Melanoma, cutaneous malignant, susceptibility to, 2

Summary

Melanoma, cutaneous malignant, susceptibility to, 2 (MONDO:0007964) is a cancer caused by CDKN2A (GenCC Definitive), with 1 cohort gene (1 CIViC-evidence somatic driver; 68 ClinVar predisposition records) and 4 clinical trials.

At a glance

• Classification: Cancer
• Causal gene: CDKN2A (GenCC Definitive)
• Cohort genes: 1
• ClinVar variants: 68
• Clinical trials: 4

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	melanoma, cutaneous malignant, susceptibility to, 2
Mondo ID	MONDO:0007964
MeSH	D004416
OMIM	155601
DOID	DOID:10041
NCIT	C7584
UMLS	C1835044
MedGen	331891
GARD	0027783
Is cancer (heuristic)	yes

Also known as: Atypical Mole syndrome · B-K Mole syndrome · CMM2 · dysplastic nevus syndrome · familial dysplastic nevi · melanoma, cutaneous malignant, 2 · melanoma, cutaneous malignant, susceptibility to, 2 · melanoma, cutaneous malignant, susceptibility to, type 2

Data availability: 68 ClinVar variants · 1 GenCC gene-disease record.

Disease family

Classification path: disease › human disease › disease by etiologic mechanism › disease of genetic or genomic mechanism › hereditary disease › autosomal genetic disease › autosomal dominant disease › melanoma, cutaneous malignant, susceptibility to, 2

