Melanoma and neural system tumor syndrome

Summary

Melanoma and neural system tumor syndrome (MONDO:0007967) is a cancer with 1 cohort gene (1 CIViC-evidence somatic driver; 137 ClinVar predisposition records).

At a glance

• Classification: Cancer
• Prevalence: <1 / 1 000 000 (Worldwide) [Orphanet-validated]
• Cohort genes: 1
• ClinVar variants: 137

Clinical features

Epidemiology

Prevalence records

2 prevalence record(s), Orphanet:

Type	Class	Value	Geography	Validation
Cases/families		49	Worldwide	Validated
Point prevalence	<1 / 1 000 000		Worldwide	Validated

Identifiers

Disease identifiers

Field	Value
Canonical name	melanoma and neural system tumor syndrome
Mondo ID	MONDO:0007967
MeSH	C536149
OMIM	155755
Orphanet	252206
DOID	DOID:0111511
NCIT	C176905
SNOMED CT	717968005
UMLS	C1835042
MedGen	331890
GARD	0008468
Is cancer (heuristic)	yes

Also known as: melanoma and neural system tumor syndrome · melanoma astrocytoma syndrome · melanoma-astrocytoma syndrome

Data availability: 137 ClinVar variants · 1 GenCC gene-disease record.

Disease family

Classification path: disease › human disease › disease by etiologic mechanism › disease of genetic or genomic mechanism › hereditary disease › hereditary neoplastic syndrome › melanoma and neural system tumor syndrome

Related subtypes (116): mosaic variegated aneuploidy syndrome, tuberous sclerosis, hereditary breast ovarian cancer syndrome, hereditary multiple osteochondromas, nevoid basal cell carcinoma syndrome, leukemia, chronic lymphocytic, susceptibility to, 2, blue rubber bleb nevus, cherubism, Beckwith-Wiedemann syndrome, multiple self-healing squamous epithelioma, erythroleukemia, familial, susceptibility to, goiter, multinodular 1, with or without Sertoli-Leydig cell tumors, hyperparathyroidism 2 with jaw tumors, Kaposi sarcoma, susceptibility to, hereditary leiomyomatosis and renal cell cancer, susceptibility to uveal melanoma, nasopharyngeal carcinoma, susceptibility to, 2, WAGR syndrome, neuroblastoma, susceptibility to, 1, Rothmund-Thomson syndrome, mismatch repair cancer syndrome 1, Wiskott-Aldrich syndrome, N syndrome, hereditary thrombocytopenia and hematologic cancer predisposition syndrome, prostate cancer/brain cancer susceptibility, Brooke-Spiegler syndrome, pancreatic cancer, susceptibility to, 1, Carney-Stratakis syndrome, nasopharyngeal carcinoma, susceptibility to, 1, ovarian cancer, susceptibility to, 1, colorectal cancer, susceptibility to, 1, lung cancer susceptibility 1, leukemia, chronic lymphocytic, susceptibility to, 1, Kostmann syndrome, colorectal cancer, susceptibility to, 2, colorectal cancer, susceptibility to, 3, colorectal cancer, susceptibility to, 5, colorectal cancer, susceptibility to, 6, colorectal cancer, susceptibility to, 7, leukemia, chronic lymphocytic, susceptibility to, 3, leukemia, chronic lymphocytic, susceptibility to, 4, leukemia, chronic lymphocytic, susceptibility to, 5, lung cancer susceptibility 3, colorectal cancer, susceptibility to, 8, colorectal cancer, susceptibility to, 9, colorectal cancer, susceptibility to, 10, colorectal cancer, susceptibility to, 11, lung cancer susceptibility 4, neuroblastoma, susceptibility to, 3, neuroblastoma, susceptibility to, 4, neuroblastoma, susceptibility to, 5, neuroblastoma, susceptibility to, 6, leukemia, acute lymphocytic, susceptibility to, 1, leukemia, acute lymphocytic, susceptibility to, 2, lung cancer susceptibility 5, BAP1-related tumor predisposition syndrome, familial cutaneous telangiectasia and oropharyngeal predisposition cancer syndrome, Maffucci syndrome, basal cell carcinoma, susceptibility to, 7, colorectal cancer, susceptibility to, 12, leukemia, acute lymphoblastic, susceptibility to, 3, cholangiocarcinoma, susceptibility to, progeroid features-hepatocellular carcinoma predisposition syndrome, neuroblastoma, susceptibility to, 7, DDX41-related hematologic malignancy predisposition syndrome, nasopharyngeal carcinoma, susceptibility to, 3, familial isolated hyperparathyroidism, intestinal polyposis syndrome, dyskeratosis congenita, familial rhabdoid tumor, multiple endocrine neoplasia, hereditary pheochromocytoma-paraganglioma, PTEN hamartoma tumor syndrome, familial multiple fibrofolliculoma, hereditary retinoblastoma, familial atypical multiple mole melanoma syndrome, hereditary nonpolyposis colon cancer, Li-Fraumeni syndrome, Cobb syndrome, neurofibromatosis, susceptibility to familial cutaneous melanoma, pancreatic cancer, susceptibility to, 5, leukemia, acute myeloid, susceptibility to, diffuse gastric and lobular breast cancer syndrome with or without cleft lip and/or palate, glioma susceptibility, hemangioma, capillary infantile, susceptibility to, CDH1-related diffuse gastric and lobular breast cancer syndrome, NTHL1-deficiency tumor predisposition syndrome, SAMD9-related spectrum and myeloid neoplasm risk, neuroblastoma, susceptibility to, 2, BARD1-related cancer predisposition, BRCA1-related cancer predisposition, BRCA2-related cancer predisposition, ATM-related cancer predisposition, CHEK2-related cancer predisposition, PALB2-related cancer predisposition, RAD51C-related cancer predisposition, RAD51D-related cancer predisposition, Li-fraumeni-like syndrome, breast cancer, familial, susceptibility to, 1, breast cancer, familial, susceptibility to, 2, breast cancer, familial, susceptibility to, 3, colorectal cancer, susceptibility to, 4, colorectal cancer, susceptibility to, on chromosome 15, ovarian cancer, familial, susceptibility to, 1, ovarian cancer, familial, susceptibility to, 2, ovarian cancer, familial, susceptibility to, 3, inherited hematologic cancer-predisposing syndrome, mosaic neurofibromatosis/schwannomatosis, tumor predisposition syndrome 2, prostate cancer, hereditary, X-linked 3, follicular lymphoma, susceptibility to, GPR161-related medulloblastoma predisposition, SAMD9L-related spectrum and myeloid neoplasm risk, HAVCR2-related cancer predisposition, EGLN1-related erythrocytosis and pheochromocytoma/paraganglioma predisposition

