Methemoglobinemia due to deficiency of methemoglobin reductase

Summary

Methemoglobinemia due to deficiency of methemoglobin reductase (MONDO:0009606) is a disease caused by CYB5R3 (GenCC Strong), with 1 cohort gene.

At a glance

• Causal gene: CYB5R3 (GenCC Strong)
• Cohort genes: 1
• ClinVar variants: 61

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	methemoglobinemia due to deficiency of methemoglobin reductase
Mondo ID	MONDO:0009606
OMIM	250800
UMLS	C0268193
MedGen	75661
GARD	0015197
Is cancer (heuristic)	no

Also known as: methemoglobinemia due to deficiency of methemoglobin reductase · methemoglobinemia, type I · methemoglobinemia, type II · NADH cytochrome B5 reductase deficiency · NADH diaphorase deficiency · NADH methemoglobin reductase deficiency

Data availability: 61 ClinVar variants · 2 GenCC gene-disease records.

Disease family

Classification path: disease › human disease › disease by body system or component › hematologic disorder › erythrocyte disorder › hemoglobinopathy › methemoglobinemia › hereditary methemoglobinemia › methemoglobinemia due to deficiency of methemoglobin reductase

Related subtypes (4): methemoglobin reductase deficiency, methemoglobinemia type 4, hemoglobin M disease, methemoglobinemia, alpha type

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

61 retrieved; paginated sample, class counts are floors:

37 uncertain significance, 8 conflicting classifications of pathogenicity, 7 pathogenic, 5 likely pathogenic, 4 pathogenic/likely pathogenic

ClinVar	Variant (HGVS)	Gene	Classification	Review
1324199	NM_000398.7(CYB5R3):c.574C>T (p.Arg192Cys)	CYB5R3	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
1694454	NM_000398.7(CYB5R3):c.708G>A (p.Trp236Ter)	CYB5R3	Pathogenic	criteria provided, multiple submitters, no conflicts
245	NM_000398.7(CYB5R3):c.464-2A>C	CYB5R3	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
248	NM_000398.7(CYB5R3):c.478C>T (p.Arg160Ter)	CYB5R3	Pathogenic	criteria provided, multiple submitters, no conflicts
250	NM_000398.7(CYB5R3):c.875G>A (p.Gly292Asp)	CYB5R3	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
4291975	NM_000398.7(CYB5R3):c.244_245del (p.Ser82fs)	CYB5R3	Pathogenic	criteria provided, single submitter
431812	NM_000398.7(CYB5R3):c.250C>T (p.Arg84Ter)	CYB5R3	Pathogenic	criteria provided, multiple submitters, no conflicts
4531856	NM_000398.7(CYB5R3):c.226G>A (p.Gly76Ser)	CYB5R3	Pathogenic	criteria provided, single submitter
4531857	NM_000398.7(CYB5R3):c.173G>C (p.Arg58Pro)	CYB5R3	Pathogenic	criteria provided, multiple submitters, no conflicts
505719	NM_000398.7(CYB5R3):c.757G>A (p.Val253Met)	CYB5R3	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
801428	NM_000398.7(CYB5R3):c.226+2T>C	CYB5R3	Pathogenic	criteria provided, single submitter
1174130	NM_000398.7(CYB5R3):c.830dup (p.Pro278fs)	CYB5R3	Likely pathogenic	criteria provided, single submitter
1502415	NM_000398.7(CYB5R3):c.547+1G>A	CYB5R3	Likely pathogenic	criteria provided, multiple submitters, no conflicts
2430191	NM_000398.7(CYB5R3):c.274C>T (p.Arg92Trp)	CYB5R3	Likely pathogenic	criteria provided, single submitter
251	NM_000398.7(CYB5R3):c.763GAG[1] (p.Glu256del)	CYB5R3	Likely pathogenic	criteria provided, single submitter
3906148	NC_000022.11:g.42631838_42638363delins[GTAATCCCAGCAA;42592521_42635366inv;AAGAGTGGGTGGATCACCTGAGGTCAGGAGTGCTAAAC]	CYB5R3	Likely pathogenic	no assertion criteria provided
1608651	NM_000398.7(CYB5R3):c.637G>A (p.Glu213Lys)	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
2440660	NM_000398.7(CYB5R3):c.149G>A (p.Arg50Gln)	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
2440662	NM_000398.7(CYB5R3):c.182G>A (p.Arg61His)	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
252	NM_000398.7(CYB5R3):c.719A>G (p.Asp240Gly)	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
2688907	NM_000398.7(CYB5R3):c.472G>A (p.Ala158Thr)	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
4292171	NM_000398.7(CYB5R3):c.431G>T (p.Gly144Val)	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
736506	NM_000398.7(CYB5R3):c.463+8G>A	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
989273	NM_000398.7(CYB5R3):c.806C>T (p.Pro269Leu)	CYB5R3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1303578	NM_000398.7(CYB5R3):c.89C>T (p.Ser30Phe)	CYB5R3	Uncertain significance	criteria provided, multiple submitters, no conflicts
1310279	NM_000398.7(CYB5R3):c.871G>A (p.Val291Met)	CYB5R3	Uncertain significance	criteria provided, multiple submitters, no conflicts
2050662	NM_000398.7(CYB5R3):c.367G>A (p.Ala123Thr)	CYB5R3	Uncertain significance	criteria provided, multiple submitters, no conflicts
2173190	NM_000398.7(CYB5R3):c.116C>G (p.Pro39Arg)	CYB5R3	Uncertain significance	criteria provided, multiple submitters, no conflicts
2185889	NM_000398.7(CYB5R3):c.63T>A (p.Ser21Arg)	CYB5R3	Uncertain significance	criteria provided, multiple submitters, no conflicts
2230028	NM_000398.7(CYB5R3):c.194C>G (p.Pro65Arg)	CYB5R3	Uncertain significance	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 4 · Orphanet: 1 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
CYB5R3	Definitive	Autosomal recessive	methemoglobinemia	4