Related subtypes (191): autosomal dominant polycystic liver disease, cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1, tuberous sclerosis, Treacher-Collins syndrome, hereditary breast ovarian cancer syndrome, autosomal dominant polycystic kidney disease, Lynch syndrome, branchio-oto-renal syndrome, autosomal dominant Aarskog syndrome, acroosteolysis dominant type, ADULT syndrome, autosomal dominant Alport syndrome, amelogenesis imperfecta type 1B, Townes-Brocks syndrome, nevoid basal cell carcinoma syndrome, blepharophimosis, ptosis, and epicanthus inversus syndrome, autosomal dominant brachyolmia, branchiooculofacial syndrome, pheochromocytoma/paraganglioma syndrome 4, cataract-aberrant oral frenula-growth delay syndrome, cherubism, autosomal dominant chondrodysplasia punctata, autosomal dominant popliteal pterygium syndrome, blepharocheilodontic syndrome, cochleosaccular degeneration-cataract syndrome, renal coloboma syndrome, Beare-Stevenson cutis gyrata syndrome, autosomal dominant vibratory urticaria, neurohypophyseal diabetes insipidus, autosomal dominant Kenny-Caffey syndrome, Rapp-Hodgkin syndrome, Ehlers-Danlos syndrome, classic type, autosomal dominant Ehlers-Danlos syndrome, vascular type, multiple endocrine neoplasia type 1, Coffin-Siris syndrome 1, isolated congenital adermatoglyphia, Flynn-Aird syndrome, Frasier syndrome, hand-foot-genital syndrome, Holt-Oram syndrome, hyperkeratosis-hyperpigmentation syndrome, autosomal dominant ichthyosis vulgaris, hyper-IgE recurrent infection syndrome 1, autosomal dominant, autosomal dominant keratitis, autosomal dominant keratitis-ichthyosis-hearing loss syndrome, LADD syndrome, trichorhinophalangeal syndrome type II, Noonan syndrome with multiple lentigines, microcephaly with or without chorioretinopathy, lymphedema, or intellectual disability, Marfan syndrome, autosomal dominant primary microcephaly, autosomal dominant progressive external ophthalmoplegia, monilethrix, Muir-Torre syndrome, autosomal dominant myoglobinuria, autosomal dominant centronuclear myopathy, nail-patella syndrome, multiple endocrine neoplasia type 2B, autosomal dominant omodysplasia, pheochromocytoma/paraganglioma syndrome 1, Pelger-Huet anomaly, multiple endocrine neoplasia type 2A, piebaldism, autosomal dominant medullary cystic kidney disease with or without hyperuricemia, generalized juvenile polyposis/juvenile polyposis coli, juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Peutz-Jeghers syndrome, contractures, pterygia, and spondylocarpotarsal fusion syndrome 1A, autosomal dominant distal renal tubular acidosis, retinoschisis, autosomal dominant, autosomal dominant Robinow syndrome, scapuloperoneal spinal muscular atrophy, autosomal dominant, autosomal dominant sideroblastic anemia, spondyloepiphyseal dysplasia tarda, autosomal dominant, proximal symphalangism, calcaneonavicular coalition, thanatophoric dysplasia type 1, trichorhinophalangeal syndrome type I, Muckle-Wells syndrome, autosomal dominant hypophosphatemic rickets, von Hippel-Lindau disease, Denys-Drash syndrome, autosomal dominant severe congenital neutropenia, Costello syndrome, EEC syndrome, multiple cutaneous and mucosal venous malformations, diffuse nonepidermolytic palmoplantar keratoderma, Timothy syndrome, pheochromocytoma/paraganglioma syndrome 2, spondyloepimetaphyseal dysplasia with multiple dislocations, Brooke-Spiegler syndrome, macrocephaly-autism syndrome, pheochromocytoma/paraganglioma syndrome 3, Duane-radial ray syndrome, PCWH syndrome, heart-hand syndrome, Slovenian type, congenital stationary night blindness autosomal dominant 3, mandibulofacial dysostosis-microcephaly syndrome, multiple endocrine neoplasia type 4, juvenile cataract-microcornea-renal glucosuria syndrome, Crouzon syndrome-acanthosis nigricans syndrome, Birk-Barel syndrome, thrombophilia due to protein S deficiency, autosomal dominant, dyskeratosis congenita, autosomal dominant 2, dyskeratosis congenita, autosomal dominant 3, colorectal cancer, hereditary nonpolyposis, type 6, colorectal cancer, hereditary nonpolyposis, type 7, brain small vessel disease 2A, autosomal dominant, intellectual disability, autosomal dominant 14, intellectual disability, autosomal dominant 15, intellectual disability, autosomal dominant 16, hypopigmentation-punctate palmoplantar keratoderma syndrome, intellectual disability-facial dysmorphism syndrome due to SETD5 haploinsufficiency, postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome, intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, intellectual disability, autosomal dominant 29, intellectual disability, autosomal dominant 30, Houge-Janssens syndrome 2, severe achondroplasia-developmental delay-acanthosis nigricans syndrome, dyskeratosis congenita, autosomal dominant 6, epidermolysis bullosa simplex 6, generalized, with scarring and hair loss, autosomal dominant complex spastic paraplegia, early-onset autosomal dominant Alzheimer disease, muscular dystrophy, limb-girdle, autosomal dominant, Feingold syndrome, Carney complex, neuronopathy, distal hereditary motor, autosomal dominant, autosomal dominant coarctation of aorta, autosomal dominant spondylocostal dysostosis, autosomal dominant hypohidrotic ectodermal dysplasia, Cowden disease, autosomal dominant distal myopathy, autosomal dominant rhegmatogenous retinal detachment, palmoplantar keratoderma-spastic paralysis syndrome, Alagille syndrome due to a JAG1 point mutation, PTEN hamartoma tumor syndrome, gastric adenocarcinoma and proximal polyposis of the stomach, autosomal dominant proximal renal tubular acidosis, autosomal dominant spastic ataxia, Waardenburg syndrome, hereditary retinoblastoma, autosomal dominant hypocalcemia, Li-Fraumeni syndrome, Loeys-Dietz syndrome, hereditary hemorrhagic telangiectasia, hereditary inclusion body myopathy-joint contractures-ophthalmoplegia syndrome, microcephalic osteodysplastic dysplasia, Saul-Wilson type, autosomal dominant intermediate Charcot-Marie-Tooth disease, autosomal dominant cutis laxa, autosomal dominant nonsyndromic hearing loss, autosomal dominant optic atrophy, autosomal dominant Emery-Dreifuss muscular dystrophy, autosomal dominant cerebellar ataxia, autosomal dominant osteopetrosis, autosomal dominant epidermolytic ichthyosis, ventricular arrhythmias due to cardiac ryanodine receptor calcium release deficiency syndrome, distal arthrogryposis type 2B1, neurofibromatosis, autosomal dominant cataract, arthrogryposis, distal, type 2B2, arthrogryposis, distal, type 2B3, Charcot-Marie-Tooth disease, demyelinating, type 1G, Delpire-McNeill syndrome, LAMA5-related multisystemic syndrome, autosomal dominant oculocutaneous albinism, Charcot-Marie-tooth disease, axonal, type 2DD, Pilarowski-Bjornsson syndrome, intellectual disability, autosomal dominant, fatty acyl-CoA reductase 1 upregulation, GUCY2D-related dominant retinopathy, RPE65-related dominant retinopathy, autosomal dominant titinopathy, NOG-related symphalangism spectrum disorder, ALPL-related autosomal dominant hypophosphatasia, MYH10-related neurodevelopmental disorder with congenital anomalies, spastic paraplegia 30A, autosomal dominant, TMEM127-related tumor predisposition, MAX-related tumor predisposition, BMPR1A-related juvenile polyposis syndrome, RP1-related dominant retinopathy, Birt-Hogg-Dube syndrome, inclusion body myopathy and brain white matter abnormalities, KINSSHIP syndrome, autosomal dominant nebulin-related myopathy, IMPG1-related dominant retinopathy, PROM1-related dominant retinopathy, PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome, ALG8-related autosomal dominant polycystic kidney and/or liver disease, NOTCH1-related AOS spectrum disorder, FLNB-associated autosomal dominant filamin related bone disorder, familial antiphospholipid syndrome

