Melanoma-pancreatic cancer syndrome

Summary

Melanoma-pancreatic cancer syndrome (MONDO:0011713) is a cancer caused by CDKN2A (GenCC Definitive), with 2 cohort genes (1 CIViC-evidence somatic driver; 445 ClinVar predisposition records).

At a glance

• Classification: Cancer
• Causal gene: CDKN2A (GenCC Definitive)
• Cohort genes: 2
• ClinVar variants: 445

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	melanoma-pancreatic cancer syndrome
Mondo ID	MONDO:0011713
MeSH	C563985
OMIM	606719
NCIT	C176904
UMLS	C1838547
MedGen	325450
GARD	0018473
Is cancer (heuristic)	yes

Also known as: melanoma-pancreatic cancer syndrome

Data availability: 445 ClinVar variants · 4 GenCC gene-disease records.

Disease family

Classification path: disease › human disease › disease by body system or component › integumentary system disorder › familial atypical multiple mole melanoma syndrome › melanoma-pancreatic cancer syndrome

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

445 retrieved; paginated sample, class counts are floors:

109 benign, 106 benign/likely benign, 76 conflicting classifications of pathogenicity, 48 uncertain significance, 42 likely benign, 32 pathogenic, 16 pathogenic/likely pathogenic, 14 likely pathogenic, 1 drug response, 1 pathogenic; risk factor

ClinVar	Variant (HGVS)	Gene	Classification	Review
1069074	NM_000077.5(CDKN2A):c.126dup (p.Ser43Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
1171238	NM_000077.5(CDKN2A):c.106del (p.Ala36fs)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
135827	NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
142061	NM_000077.5(CDKN2A):c.47_50del (p.Leu16fs)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
1752844	NM_000077.5(CDKN2A):c.122_123delinsT (p.Pro41fs)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
1782299	NM_000077.5(CDKN2A):c.19_22dup (p.Ser8fs)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
182409	NM_000077.5(CDKN2A):c.131_132insAA (p.Tyr44Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
182411	NM_000077.5(CDKN2A):c.225_243del (p.Ala76fs)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
182412	NM_000077.5(CDKN2A):c.240_253del (p.Pro81fs)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
182414	NM_058195.4(CDKN2A):c.194-3653G>T	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
216035	NM_000077.5(CDKN2A):c.457G>T (p.Asp153Tyr)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
219815	NM_000077.5(CDKN2A):c.47T>G (p.Leu16Arg)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
220711	NM_000077.5(CDKN2A):c.148C>T (p.Gln50Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
230421	NM_000077.5(CDKN2A):c.44G>A (p.Trp15Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
232304	NM_000077.5(CDKN2A):c.149A>G (p.Gln50Arg)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
236992	NM_000077.5(CDKN2A):c.95T>C (p.Leu32Pro)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
2431281	NM_000077.5(CDKN2A):c.165C>T (p.Gly55=)	CDKN2A	Pathogenic	criteria provided, single submitter
2449063	NM_000077.5(CDKN2A):c.135dup (p.Arg46fs)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
2573238	NM_058195.4(CDKN2A):c.106del (p.Ala36fs)	CDKN2A	Pathogenic	criteria provided, single submitter
37003	NM_000077.5(CDKN2A):c.19_23dup (p.Ser8fs)	CDKN2A	Pathogenic	no assertion criteria provided
376303	NM_000077.5(CDKN2A):c.330G>A (p.Trp110Ter)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
406708	NM_058195.4(CDKN2A):c.193+1G>A	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
406715	NM_000077.5(CDKN2A):c.458-105A>G	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
4077026	NM_000077.5(CDKN2A):c.128_141dup (p.Pro48fs)	CDKN2A	Pathogenic	criteria provided, single submitter
420108	NM_000077.5(CDKN2A):c.68G>A (p.Gly23Asp)	CDKN2A	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
429111	NM_000077.5(CDKN2A):c.132del (p.Ser43_Tyr44insTer)	CDKN2A	Pathogenic	criteria provided, multiple submitters, no conflicts
4294165	NM_058195.4(CDKN2A):c.169C>T (p.Gln57Ter)	CDKN2A	Pathogenic	criteria provided, single submitter
4294179	NM_058195.4(CDKN2A):c.26_27dup (p.Arg10fs)	CDKN2A	Pathogenic	criteria provided, single submitter
4294202	NM_000077.5(CDKN2A):c.18del (p.Ser7fs)	CDKN2A	Pathogenic	criteria provided, single submitter
4294280	NM_000077.5(CDKN2A):c.68dup (p.Arg24fs)	CDKN2A	Pathogenic	criteria provided, single submitter

