A | Approved (phase 4 drug) | 5 | KLF10, PADI4, HLA-A, PSMB8, PSMB9 |
| B | Phased (≥1) drug, not yet approved | 2 | PADI3, PADI1 |
| C | Druggable family + PDB, no drug | 13 | ST6GAL1, TAP1, TAP2, CFHR1, HLA-B, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1 (+3 more) |
| D | Druggable family + AlphaFold only, no drug | 3 | CFHR3, FCRL3, MTMR3 |
| E | Difficult family or no structure, no drug | 10 | TNFSF13, VAV3, CARD9, ACCS, ACOXL, HORMAD2, HLA-DPB2, IRF4, MPDU1, ODF1 |
Undrugged target profiles
26 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|
| TAP1 | 4 | PSMB9, PSMB8 |
| TAP2 | 3 | PSMB9, PSMB8 |
| ST6GAL1 | 27 | — |
| TNFSF13 | 0 | — |
| VAV3 | 0 | — |
| CARD9 | 0 | — |
| CFHR3 | 0 | — |
| FCRL3 | 0 | — |
| ACCS | 0 | — |
| ACOXL | 0 | — |
| HORMAD2 | 0 | — |
| CFHR1 | 0 | — |
| HLA-B | 1 | — |
| HLA-DPA1 | 0 | — |
| HLA-DPB1 | 0 | — |
| HLA-DPB2 | 0 | — |
| HLA-DQA1 | 2 | — |
| HLA-DQB1 | 0 | — |
| HLA-DRB1 | 17 | — |
| IRF4 | 3 | — |
| ITGAM | 14 | — |
| ITGAX | 0 | — |
| MPDU1 | 1 | — |
| MTMR3 | 0 | — |
| ODF1 | 0 | — |
| PIGR | 1 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 173.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|
| Not specified | 53 |
| PHASE2 | 44 |
| PHASE3 | 29 |
| PHASE4 | 24 |
| PHASE1 | 10 |
| EARLY_PHASE1 | 7 |
| PHASE2/PHASE3 | 3 |
| PHASE1/PHASE2 | 3 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|
| NCT06676384 | PHASE4 | RECRUITING | Which of the Commonly Available and Approved Drugs in Addition to Standard of Care Can Significantly Improve the Slope of Estimated Glomerular Filtration Rate at Two Years When Compared to Standard of Care Alone in South-Asian Kidney Biopsy-proven Adult (≥18 Years) Primary IgA Nephropathy? |
| NCT06712407 | PHASE4 | RECRUITING | Efficacy and Safety of Extended TARPEYO® Treatment Beyond 9 Months in Adult Patients With Primary IgA Nephropathy |
| NCT07030894 | PHASE4 | RECRUITING | Nefecon and Ambrisentan in IgA Nephropathy |
| NCT07604311 | PHASE4 | NOT_YET_RECRUITING | Efficacy and Safety of Nefecon on Prevention of Relapse of IgA Nephropathy: a Randomized, Double-blinded, Placebo-Controlled Trial |
| NCT00319761 | PHASE4 | COMPLETED | Calcitriol in the Treatment of Immunoglobulin A (IgA) Nephropathy |
| NCT00367562 | PHASE4 | COMPLETED | Inhibition of the Renin Angiotensin System Plus Corticosteroids for the Treatment of Proteinuria in IGA Nephropathy |
| NCT00426348 | PHASE4 | COMPLETED | A Study of the Antioxidant Probucol Combined With Valsartan in Patients With IgA Nephropathy |
| NCT00498368 | PHASE4 | COMPLETED | Rituximab in Progressive Immunoglobulin A (IgA) Nephropathy |
| NCT00755859 | PHASE4 | COMPLETED | Steroids and Azathioprine Versus Steroids Alone in IgAN |
| NCT00863252 | PHASE4 | COMPLETED | Mycophenolate Mofetil for IgA Nephropathy |
| NCT00922311 | PHASE4 | COMPLETED | Aliskiren for Proteinuric IgAN Despite Angiotensin Blockade |
| NCT01103778 | PHASE4 | COMPLETED | Pilot Study of Velcade® in IgA Nephropathy |
| NCT01115426 | PHASE4 | COMPLETED | Inhibitors of Angiotensin II in Proteinuric Mesangioproliferative Glomerulonephritis |
| NCT01129557 | PHASE4 | TERMINATED | Aldosterone Breakthrough During Diovan, Tekturna, and Combination Therapy in Patients With Proteinuric Kidney Disease |
| NCT01758120 | PHASE4 | UNKNOWN | Treatment of Prednisone Plus Cyclophosphamide in Patients With Advanced-stage IgA Nephropathy |
| NCT02231125 | PHASE4 | UNKNOWN | Efficacy and Safety of Abelmoschus Manihot for IgA Nephropathy |
| NCT02351752 | PHASE4 | COMPLETED | Hydroxychloroquine Sulfate for Reduction of Proteinuria in Patients With IgA Nephropathy: a Self- Controlled Study |