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

137 retrieved; paginated sample, class counts are floors:

80 uncertain significance, 22 conflicting classifications of pathogenicity, 15 pathogenic/likely pathogenic, 10 pathogenic, 6 likely pathogenic, 4 benign/likely benign

ClinVar	Variant (HGVS)	Gene	Classification	Review
135827	NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
142882	NM_000077.5(CDKN2A):c.251A>C (p.Asp84Ala)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
182411	NM_000077.5(CDKN2A):c.225_243del (p.Ala76fs)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
182414	NM_058195.4(CDKN2A):c.194-3653G>T	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
183759	NM_000077.5(CDKN2A):c.335_337dup (p.Arg112dup)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
216035	NM_000077.5(CDKN2A):c.457G>T (p.Asp153Tyr)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
220711	NM_000077.5(CDKN2A):c.148C>T (p.Gln50Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
229824	NM_000077.5(CDKN2A):c.212del (p.Asn71fs)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
232304	NM_000077.5(CDKN2A):c.149A>G (p.Gln50Arg)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
233484	NM_000077.5(CDKN2A):c.334C>G (p.Arg112Gly)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
236984	NM_000077.5(CDKN2A):c.260G>C (p.Arg87Pro)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
406715	NM_000077.5(CDKN2A):c.458-105A>G	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
430217	NM_000077.5(CDKN2A):c.146T>G (p.Ile49Ser)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
463512	NM_000077.5(CDKN2A):c.79G>T (p.Glu27Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
483336	NM_000077.5(CDKN2A):c.131dup (p.Tyr44Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
532294	NM_000077.5(CDKN2A):c.159G>A (p.Met53Ile)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
573002	NM_000077.5(CDKN2A):c.359_360dup (p.Leu121fs)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
825010	NM_000077.5(CDKN2A):c.457+1_457+10del	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
870835	NM_058195.4(CDKN2A):c.102G>A (p.Trp34Ter)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
9412	NM_000077.5(CDKN2A):c.301G>T (p.Gly101Trp)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
9414	NM_000077.5(CDKN2A):c.159G>C (p.Met53Ile)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
9415	NM_000077.5(CDKN2A):c.71G>C (p.Arg24Pro)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
9419	NC_000009.12:g.21977568_21999392del	CDKN2A	Pathogenic	no assertion criteria provided
9420	NM_000077.5(CDKN2A):c.377T>A (p.Val126Asp)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
9423	NM_000077.5(CDKN2A):c.176T>G (p.Val59Gly)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
2680554	NM_000077.5(CDKN2A):c.182_185dup (p.Leu63fs)	CDKN2A	Likely pathogenic	criteria provided, single submitter
2680555	NM_000077.5(CDKN2A):c.225_243dup (p.Val82fs)	CDKN2A	Likely pathogenic	criteria provided, single submitter
406707	NM_000077.5(CDKN2A):c.259C>T (p.Arg87Trp)	CDKN2A	Likely pathogenic	criteria provided, multiple submitters, no conflicts
429108	NM_000077.5(CDKN2A):c.67G>A (p.Gly23Ser)	CDKN2A	Likely pathogenic	criteria provided, multiple submitters, no conflicts
429109	NM_000077.5(CDKN2A):c.67G>T (p.Gly23Cys)	CDKN2A	Likely pathogenic	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 7 · Orphanet: 8 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

