Melanoma, cutaneous malignant, susceptibility to, 2
diseaseOn this page
Also known as Atypical Mole syndromeB-K Mole syndromeCMM2dysplastic nevus syndromefamilial dysplastic nevimelanoma, cutaneous malignant, 2melanoma, cutaneous malignant, susceptibility to, type 2
Summary
Melanoma, cutaneous malignant, susceptibility to, 2 (MONDO:0007964) is a cancer caused by CDKN2A (GenCC Definitive), with 1 cohort gene (1 CIViC-evidence somatic driver; 68 ClinVar predisposition records) and 4 clinical trials.
At a glance
- Classification: Cancer
- Causal gene: CDKN2A (GenCC Definitive)
- Cohort genes: 1
- ClinVar variants: 68
- Clinical trials: 4
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | melanoma, cutaneous malignant, susceptibility to, 2 |
| Mondo ID | MONDO:0007964 |
| MeSH | D004416 |
| OMIM | 155601 |
| DOID | DOID:10041 |
| NCIT | C7584 |
| UMLS | C1835044 |
| MedGen | 331891 |
| GARD | 0027783 |
| Is cancer (heuristic) | yes |
Also known as: Atypical Mole syndrome · B-K Mole syndrome · CMM2 · dysplastic nevus syndrome · familial dysplastic nevi · melanoma, cutaneous malignant, 2 · melanoma, cutaneous malignant, susceptibility to, 2 · melanoma, cutaneous malignant, susceptibility to, type 2
Data availability: 68 ClinVar variants · 1 GenCC gene-disease record.
Disease family
Classification path: disease › human disease › disease by etiologic mechanism › disease of genetic or genomic mechanism › hereditary disease › autosomal genetic disease › autosomal dominant disease › melanoma, cutaneous malignant, susceptibility to, 2
Related subtypes (191): autosomal dominant polycystic liver disease, cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1, tuberous sclerosis, Treacher-Collins syndrome, hereditary breast ovarian cancer syndrome, autosomal dominant polycystic kidney disease, Lynch syndrome, branchio-oto-renal syndrome, autosomal dominant Aarskog syndrome, acroosteolysis dominant type, ADULT syndrome, autosomal dominant Alport syndrome, amelogenesis imperfecta type 1B, Townes-Brocks syndrome, nevoid basal cell carcinoma syndrome, blepharophimosis, ptosis, and epicanthus inversus syndrome, autosomal dominant brachyolmia, branchiooculofacial syndrome, pheochromocytoma/paraganglioma syndrome 4, cataract-aberrant oral frenula-growth delay syndrome, cherubism, autosomal dominant chondrodysplasia punctata, autosomal dominant popliteal pterygium syndrome, blepharocheilodontic syndrome, cochleosaccular degeneration-cataract syndrome, renal coloboma syndrome, Beare-Stevenson cutis gyrata syndrome, autosomal dominant vibratory urticaria, neurohypophyseal diabetes insipidus, autosomal dominant Kenny-Caffey syndrome, Rapp-Hodgkin syndrome, Ehlers-Danlos syndrome, classic type, autosomal dominant Ehlers-Danlos syndrome, vascular type, multiple endocrine neoplasia type 1, Coffin-Siris syndrome 1, isolated congenital adermatoglyphia, Flynn-Aird syndrome, Frasier syndrome, hand-foot-genital syndrome, Holt-Oram syndrome, hyperkeratosis-hyperpigmentation syndrome, autosomal dominant ichthyosis vulgaris, hyper-IgE recurrent infection syndrome 1, autosomal dominant, autosomal dominant keratitis, autosomal dominant keratitis-ichthyosis-hearing loss syndrome, LADD syndrome, trichorhinophalangeal syndrome type II, Noonan syndrome with multiple lentigines, microcephaly with or without chorioretinopathy, lymphedema, or intellectual disability, Marfan syndrome, autosomal dominant primary microcephaly, autosomal dominant progressive external ophthalmoplegia, monilethrix, Muir-Torre syndrome, autosomal dominant myoglobinuria, autosomal dominant centronuclear myopathy, nail-patella syndrome, multiple endocrine neoplasia type 2B, autosomal dominant omodysplasia, pheochromocytoma/paraganglioma syndrome 