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
CYB5R3	Orphanet:621	Autosomal recessive methemoglobinemia

Cohort genes → proteins

1 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
CYB5R3	HGNC:2873	ENSG00000100243	P00387	NADH-cytochrome b5 reductase 3	gencc,clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
CYB5R3	NADH-cytochrome b5 reductase 3	Catalyzes the reduction of two molecules of cytochrome b5 using NADH as the electron donor.

Protein-family classification

Druggable: 1 · Difficult: 0 · Unknown: 0 · Druggable fraction: 1.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Enzyme (other)	1	12.0×	0.083

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
CYB5R3	Enzyme (other)	yes	1.6.2.2	OxRdtase_FAD/NAD-bd, Flavoprot_Pyr_Nucl_cyt_Rdtase, CBR-like

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	1
unknown	0

Top tissues across cohort

Tissue	Cohort genes
descending thoracic aorta	1
right coronary artery	1
thoracic aorta	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
CYB5R3	294	ubiquitous	marker	right coronary artery, descending thoracic aorta, thoracic aorta

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
CYB5R3	2,715

Structural data

PDB: 1 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
CYB5R3	P00387	5

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 9. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Vitamin C (ascorbate) metabolism	1	1427.5×	0.006	CYB5R3
Phase I - Functionalization of compounds	1	219.6×	0.015	CYB5R3
Metabolism of water-soluble vitamins and cofactors	1	181.3×	0.015	CYB5R3
Biological oxidations	1	129.8×	0.015	CYB5R3
Metabolism of vitamins and cofactors	1	116.5×	0.015	CYB5R3
Innate Immune System	1	25.5×	0.056	CYB5R3
Neutrophil degranulation	1	23.1×	0.056	CYB5R3
Immune System	1	13.0×	0.086	CYB5R3
Metabolism	1	11.6×	0.086	CYB5R3

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
nitric oxide biosynthetic process	1	702.2×	0.002	CYB5R3
blood circulation	1	510.7×	0.002	CYB5R3
cholesterol biosynthetic process	1	421.3×	0.002	CYB5R3

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1

Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
CYB5R3	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 1.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
CYB5R3	18	Binding:18

Cohort enzymes (BRENDA EC)

Symbol	EC numbers	Names
CYB5R3	1.6.2.2	cytochrome-b5 reductase

Pharmacogenomics

Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	1	CYB5R3
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	0

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
CYB5R3	18	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.