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 7 · Orphanet: 14 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

Somatic driver evidence (intOGen + CIViC, cohort fanout)

Gene	intOGen role	Cancer types	CIViC
CDKN2A	LoF	ACYC,BLCA,BRCA,CHOL,COAD,COADREAD,CSCC,EGC,ESCA,ESCC,GBM,HCC,HNSC,LGGNOS,LUAD,LUSC,MEL,MLYM,NPC,NSCLC,OS,PAAD,PANCREAS,RCC,SKCM,SKIN,STAD,STOMACH,WDTC	CIViC #14

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
CDKN2A	Definitive	Autosomal dominant	melanoma-pancreatic cancer syndrome	7

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
CDKN2A	Orphanet:1333	Familial pancreatic carcinoma
CDKN2A	Orphanet:1501	Adrenocortical carcinoma
CDKN2A	Orphanet:252206	Melanoma and neural system tumor syndrome
CDKN2A	Orphanet:404560	Familial atypical multiple mole melanoma syndrome
CDKN2A	Orphanet:524	Li-Fraumeni syndrome
CDKN2A	Orphanet:585909	B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2)
CDKN2A	Orphanet:618	Familial melanoma
CDKN2A	Orphanet:99861	Precursor T-cell acute lymphoblastic leukemia
CFTR	Orphanet:399805	Male infertility with azoospermia or oligozoospermia due to single gene mutation
CFTR	Orphanet:48	Congenital bilateral absence of vas deferens
CFTR	Orphanet:498359	Aquagenic palmoplantar keratoderma
CFTR	Orphanet:586	Cystic fibrosis
CFTR	Orphanet:60033	Idiopathic bronchiectasis
CFTR	Orphanet:700124	Autosomal recessive hereditary chronic pancreatitis

Cohort genes → proteins

2 cohort genes, 2 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	2

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
CDKN2A	HGNC:1787	ENSG00000147889	P42771	Cyclin-dependent kinase inhibitor 2A	gencc,clinvar
CFTR	HGNC:1884	ENSG00000001626	P13569	Cystic fibrosis transmembrane conductance regulator	clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
CDKN2A	Cyclin-dependent kinase inhibitor 2A	Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6.
CFTR	Cystic fibrosis transmembrane conductance regulator	Epithelial ion channel that plays an important role in the regulation of epithelial ion and water transport and fluid homeostasis.

Protein-family classification

Druggable: 1 · Difficult: 1 · Unknown: 0 · Druggable fraction: 0.5

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Transporter	1	38.9×	0.051
Scaffold/PPI	1	8.6×	0.112

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
CDKN2A	Scaffold/PPI	no		Ankyrin_rpt-contain_sf, Ank_Repeat/CDKN_Inhibitor, Tumor_suppres_ARF
CFTR	Transporter	yes	2.7.4.3	ABC_transporter-like_ATP-bd, AAA+_ATPase, CFTR/ABCC7

Expression context

Cohort genes with no expression data: 0.