Somatic driver evidence (intOGen + CIViC, cohort fanout)

Gene	intOGen role	Cancer types	CIViC
CDKN2A	LoF	ACYC,BLCA,BRCA,CHOL,COAD,COADREAD,CSCC,EGC,ESCA,ESCC,GBM,HCC,HNSC,LGGNOS,LUAD,LUSC,MEL,MLYM,NPC,NSCLC,OS,PAAD,PANCREAS,RCC,SKCM,SKIN,STAD,STOMACH,WDTC	CIViC #14

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
CDKN2A	Definitive	Autosomal dominant	melanoma-pancreatic cancer syndrome	7

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
CDKN2A	Orphanet:1333	Familial pancreatic carcinoma
CDKN2A	Orphanet:1501	Adrenocortical carcinoma
CDKN2A	Orphanet:252206	Melanoma and neural system tumor syndrome
CDKN2A	Orphanet:404560	Familial atypical multiple mole melanoma syndrome
CDKN2A	Orphanet:524	Li-Fraumeni syndrome
CDKN2A	Orphanet:585909	B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2)
CDKN2A	Orphanet:618	Familial melanoma
CDKN2A	Orphanet:99861	Precursor T-cell acute lymphoblastic leukemia

Cohort genes → proteins

1 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
CDKN2A	HGNC:1787	ENSG00000147889	P42771	Cyclin-dependent kinase inhibitor 2A	gencc,clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
CDKN2A	Cyclin-dependent kinase inhibitor 2A	Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6.

Protein-family classification

Druggable: 0 · Difficult: 1 · Unknown: 0 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Scaffold/PPI	1	17.3×	0.058

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
CDKN2A	Scaffold/PPI	no		Ankyrin_rpt-contain_sf, Ank_Repeat/CDKN_Inhibitor, Tumor_suppres_ARF

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	1
unknown	0

Top tissues across cohort

Tissue	Cohort genes
cervix squamous epithelium	1
parotid gland	1
pituitary gland	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
CDKN2A	220	ubiquitous	marker	parotid gland, cervix squamous epithelium, pituitary gland