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

68 retrieved; paginated sample, class counts are floors:

28 uncertain significance, 10 conflicting classifications of pathogenicity, 9 pathogenic/likely pathogenic, 7 benign/likely benign, 7 pathogenic, 2 benign, 2 likely pathogenic, 2 risk factor, 1 pathogenic; risk factor

ClinVar	Variant (HGVS)	Gene	Classification	Review
135827	NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
182414	NM_058195.4(CDKN2A):c.194-3653G>T	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
219815	NM_000077.5(CDKN2A):c.47T>G (p.Leu16Arg)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
236984	NM_000077.5(CDKN2A):c.260G>C (p.Arg87Pro)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
3236468	NM_000077.5(CDKN2A):c.83_100del (p.Val28_Glu33del)	CDKN2A	Pathogenic	criteria provided, single submitter
406708	NM_058195.4(CDKN2A):c.193+1G>A	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
406715	NM_000077.5(CDKN2A):c.458-105A>G	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
483336	NM_000077.5(CDKN2A):c.131dup (p.Tyr44Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
9409	NM_000077.5(CDKN2A):c.238C>T (p.Arg80Ter)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
9410	NM_000077.5(CDKN2A):c.226_244del (p.Ala76fs)	CDKN2A	Pathogenic; risk factor	no assertion criteria provided
9412	NM_000077.5(CDKN2A):c.301G>T (p.Gly101Trp)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
9414	NM_000077.5(CDKN2A):c.159G>C (p.Met53Ile)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
9415	NM_000077.5(CDKN2A):c.71G>C (p.Arg24Pro)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
9420	NM_000077.5(CDKN2A):c.377T>A (p.Val126Asp)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
9423	NM_000077.5(CDKN2A):c.176T>G (p.Val59Gly)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
9425	NM_000077.5(CDKN2A):c.167G>T (p.Ser56Ile)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
9426	NM_000077.5(CDKN2A):c.266G>A (p.Gly89Asp)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
4820087	NM_000077.5(CDKN2A):c.99_150+1161del	CDKN2A	Likely pathogenic	criteria provided, single submitter
491572	NM_000077.5(CDKN2A):c.296G>C (p.Arg99Pro)	CDKN2A	Likely pathogenic	criteria provided, multiple submitters, no conflicts
9411	CDKN2A, 6-BP DEL, NT363	CDKN2A	risk factor	no assertion criteria provided
9413	NM_058195.4(CDKN2A):c.184AGA[3] (p.Arg63_Pro64insArg)	CDKN2A	risk factor	no assertion criteria provided
127523	NM_000077.5(CDKN2A):c.146T>C (p.Ile49Thr)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
141111	NM_000077.5(CDKN2A):c.122C>A (p.Pro41Gln)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
182419	NM_000077.5(CDKN2A):c.365G>T (p.Gly122Val)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
186615	NM_000077.5(CDKN2A):c.206A>G (p.Glu69Gly)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
2631850	NM_000077.5(CDKN2A):c.151-1104C>G	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
41577	NM_000077.5(CDKN2A):c.373G>C (p.Asp125His)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
463515	NM_000077.5(CDKN2A):c.294C>T (p.His98=)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
567122	NM_058195.4(CDKN2A):c.40G>A (p.Ala14Thr)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
9424	NM_000077.5(CDKN2A):c.339_340delinsCT (p.Pro114Ser)	CDKN2A	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 7 · Orphanet: 8 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