1, Pelger-Huet anomaly, multiple endocrine neoplasia type 2A, piebaldism, autosomal dominant medullary cystic kidney disease with or without hyperuricemia, generalized juvenile polyposis/juvenile polyposis coli, juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Peutz-Jeghers syndrome, contractures, pterygia, and spondylocarpotarsal fusion syndrome 1A, autosomal dominant distal renal tubular acidosis, retinoschisis, autosomal dominant, autosomal dominant Robinow syndrome, scapuloperoneal spinal muscular atrophy, autosomal dominant, autosomal dominant sideroblastic anemia, spondyloepiphyseal dysplasia tarda, autosomal dominant, proximal symphalangism, calcaneonavicular coalition, thanatophoric dysplasia type 1, trichorhinophalangeal syndrome type I, Muckle-Wells syndrome, autosomal dominant hypophosphatemic rickets, von Hippel-Lindau disease, Denys-Drash syndrome, autosomal dominant severe congenital neutropenia, Costello syndrome, EEC syndrome, multiple cutaneous and mucosal venous malformations, diffuse nonepidermolytic palmoplantar keratoderma, Timothy syndrome, pheochromocytoma/paraganglioma syndrome 2, spondyloepimetaphyseal dysplasia with multiple dislocations, Brooke-Spiegler syndrome, macrocephaly-autism syndrome, pheochromocytoma/paraganglioma syndrome 3, Duane-radial ray syndrome, PCWH syndrome, heart-hand syndrome, Slovenian type, congenital stationary night blindness autosomal dominant 3, mandibulofacial dysostosis-microcephaly syndrome, multiple endocrine neoplasia type 4, juvenile cataract-microcornea-renal glucosuria syndrome, Crouzon syndrome-acanthosis nigricans syndrome, Birk-Barel syndrome, thrombophilia due to protein S deficiency, autosomal dominant, dyskeratosis congenita, autosomal dominant 2, dyskeratosis congenita, autosomal dominant 3, colorectal cancer, hereditary nonpolyposis, type 6, colorectal cancer, hereditary nonpolyposis, type 7, brain small vessel disease 2A, autosomal dominant, intellectual disability, autosomal dominant 14, intellectual disability, autosomal dominant 15, intellectual disability, autosomal dominant 16, hypopigmentation-punctate palmoplantar keratoderma syndrome, intellectual disability-facial dysmorphism syndrome due to SETD5 haploinsufficiency, postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome, intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, intellectual disability, autosomal dominant 29, intellectual disability, autosomal dominant 30, Houge-Janssens syndrome 2, severe achondroplasia-developmental delay-acanthosis nigricans syndrome, dyskeratosis congenita, autosomal dominant 6, epidermolysis bullosa simplex 6, generalized, with scarring and hair loss, autosomal dominant complex spastic paraplegia, early-onset autosomal dominant Alzheimer disease, muscular dystrophy, limb-girdle, autosomal dominant, Feingold syndrome, Carney complex, neuronopathy, distal hereditary motor, autosomal dominant, autosomal dominant coarctation of aorta, autosomal dominant spondylocostal dysostosis, autosomal dominant hypohidrotic ectodermal dysplasia, Cowden disease, autosomal dominant distal myopathy, autosomal dominant rhegmatogenous retinal detachment, palmoplantar keratoderma-spastic paralysis syndrome, Alagille syndrome due to a JAG1 point mutation, PTEN hamartoma tumor syndrome, gastric adenocarcinoma and proximal polyposis of the stomach, autosomal dominant proximal renal tubular acidosis, autosomal dominant spastic ataxia, Waardenburg syndrome, hereditary retinoblastoma, autosomal dominant hypocalcemia, Li-Fraumeni syndrome, Loeys-Dietz syndrome, hereditary hemorrhagic telangiectasia, hereditary inclusion body myopathy-joint contractures-ophthalmoplegia syndrome, microcephalic osteodysplastic dysplasia, Saul-Wilson