2 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	2
unknown	0

Top tissues across cohort

Tissue	Cohort genes
cervix squamous epithelium	1
parotid gland	1
pituitary gland	1
body of pancreas	1
gall bladder	1
pancreas	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
CDKN2A	220	ubiquitous	marker	parotid gland, cervix squamous epithelium, pituitary gland
CFTR	193	broad	marker	body of pancreas, gall bladder, pancreas

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
CDKN2A	9,311
CFTR	7,664

Structural data

PDB: 2 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
CFTR	P13569	58
CDKN2A	P42771	5

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 69. Enrichment computed across 2 evidence-associated genes (2 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Evasion of Oncogene Induced Senescence Due to p14ARF Defects	1	5710.0×	0.003	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects	1	5710.0×	0.003	CDKN2A
Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4	1	2855.0×	0.003	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4	1	2855.0×	0.003	CDKN2A
Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function	1	2855.0×	0.003	CDKN2A
RHO GTPases regulate CFTR trafficking	1	1903.3×	0.003	CFTR
Diseases of Cellular Senescence	1	1903.3×	0.003	CDKN2A
Evasion of Oncogene Induced Senescence Due to p16INK4A Defects	1	1903.3×	0.003	CDKN2A
Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6	1	1903.3×	0.003	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to p16INK4A Defects	1	1903.3×	0.003	CDKN2A
Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6	1	1903.3×	0.003	CDKN2A
Diseases of cellular response to stress	1	1903.3×	0.003	CDKN2A
RUNX3 regulates p14-ARF	1	571.0×	0.009	CDKN2A
Apoptotic factor-mediated response	1	439.2×	0.011	CDKN2A
Stabilization of p53	1	380.7×	0.011	CDKN2A
Defective Intrinsic Pathway for Apoptosis	1	380.7×	0.011	CDKN2A
p53-Dependent G1 DNA Damage Response	1	356.9×	0.011	CDKN2A
p53-Dependent G1/S DNA damage checkpoint	1	356.9×	0.011	CDKN2A
G1/S DNA Damage Checkpoints	1	335.9×	0.011	CDKN2A
Diseases of programmed cell death	1	317.2×	0.011	CDKN2A
SUMOylation of transcription factors	1	285.5×	0.011	CDKN2A
Regulation of MITF-M-dependent genes involved in cell cycle and proliferation	1	285.5×	0.011	CDKN2A
Regulation of TP53 Expression and Degradation	1	259.6×	0.012	CDKN2A
Chaperone Mediated Autophagy	1	248.3×	0.012	CFTR
G1 Phase	1	196.9×	0.014	CDKN2A
Oncogene Induced Senescence	1	167.9×	0.015	CDKN2A
Nuclear events mediated by NFE2L2	1	167.9×	0.015	CDKN2A
Late endosomal microautophagy	1	163.1×	0.015	CFTR
Intrinsic Pathway for Apoptosis	1	146.4×	0.016	CDKN2A
Regulation of TP53 Degradation	1	146.4×	0.016	CDKN2A

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
nuclear body organization	1	4213.0×	0.004	CDKN2A
intracellular pH elevation	1	2808.7×	0.004	CFTR
apoptotic process involved in mammary gland involution	1	2808.7×	0.004	CDKN2A
positive regulation of macrophage apoptotic process	1	2808.7×	0.004	CDKN2A
positive regulation of apoptotic process involved in mammary gland involution	1	2106.5×	0.004	CDKN2A
obsolete negative regulation of proteolysis involved in protein catabolic process	1	2106.5×	0.004	CDKN2A
negative regulation of mammary gland epithelial cell proliferation	1	1685.2×	0.004	CDKN2A
transepithelial water transport	1	1685.2×	0.004	CFTR
positive regulation of enamel mineralization	1	1685.2×	0.004	CFTR
negative regulation of immature T cell proliferation in thymus	1	1404.3×	0.004	CDKN2A
positive regulation of smooth muscle cell apoptotic process	1	1203.7×	0.004	CDKN2A
mitochondrial depolarization	1	1203.7×	0.004	CDKN2A
oncogene-induced cell senescence	1	1203.7×	0.004	CDKN2A
negative regulation of cyclin-dependent protein serine/threonine kinase activity	1	1053.2×	0.004	CDKN2A
obsolete regulation of protein targeting to mitochondrion	1	1053.2×	0.004	CDKN2A
regulation of nucleocytoplasmic transport	1	936.2×	0.004	CDKN2A
membrane hyperpolarization	1	936.2×	0.004	CFTR
multicellular organismal-level water homeostasis	1	842.6×	0.004	CFTR
mammary gland epithelial cell proliferation	1	766.0×	0.004	CDKN2A
regulation of protein export from nucleus	1	766.0×	0.004	CDKN2A
somatic stem cell division	1	766.0×	0.004	CDKN2A
protein localization to nucleolus	1	766.0×	0.004	CDKN2A
amelogenesis	1	702.2×	0.004	CFTR
positive regulation of protein sumoylation	1	648.1×	0.004	CDKN2A
positive regulation of signal transduction by p53 class mediator	1	601.9×	0.005	CDKN2A
cellular response to forskolin	1	561.7×	0.005	CFTR
water transport	1	495.6×	0.005	CFTR
rRNA transcription	1	495.6×	0.005	CDKN2A
positive regulation of DNA damage response, signal transduction by p53 class mediator	1	495.6×	0.005	CDKN2A
replicative senescence	1	495.6×	0.005	CDKN2A