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
CDKN2A	9,311

Structural data

PDB: 1 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
CDKN2A	P42771	5

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 58. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Evasion of Oncogene Induced Senescence Due to p14ARF Defects	1	11420.0×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects	1	11420.0×	0.001	CDKN2A
Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4	1	5710.0×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4	1	5710.0×	0.001	CDKN2A
Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function	1	5710.0×	0.001	CDKN2A
Diseases of Cellular Senescence	1	3806.7×	0.001	CDKN2A
Evasion of Oncogene Induced Senescence Due to p16INK4A Defects	1	3806.7×	0.001	CDKN2A
Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6	1	3806.7×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to p16INK4A Defects	1	3806.7×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6	1	3806.7×	0.001	CDKN2A
Diseases of cellular response to stress	1	3806.7×	0.001	CDKN2A
RUNX3 regulates p14-ARF	1	1142.0×	0.004	CDKN2A
Apoptotic factor-mediated response	1	878.5×	0.005	CDKN2A
Stabilization of p53	1	761.3×	0.005	CDKN2A
Defective Intrinsic Pathway for Apoptosis	1	761.3×	0.005	CDKN2A
p53-Dependent G1 DNA Damage Response	1	713.8×	0.005	CDKN2A
p53-Dependent G1/S DNA damage checkpoint	1	713.8×	0.005	CDKN2A
G1/S DNA Damage Checkpoints	1	671.8×	0.005	CDKN2A
Diseases of programmed cell death	1	634.4×	0.005	CDKN2A
SUMOylation of transcription factors	1	571.0×	0.005	CDKN2A
Regulation of MITF-M-dependent genes involved in cell cycle and proliferation	1	571.0×	0.005	CDKN2A
Regulation of TP53 Expression and Degradation	1	519.1×	0.005	CDKN2A
G1 Phase	1	393.8×	0.006	CDKN2A
Oncogene Induced Senescence	1	335.9×	0.007	CDKN2A
Nuclear events mediated by NFE2L2	1	335.9×	0.007	CDKN2A
Intrinsic Pathway for Apoptosis	1	292.8×	0.007	CDKN2A
Regulation of TP53 Degradation	1	292.8×	0.007	CDKN2A
Transcriptional regulation by RUNX3	1	271.9×	0.008	CDKN2A
Transcriptional Regulation by VENTX	1	265.6×	0.008	CDKN2A
Cyclin D associated events in G1	1	233.1×	0.008	CDKN2A

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
nuclear body organization	1	8426.0×	0.002	CDKN2A
apoptotic process involved in mammary gland involution	1	5617.3×	0.002	CDKN2A
positive regulation of macrophage apoptotic process	1	5617.3×	0.002	CDKN2A
positive regulation of apoptotic process involved in mammary gland involution	1	4213.0×	0.002	CDKN2A
obsolete negative regulation of proteolysis involved in protein catabolic process	1	4213.0×	0.002	CDKN2A
negative regulation of mammary gland epithelial cell proliferation	1	3370.4×	0.002	CDKN2A
negative regulation of immature T cell proliferation in thymus	1	2808.7×	0.002	CDKN2A
positive regulation of smooth muscle cell apoptotic process	1	2407.4×	0.002	CDKN2A
mitochondrial depolarization	1	2407.4×	0.002	CDKN2A
oncogene-induced cell senescence	1	2407.4×	0.002	CDKN2A
negative regulation of cyclin-dependent protein serine/threonine kinase activity	1	2106.5×	0.002	CDKN2A
obsolete regulation of protein targeting to mitochondrion	1	2106.5×	0.002	CDKN2A
regulation of nucleocytoplasmic transport	1	1872.4×	0.002	CDKN2A
mammary gland epithelial cell proliferation	1	1532.0×	0.002	CDKN2A
regulation of protein export from nucleus	1	1532.0×	0.002	CDKN2A
somatic stem cell division	1	1532.0×	0.002	CDKN2A
protein localization to nucleolus	1	1532.0×	0.002	CDKN2A
positive regulation of protein sumoylation	1	1296.3×	0.002	CDKN2A
positive regulation of signal transduction by p53 class mediator	1	1203.7×	0.002	CDKN2A
rRNA transcription	1	991.3×	0.002	CDKN2A
positive regulation of DNA damage response, signal transduction by p53 class mediator	1	991.3×	0.002	CDKN2A
replicative senescence	1	991.3×	0.002	CDKN2A
negative regulation of B cell proliferation	1	936.2×	0.002	CDKN2A
negative regulation of cell-matrix adhesion	1	887.0×	0.002	CDKN2A
negative regulation of ubiquitin-dependent protein catabolic process	1	842.6×	0.003	CDKN2A
autophagy of mitochondrion	1	732.7×	0.003	CDKN2A
amyloid fibril formation	1	601.9×	0.003	CDKN2A
keratinocyte proliferation	1	581.1×	0.003	CDKN2A
positive regulation of protein localization to nucleus	1	391.9×	0.005	CDKN2A
protein localization to nucleus	1	351.1×	0.005	CDKN2A

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1

Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
CDKN2A	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
CDKN2A	2	Binding:2

Pharmacogenomics

Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Drug repurposing candidates

0 approved/phased drugs hit cohort targets but don’t yet appear in disease-level clinical trials. Target-inhibition rationale is strongest for cancer driver genes; a bioactivity hit is a screening signal, not a treatment claim.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	1	CDKN2A

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
CDKN2A	2	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.