type, autosomal dominant intermediate Charcot-Marie-Tooth disease, autosomal dominant cutis laxa, autosomal dominant nonsyndromic hearing loss, autosomal dominant optic atrophy, autosomal dominant Emery-Dreifuss muscular dystrophy, autosomal dominant cerebellar ataxia, autosomal dominant osteopetrosis, autosomal dominant epidermolytic ichthyosis, ventricular arrhythmias due to cardiac ryanodine receptor calcium release deficiency syndrome, distal arthrogryposis type 2B1, neurofibromatosis, autosomal dominant cataract, arthrogryposis, distal, type 2B2, arthrogryposis, distal, type 2B3, Charcot-Marie-Tooth disease, demyelinating, type 1G, Delpire-McNeill syndrome, LAMA5-related multisystemic syndrome, autosomal dominant oculocutaneous albinism, Charcot-Marie-tooth disease, axonal, type 2DD, Pilarowski-Bjornsson syndrome, intellectual disability, autosomal dominant, fatty acyl-CoA reductase 1 upregulation, GUCY2D-related dominant retinopathy, RPE65-related dominant retinopathy, autosomal dominant titinopathy, NOG-related symphalangism spectrum disorder, ALPL-related autosomal dominant hypophosphatasia, MYH10-related neurodevelopmental disorder with congenital anomalies, spastic paraplegia 30A, autosomal dominant, TMEM127-related tumor predisposition, MAX-related tumor predisposition, BMPR1A-related juvenile polyposis syndrome, RP1-related dominant retinopathy, Birt-Hogg-Dube syndrome, inclusion body myopathy and brain white matter abnormalities, KINSSHIP syndrome, autosomal dominant nebulin-related myopathy, IMPG1-related dominant retinopathy, PROM1-related dominant retinopathy, PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome, ALG8-related autosomal dominant polycystic kidney and/or liver disease, NOTCH1-related AOS spectrum disorder, FLNB-associated autosomal dominant filamin related bone disorder, familial antiphospholipid syndrome
Genetics & variants
GWAS landscape
No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.
Variant details and genetic-evidence tiers
ClinVar germline variants
68 retrieved; paginated sample, class counts are floors:
28 uncertain significance, 10 conflicting classifications of pathogenicity, 9 pathogenic/likely pathogenic, 7 benign/likely benign, 7 pathogenic, 2 benign, 2 likely pathogenic, 2 risk factor, 1 pathogenic; risk factor
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 135827 | NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 182414 | NM_058195.4(CDKN2A):c.194-3653G>T | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 219815 | NM_000077.5(CDKN2A):c.47T>G (p.Leu16Arg) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 236984 | NM_000077.5(CDKN2A):c.260G>C (p.Arg87Pro) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 3236468 | NM_000077.5(CDKN2A):c.83_100del (p.Val28_Glu33del) | CDKN2A | Pathogenic | criteria provided, single submitter |
| 406708 | NM_058195.4(CDKN2A):c.193+1G>A | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 406715 | NM_000077.5(CDKN2A):c.458-105A>G | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 483336 | NM_000077.5(CDKN2A):c.131dup (p.Tyr44Ter) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 9409 | NM_000077.5(CDKN2A):c.238C>T (p.Arg80Ter) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 9410 | NM_000077.5(CDKN2A):c.226_244del (p.Ala76fs) | CDKN2A | Pathogenic; risk factor | no assertion criteria provided |