Somatic driver evidence (intOGen + CIViC, cohort fanout)

Gene	intOGen role	Cancer types	CIViC
CDKN2A	LoF	ACYC,BLCA,BRCA,CHOL,COAD,COADREAD,CSCC,EGC,ESCA,ESCC,GBM,HCC,HNSC,LGGNOS,LUAD,LUSC,MEL,MLYM,NPC,NSCLC,OS,PAAD,PANCREAS,RCC,SKCM,SKIN,STAD,STOMACH,WDTC	CIViC #14

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
CDKN2A	Definitive	Autosomal dominant	melanoma-pancreatic cancer syndrome	7

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
CDKN2A	Orphanet:1333	Familial pancreatic carcinoma
CDKN2A	Orphanet:1501	Adrenocortical carcinoma
CDKN2A	Orphanet:252206	Melanoma and neural system tumor syndrome
CDKN2A	Orphanet:404560	Familial atypical multiple mole melanoma syndrome
CDKN2A	Orphanet:524	Li-Fraumeni syndrome
CDKN2A	Orphanet:585909	B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2)
CDKN2A	Orphanet:618	Familial melanoma
CDKN2A	Orphanet:99861	Precursor T-cell acute lymphoblastic leukemia

Cohort genes → proteins

1 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
CDKN2A	HGNC:1787	ENSG00000147889	P42771	Cyclin-dependent kinase inhibitor 2A	gencc,clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
CDKN2A	Cyclin-dependent kinase inhibitor 2A	Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6.

Protein-family classification

Druggable: 0 · Difficult: 1 · Unknown: 0 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Scaffold/PPI	1	17.3×	0.058

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
CDKN2A	Scaffold/PPI	no		Ankyrin_rpt-contain_sf, Ank_Repeat/CDKN_Inhibitor, Tumor_suppres_ARF

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	1
unknown	0

Top tissues across cohort

Tissue	Cohort genes
cervix squamous epithelium	1
parotid gland	1
pituitary gland	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
CDKN2A	220	ubiquitous	marker	parotid gland, cervix squamous epithelium, pituitary gland

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
CDKN2A	9,311

Structural data

PDB: 1 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
CDKN2A	P42771	5

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 58. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Evasion of Oncogene Induced Senescence Due to p14ARF Defects	1	11420.0×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects	1	11420.0×	0.001	CDKN2A
Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4	1	5710.0×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4	1	5710.0×	0.001	CDKN2A
Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function	1	5710.0×	0.001	CDKN2A
Diseases of Cellular Senescence	1	3806.7×	0.001	CDKN2A
Evasion of Oncogene Induced Senescence Due to p16INK4A Defects	1	3806.7×	0.001	CDKN2A
Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6	1	3806.7×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to p16INK4A Defects	1	3806.7×	0.001	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6	1	3806.7×	0.001	CDKN2A
Diseases of cellular response to stress	1	3806.7×	0.001	CDKN2A
RUNX3 regulates p14-ARF	1	1142.0×	0.004	CDKN2A
Apoptotic factor-mediated response	1	878.5×	0.005	CDKN2A
Stabilization of p53	1	761.3×	0.005	CDKN2A
Defective Intrinsic Pathway for Apoptosis	1	761.3×	0.005	CDKN2A
p53-Dependent G1 DNA Damage Response	1	713.8×	0.005	CDKN2A
p53-Dependent G1/S DNA damage checkpoint	1	713.8×	0.005	CDKN2A
G1/S DNA Damage Checkpoints	1	671.8×	0.005	CDKN2A
Diseases of programmed cell death	1	634.4×	0.005	CDKN2A
SUMOylation of transcription factors	1	571.0×	0.005	CDKN2A
Regulation of MITF-M-dependent genes involved in cell cycle and proliferation	1	571.0×	0.005	CDKN2A
Regulation of TP53 Expression and Degradation	1	519.1×	0.005	CDKN2A
G1 Phase	1	393.8×	0.006	CDKN2A
Oncogene Induced Senescence	1	335.9×	0.007	CDKN2A
Nuclear events mediated by NFE2L2	1	335.9×	0.007	CDKN2A
Intrinsic Pathway for Apoptosis	1	292.8×	0.007	CDKN2A
Regulation of TP53 Degradation	1	292.8×	0.007	CDKN2A
Transcriptional regulation by RUNX3	1	271.9×	0.008	CDKN2A
Transcriptional Regulation by VENTX	1	265.6×	0.008	CDKN2A
Cyclin D associated events in G1	1	233.1×	0.008	CDKN2A