Therapeutics

Drug target analysis

Approved (phase 4): 1 · Phase ≥3: 1 · Phased (≥1): 1 · Undrugged: 1

Druggability breadth: 2 of 2 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Genes with an approved drug

The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.

Symbol	Example approved molecule
CFTR	IVACAFTOR

Top cohort targets by molecule count

Symbol	Molecules	Max phase
CFTR	14	4
CDKN2A	0	0

Drugs targeting cohort genes (top 30)

Molecule	Max phase	Targets in cohort
IVACAFTOR	4	CFTR
LUMACAFTOR	4	CFTR
TEZACAFTOR	4	CFTR
ELEXACAFTOR	4	CFTR
GLYBURIDE	4	CFTR
RUTIN	3	CFTR
BAMOCAFTOR	3	CFTR
QUERCETIN	3	CFTR
GALICAFTOR	2	CFTR
GENISTEIN	2	CFTR
ICENTICAFTOR	2	CFTR
NAVOCAFTOR	2	CFTR
RISELCAFTOR	2	CFTR
GLPG-2737	2	CFTR

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 1.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
CFTR	520	Binding:497, Functional:17, ADMET:5, Toxicity:1
CDKN2A	2	Binding:2

Cohort enzymes (BRENDA EC)

Symbol	EC numbers	Names
CFTR	2.7.4.3, 5.6.1.6	adenylate kinase, channel-conductance-controlling ATPase

Cohort genes with high screening signal

≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.

Symbol	ChEMBL assays
CFTR	520

Pharmacogenomics

Cohort genes with a PharmGKB record: 2; with CPIC/DPWG dosing guidelines: 1.

Cohort genes with a CPIC/DPWG dosing guideline

Symbol	CPIC guidelines
CFTR	1

Drug repurposing candidates

14 approved/phased drugs hit cohort targets but don’t yet appear in disease-level clinical trials. Target-inhibition rationale is strongest for cancer driver genes; a bioactivity hit is a screening signal, not a treatment claim.

Compound	Max phase	Cohort target (bioactivity)
IVACAFTOR	4	CFTR
LUMACAFTOR	4	CFTR
TEZACAFTOR	4	CFTR
ELEXACAFTOR	4	CFTR
GLYBURIDE	4	CFTR
RUTIN	3	CFTR
BAMOCAFTOR	3	CFTR
QUERCETIN	3	CFTR
GALICAFTOR	2	CFTR
GENISTEIN	2	CFTR
ICENTICAFTOR	2	CFTR
NAVOCAFTOR	2	CFTR
RISELCAFTOR	2	CFTR
GLPG-2737	2	CFTR

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	1	CFTR
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	1	CDKN2A

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
CDKN2A	2	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.