| 9412 | NM_000077.5(CDKN2A):c.301G>T (p.Gly101Trp) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 9414 | NM_000077.5(CDKN2A):c.159G>C (p.Met53Ile) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 9415 | NM_000077.5(CDKN2A):c.71G>C (p.Arg24Pro) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 9420 | NM_000077.5(CDKN2A):c.377T>A (p.Val126Asp) | CDKN2A | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 9423 | NM_000077.5(CDKN2A):c.176T>G (p.Val59Gly) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 9425 | NM_000077.5(CDKN2A):c.167G>T (p.Ser56Ile) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 9426 | NM_000077.5(CDKN2A):c.266G>A (p.Gly89Asp) | CDKN2A | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 4820087 | NM_000077.5(CDKN2A):c.99_150+1161del | CDKN2A | Likely pathogenic | criteria provided, single submitter |
| 491572 | NM_000077.5(CDKN2A):c.296G>C (p.Arg99Pro) | CDKN2A | Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 9411 | CDKN2A, 6-BP DEL, NT363 | CDKN2A | risk factor | no assertion criteria provided |
| 9413 | NM_058195.4(CDKN2A):c.184AGA[3] (p.Arg63_Pro64insArg) | CDKN2A | risk factor | no assertion criteria provided |
| 127523 | NM_000077.5(CDKN2A):c.146T>C (p.Ile49Thr) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 141111 | NM_000077.5(CDKN2A):c.122C>A (p.Pro41Gln) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 182419 | NM_000077.5(CDKN2A):c.365G>T (p.Gly122Val) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 186615 | NM_000077.5(CDKN2A):c.206A>G (p.Glu69Gly) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 2631850 | NM_000077.5(CDKN2A):c.151-1104C>G | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 41577 | NM_000077.5(CDKN2A):c.373G>C (p.Asp125His) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 463515 | NM_000077.5(CDKN2A):c.294C>T (p.His98=) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 567122 | NM_058195.4(CDKN2A):c.40G>A (p.Ala14Thr) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 9424 | NM_000077.5(CDKN2A):c.339_340delinsCT (p.Pro114Ser) | CDKN2A | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 7 · Orphanet: 8 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Somatic driver evidence (intOGen + CIViC, cohort fanout)
| Gene | intOGen role | Cancer types | CIViC |
|---|---|---|---|
| CDKN2A | LoF | ACYC,BLCA,BRCA,CHOL,COAD,COADREAD,CSCC,EGC,ESCA,ESCC,GBM,HCC,HNSC,LGGNOS,LUAD,LUSC,MEL,MLYM,NPC,NSCLC,OS,PAAD,PANCREAS,RCC,SKCM,SKIN,STAD,STOMACH,WDTC | CIViC #14 |
GenCC gene–disease validity (cohort genes)
the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.
| Gene | Classification | Inheritance | Disease | Records |
|---|---|---|---|---|
| CDKN2A | Definitive | Autosomal dominant | melanoma-pancreatic cancer syndrome | 7 |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| CDKN2A | Orphanet:1333 | Familial pancreatic carcinoma |
| CDKN2A | Orphanet:1501 | Adrenocortical carcinoma |
| CDKN2A | Orphanet:252206 | Melanoma and neural system tumor syndrome |
| CDKN2A | Orphanet:404560 | Familial atypical multiple mole melanoma syndrome |
| CDKN2A | Orphanet:524 | Li-Fraumeni syndrome |
| CDKN2A | Orphanet:585909 | B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2) |
| CDKN2A | Orphanet:618 | Familial melanoma |
| CDKN2A | Orphanet:99861 | Precursor T-cell acute lymphoblastic leukemia |
Cohort genes → proteins
1 cohort genes, 1 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| CDKN2A | HGNC:1787 | ENSG00000147889 | P42771 | Cyclin-dependent kinase inhibitor 2A | gencc,clinvar |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| CDKN2A | Cyclin-dependent kinase inhibitor 2A | Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. |
Protein-family classification
Druggable: 0 · Difficult: 1 · Unknown: 0 · Druggable fraction: 0.0
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Scaffold/PPI | 1 | 17.3× | 0.058 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| CDKN2A | Scaffold/PPI | no | Ankyrin_rpt-contain_sf, Ank_Repeat/CDKN_Inhibitor, Tumor_suppres_ARF |
Expression context
Cohort genes with no expression data: 0.