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
nuclear body organization	1	8426.0×	0.002	CDKN2A
apoptotic process involved in mammary gland involution	1	5617.3×	0.002	CDKN2A
positive regulation of macrophage apoptotic process	1	5617.3×	0.002	CDKN2A
positive regulation of apoptotic process involved in mammary gland involution	1	4213.0×	0.002	CDKN2A
obsolete negative regulation of proteolysis involved in protein catabolic process	1	4213.0×	0.002	CDKN2A
negative regulation of mammary gland epithelial cell proliferation	1	3370.4×	0.002	CDKN2A
negative regulation of immature T cell proliferation in thymus	1	2808.7×	0.002	CDKN2A
positive regulation of smooth muscle cell apoptotic process	1	2407.4×	0.002	CDKN2A
mitochondrial depolarization	1	2407.4×	0.002	CDKN2A
oncogene-induced cell senescence	1	2407.4×	0.002	CDKN2A
negative regulation of cyclin-dependent protein serine/threonine kinase activity	1	2106.5×	0.002	CDKN2A
obsolete regulation of protein targeting to mitochondrion	1	2106.5×	0.002	CDKN2A
regulation of nucleocytoplasmic transport	1	1872.4×	0.002	CDKN2A
mammary gland epithelial cell proliferation	1	1532.0×	0.002	CDKN2A
regulation of protein export from nucleus	1	1532.0×	0.002	CDKN2A
somatic stem cell division	1	1532.0×	0.002	CDKN2A
protein localization to nucleolus	1	1532.0×	0.002	CDKN2A
positive regulation of protein sumoylation	1	1296.3×	0.002	CDKN2A
positive regulation of signal transduction by p53 class mediator	1	1203.7×	0.002	CDKN2A
rRNA transcription	1	991.3×	0.002	CDKN2A
positive regulation of DNA damage response, signal transduction by p53 class mediator	1	991.3×	0.002	CDKN2A
replicative senescence	1	991.3×	0.002	CDKN2A
negative regulation of B cell proliferation	1	936.2×	0.002	CDKN2A
negative regulation of cell-matrix adhesion	1	887.0×	0.002	CDKN2A
negative regulation of ubiquitin-dependent protein catabolic process	1	842.6×	0.003	CDKN2A
autophagy of mitochondrion	1	732.7×	0.003	CDKN2A
amyloid fibril formation	1	601.9×	0.003	CDKN2A
keratinocyte proliferation	1	581.1×	0.003	CDKN2A
positive regulation of protein localization to nucleus	1	391.9×	0.005	CDKN2A
protein localization to nucleus	1	351.1×	0.005	CDKN2A

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1

Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
CDKN2A	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
CDKN2A	2	Binding:2

Pharmacogenomics

Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Drug repurposing candidates

0 approved/phased drugs hit cohort targets but don’t yet appear in disease-level clinical trials. Target-inhibition rationale is strongest for cancer driver genes; a bioactivity hit is a screening signal, not a treatment claim.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	1	CDKN2A

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
CDKN2A	2	—

Clinical trials & evidence

Clinical trials

Clinical trials: 4.

Phase distribution (across all retrieved trials)

Phase	Trials
Not specified	3
PHASE1/PHASE2	1

Top trials by phase / activity

NCT	Phase	Status	Title
NCT00346502	PHASE1/PHASE2	WITHDRAWN	Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia)
NCT00040352	Not specified	RECRUITING	Clinical, Laboratory, and Epidemiologic Characterization of Individuals and Families at High Risk of Melanoma
NCT04353050	Not specified	UNKNOWN	Atypical MOLes and Melanoma Early Detection Study (MoleMed)
NCT04688749	Not specified	TERMINATED	Use of Electrical Impedance Spectroscopy (EIS) for Early Diagnosis of Skin Damage