| NCT02382523 | PHASE4 | WITHDRAWN | Acthar on Proteinuria in IgA Nephropathy Patients |
| NCT02571842 | PHASE4 | UNKNOWN | Rituximab in Recurrent IgA Nephropathy |
| NCT02765594 | PHASE4 | UNKNOWN | Hydroxychloroquine Sulfate Alleviates Persistent Proteinuria in IgA Nephropathy |
| NCT02981212 | PHASE4 | UNKNOWN | Efficacy and Safety of a Combination of Mycophenolate Mofetil and Corticosteroid in Advanced IgA Nephropathy |
| NCT03218852 | PHASE4 | UNKNOWN | Extended Follow-up of Treatment of Prednisone Plus Cyclophosphamide in Patients With Advanced-stage IgA Nephropathy |
| NCT04525729 | PHASE4 | COMPLETED | Rituximab and RASi in Patients with IgAN |
| NCT05824390 | PHASE4 | UNKNOWN | A Randomized, Controlled Clinical Study of Rituximab in Treatment of Primary IgA Nephropathy |
| NCT04557462 | PHASE3 | RECRUITING | A Rollover Extension Program (REP) to Evaluate the Long-term Safety and Tolerability of Open Label Iptacopan/LNP023 in Participants With Primary IgA Nephropathy |
| NCT04573478 | PHASE3 | ACTIVE_NOT_RECRUITING | Atrasentan in Patients With IgA Nephropathy |
| NCT04716231 | PHASE3 | ACTIVE_NOT_RECRUITING | Atacicept in Subjects With IgA Nephropathy |
| NCT05596708 | PHASE2/PHASE3 | NOT_YET_RECRUITING | Study of Telitacicept in Patients With Refractory IgA Nephropathy |
| NCT05797610 | PHASE3 | RECRUITING | A Study to Evaluate the Efficacy and Safety of Sefaxersen (RO7434656) in Participants With Primary Immunoglobulin A (IgA) Nephropathy at High Risk of Progression |
| NCT05799287 | PHASE3 | ACTIVE_NOT_RECRUITING | A Study of Telitacicept for IgA Nephropathy (TELIGAN) |
| NCT05852938 | PHASE3 | ACTIVE_NOT_RECRUITING | A Study of Zigakibart in Adults With IgA Nephropathy |
| NCT06580288 | PHASE3 | NOT_YET_RECRUITING | Effect of Finerenone in IgA Nephropathy |
| NCT06819826 | PHASE3 | RECRUITING | A Study of SC0062 Capsule for the Treatment of IgA Nephropathy with Proteinuria |
| NCT07014826 | PHASE3 | RECRUITING | A Trial of HRS-5965 Capsule in Primary IgA Nephropathy |
| NCT07052981 | PHASE3 | NOT_YET_RECRUITING | Clinical Study on the Efficacy and Safety of Telitacicept in the Treatment of Pediatric IgA Nephropathy or IgA Vasculitis Nephritis |
| NCT07098897 | PHASE3 | ACTIVE_NOT_RECRUITING | To Evaluate the Effect and Safety of Telitacicept and Standard Treatment for 6months in IgA Nephropathy |
| NCT07390123 | PHASE3 | RECRUITING | Phase Ⅲ Study of Efficacy and Safety of HSK39297 Tablet in Treatment of Patients With Primary IgAN |
| NCT07498335 | PHASE3 | NOT_YET_RECRUITING | Study to Assess the Efficacy, Pharmacokinetics, Safety and Tolerability of Atrasentan in Pediatric Patients With Primary IgAN |
| NCT00318474 | PHASE3 | TERMINATED | Mycophenolate Mofetil (MMF) in Patients With IgA Nephropathy |
| NCT00549692 | PHASE3 | COMPLETED | Efficacy and Safety of Omega-3 Fatty Acids(Omacor®) for the Treatment of Immunoglobulin A Nephropathy |
Drugs tested across these trials (top 30)
- Cohort genes: ST6GAL1, KLF10, TNFSF13, VAV3, CARD9, CFHR3, PADI3, PADI1, PADI4, FCRL3, ACCS, ACOXL, HORMAD2, TAP1, TAP2, CFHR1, HLA-A, HLA-B, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1, IRF4, ITGAM, ITGAX, MPDU1, MTMR3, ODF1, PIGR, PSMB8, PSMB9
- Drugs: Hydroxychloroquine, Rituximab, Aliskiren, Cyclophosphamide, Enalapril, Finerenone, Iptacopan, Valsartan, Calcitriol, Fostamatinib, Losartan, Mycophenolate Mofetil, Prednisone, Allopurinol, Ambrisentan, Avacopan, Azathioprine, Bortezomib, Corticotropin, Dipyridamole, Irbesartan, Paricalcitol, Pegcetacoplan, Probucol, Rasagiline, Sparsentan, Telitacicept, Atrasentan, Atacicept, Blisibimod