1 cohort gene are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 1 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| cervix squamous epithelium | 1 |
| parotid gland | 1 |
| pituitary gland | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| CDKN2A | 220 | ubiquitous | marker | parotid gland, cervix squamous epithelium, pituitary gland |
Protein interactions among cohort
Intra-cohort edges: 0.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| CDKN2A | 9,311 |
Structural data
PDB: 1 · AlphaFold-only: 0 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| CDKN2A | P42771 | 5 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 58. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Evasion of Oncogene Induced Senescence Due to p14ARF Defects | 1 | 11420.0× | 0.001 | CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects | 1 | 11420.0× | 0.001 | CDKN2A |
| Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 | 1 | 5710.0× | 0.001 | CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 | 1 | 5710.0× | 0.001 | CDKN2A |
| Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function | 1 | 5710.0× | 0.001 | CDKN2A |
| Diseases of Cellular Senescence | 1 | 3806.7× | 0.001 | CDKN2A |
| Evasion of Oncogene Induced Senescence Due to p16INK4A Defects | 1 | 3806.7× | 0.001 | CDKN2A |
| Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 | 1 | 3806.7× | 0.001 | CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to p16INK4A Defects | 1 | 3806.7× | 0.001 | CDKN2A |
| Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6 | 1 | 3806.7× | 0.001 | CDKN2A |
| Diseases of cellular response to stress | 1 | 3806.7× | 0.001 | CDKN2A |
| RUNX3 regulates p14-ARF | 1 | 1142.0× | 0.004 | CDKN2A |
| Apoptotic factor-mediated response | 1 | 878.5× | 0.005 | CDKN2A |
| Stabilization of p53 | 1 | 761.3× | 0.005 | CDKN2A |
| Defective Intrinsic Pathway for Apoptosis | 1 | 761.3× | 0.005 | CDKN2A |
| p53-Dependent G1 DNA Damage Response | 1 | 713.8× | 0.005 | CDKN2A |
| p53-Dependent G1/S DNA damage checkpoint | 1 | 713.8× | 0.005 | CDKN2A |
| G1/S DNA Damage Checkpoints | 1 | 671.8× | 0.005 | CDKN2A |
| Diseases of programmed cell death | 1 | 634.4× | 0.005 | CDKN2A |
| SUMOylation of transcription factors | 1 | 571.0× | 0.005 | CDKN2A |
| Regulation of MITF-M-dependent genes involved in cell cycle and proliferation | 1 | 571.0× | 0.005 | CDKN2A |
| Regulation of TP53 Expression and Degradation | 1 | 519.1× | 0.005 | CDKN2A |
| G1 Phase | 1 | 393.8× | 0.006 | CDKN2A |
| Oncogene Induced Senescence | 1 | 335.9× | 0.007 | CDKN2A |
| Nuclear events mediated by NFE2L2 | 1 | 335.9× | 0.007 | CDKN2A |
| Intrinsic Pathway for Apoptosis | 1 | 292.8× | 0.007 | CDKN2A |
| Regulation of TP53 Degradation | 1 | 292.8× | 0.007 | CDKN2A |
| Transcriptional regulation by RUNX3 | 1 | 271.9× | 0.008 | CDKN2A |
| Transcriptional Regulation by VENTX | 1 | 265.6× | 0.008 | CDKN2A |
| Cyclin D associated events in G1 | 1 | 233.1× | 0.008 | CDKN2A |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| nuclear body organization | 1 | 8426.0× | 0.002 | CDKN2A |
| apoptotic process involved in mammary gland involution | 1 | 5617.3× | 0.002 | CDKN2A |
| positive regulation of macrophage apoptotic process | 1 | 5617.3× | 0.002 | CDKN2A |
| positive regulation of apoptotic process involved in mammary gland involution | 1 | 4213.0× | 0.002 | CDKN2A |
| obsolete negative regulation of proteolysis involved in protein catabolic process | 1 | 4213.0× | 0.002 | CDKN2A |
| negative regulation of mammary gland epithelial cell proliferation | 1 | 3370.4× | 0.002 | CDKN2A |
| negative regulation of immature T cell proliferation in thymus | 1 | 2808.7× | 0.002 | CDKN2A |
| positive regulation of smooth muscle cell apoptotic process | 1 | 2407.4× | 0.002 | CDKN2A |
| mitochondrial depolarization | 1 | 2407.4× | 0.002 | CDKN2A |
| oncogene-induced cell senescence | 1 | 2407.4× | 0.002 | CDKN2A |
| negative regulation of cyclin-dependent protein serine/threonine kinase activity | 1 | 2106.5× | 0.002 | CDKN2A |
| obsolete regulation of protein targeting to mitochondrion | 1 | 2106.5× | 0.002 | CDKN2A |
| regulation of nucleocytoplasmic transport | 1 | 1872.4× | 0.002 | CDKN2A |
| mammary gland epithelial cell proliferation | 1 | 1532.0× | 0.002 | CDKN2A |
| regulation of protein export from nucleus | 1 | 1532.0× | 0.002 | CDKN2A |
| somatic stem cell division | 1 | 1532.0× | 0.002 | CDKN2A |
| protein localization to nucleolus | 1 | 1532.0× | 0.002 | CDKN2A |
| positive regulation of protein sumoylation | 1 | 1296.3× | 0.002 | CDKN2A |
| positive regulation of signal transduction by p53 class mediator | 1 | 1203.7× | 0.002 | CDKN2A |
| rRNA transcription | 1 | 991.3× | 0.002 | CDKN2A |
| positive regulation of DNA damage response, signal transduction by p53 class mediator | 1 | 991.3× | 0.002 | CDKN2A |
| replicative senescence | 1 | 991.3× | 0.002 | CDKN2A |
| negative regulation of B cell proliferation | 1 | 936.2× | 0.002 | CDKN2A |
| negative regulation of cell-matrix adhesion | 1 | 887.0× | 0.002 | CDKN2A |
| negative regulation of ubiquitin-dependent protein catabolic process | 1 | 842.6× | 0.003 | CDKN2A |
| autophagy of mitochondrion | 1 | 732.7× | 0.003 | CDKN2A |
| amyloid fibril formation | 1 | 601.9× | 0.003 | CDKN2A |
| keratinocyte proliferation | 1 | 581.1× | 0.003 | CDKN2A |
| positive regulation of protein localization to nucleus | 1 | 391.9× | 0.005 | CDKN2A |
| protein localization to nucleus | 1 | 351.1× | 0.005 | CDKN2A |
Therapeutics
Drug target analysis
Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1
Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| CDKN2A | 0 | 0 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 0.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| CDKN2A | 2 | Binding:2 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Drug repurposing candidates
0 approved/phased drugs hit cohort targets but don’t yet appear in disease-level clinical trials. Target-inhibition rationale is strongest for cancer driver genes; a bioactivity hit is a screening signal, not a treatment claim.
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 0 | |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 0 | |
| D | Druggable family + AlphaFold only, no drug | 0 | |
| E | Difficult family or no structure, no drug | 1 | CDKN2A |
Undrugged target profiles
1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| CDKN2A | 2 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 4.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| Not specified | 3 |
| PHASE1/PHASE2 | 1 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT00346502 | PHASE1/PHASE2 | WITHDRAWN | Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia) |
| NCT00040352 | Not specified | RECRUITING | Clinical, Laboratory, and Epidemiologic Characterization of Individuals and Families at High Risk of Melanoma |
| NCT04353050 | Not specified | UNKNOWN | Atypical MOLes and Melanoma Early Detection Study (MoleMed) |
| NCT04688749 | Not specified | TERMINATED | Use of Electrical Impedance Spectroscopy (EIS) for Early Diagnosis of Skin Damage |
Related Atlas pages
- Cohort genes: CDKN2A