Methemoglobinemia due to deficiency of methemoglobin reductase
diseaseOn this page
Also known as methemoglobinemia, type Imethemoglobinemia, type IINADH cytochrome B5 reductase deficiencyNADH diaphorase deficiencyNADH methemoglobin reductase deficiency
Summary
Methemoglobinemia due to deficiency of methemoglobin reductase (MONDO:0009606) is a disease caused by CYB5R3 (GenCC Strong), with 1 cohort gene.
At a glance
- Causal gene: CYB5R3 (GenCC Strong)
- Cohort genes: 1
- ClinVar variants: 61
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | methemoglobinemia due to deficiency of methemoglobin reductase |
| Mondo ID | MONDO:0009606 |
| OMIM | 250800 |
| UMLS | C0268193 |
| MedGen | 75661 |
| GARD | 0015197 |
| Is cancer (heuristic) | no |
Also known as: methemoglobinemia due to deficiency of methemoglobin reductase · methemoglobinemia, type I · methemoglobinemia, type II · NADH cytochrome B5 reductase deficiency · NADH diaphorase deficiency · NADH methemoglobin reductase deficiency
Data availability: 61 ClinVar variants · 2 GenCC gene-disease records.
Disease family
Classification path: disease › human disease › disease by body system or component › hematologic disorder › erythrocyte disorder › hemoglobinopathy › methemoglobinemia › hereditary methemoglobinemia › methemoglobinemia due to deficiency of methemoglobin reductase
Related subtypes (4): methemoglobin reductase deficiency, methemoglobinemia type 4, hemoglobin M disease, methemoglobinemia, alpha type
Genetics & variants
GWAS landscape
No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.
Variant details and genetic-evidence tiers
ClinVar germline variants
61 retrieved; paginated sample, class counts are floors:
37 uncertain significance, 8 conflicting classifications of pathogenicity, 7 pathogenic, 5 likely pathogenic, 4 pathogenic/likely pathogenic
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 1324199 | NM_000398.7(CYB5R3):c.574C>T (p.Arg192Cys) | CYB5R3 | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 1694454 | NM_000398.7(CYB5R3):c.708G>A (p.Trp236Ter) | CYB5R3 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 245 | NM_000398.7(CYB5R3):c.464-2A>C | CYB5R3 | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 248 | NM_000398.7(CYB5R3):c.478C>T (p.Arg160Ter) | CYB5R3 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 250 | NM_000398.7(CYB5R3):c.875G>A (p.Gly292Asp) | CYB5R3 | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 4291975 | NM_000398.7(CYB5R3):c.244_245del (p.Ser82fs) | CYB5R3 | Pathogenic | criteria provided, single submitter |
| 431812 | NM_000398.7(CYB5R3):c.250C>T (p.Arg84Ter) | CYB5R3 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 4531856 | NM_000398.7(CYB5R3):c.226G>A (p.Gly76Ser) | CYB5R3 | Pathogenic | criteria provided, single submitter |
| 4531857 | NM_000398.7(CYB5R3):c.173G>C (p.Arg58Pro) | CYB5R3 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 505719 | NM_000398.7(CYB5R3):c.757G>A (p.Val253Met) | CYB5R3 | Pathogenic/Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 801428 | NM_000398.7(CYB5R3):c.226+2T>C | CYB5R3 | Pathogenic | criteria provided, single submitter |
| 1174130 | NM_000398.7(CYB5R3):c.830dup (p.Pro278fs) | CYB5R3 | Likely pathogenic | criteria provided, single submitter |
| 1502415 | NM_000398.7(CYB5R3):c.547+1G>A | CYB5R3 | Likely pathogenic | criteria provided, multiple submitters, no conflicts |
| 2430191 | NM_000398.7(CYB5R3):c.274C>T (p.Arg92Trp) | CYB5R3 | Likely pathogenic | criteria provided, single submitter |
| 251 | NM_000398.7(CYB5R3):c.763GAG[1] (p.Glu256del) | CYB5R3 | Likely pathogenic | criteria provided, single submitter |
| 3906148 | NC_000022.11:g.42631838_42638363delins[GTAATCCCAGCAA;42592521_42635366inv;AAGAGTGGGTGGATCACCTGAGGTCAGGAGTGCTAAAC] | CYB5R3 | Likely pathogenic | no assertion criteria provided |
| 1608651 | NM_000398.7(CYB5R3):c.637G>A (p.Glu213Lys) | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 2440660 | NM_000398.7(CYB5R3):c.149G>A (p.Arg50Gln) | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 2440662 | NM_000398.7(CYB5R3):c.182G>A (p.Arg61His) | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 252 | NM_000398.7(CYB5R3):c.719A>G (p.Asp240Gly) | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 2688907 | NM_000398.7(CYB5R3):c.472G>A (p.Ala158Thr) | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 4292171 | NM_000398.7(CYB5R3):c.431G>T (p.Gly144Val) | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 736506 | NM_000398.7(CYB5R3):c.463+8G>A | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 989273 | NM_000398.7(CYB5R3):c.806C>T (p.Pro269Leu) | CYB5R3 | Conflicting classifications of pathogenicity | criteria provided, conflicting classifications |
| 1303578 | NM_000398.7(CYB5R3):c.89C>T (p.Ser30Phe) | CYB5R3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 1310279 | NM_000398.7(CYB5R3):c.871G>A (p.Val291Met) | CYB5R3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 2050662 | NM_000398.7(CYB5R3):c.367G>A (p.Ala123Thr) | CYB5R3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 2173190 | NM_000398.7(CYB5R3):c.116C>G (p.Pro39Arg) | CYB5R3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 2185889 | NM_000398.7(CYB5R3):c.63T>A (p.Ser21Arg) | CYB5R3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 2230028 | NM_000398.7(CYB5R3):c.194C>G (p.Pro65Arg) | CYB5R3 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 4 · Orphanet: 1 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
GenCC gene–disease validity (cohort genes)
the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.
| Gene | Classification | Inheritance | Disease | Records |
|---|---|---|---|---|
| CYB5R3 | Definitive | Autosomal recessive | methemoglobinemia | 4 |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| CYB5R3 | Orphanet:621 | Autosomal recessive methemoglobinemia |
Cohort genes → proteins
1 cohort genes, 1 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| CYB5R3 | HGNC:2873 | ENSG00000100243 | P00387 | NADH-cytochrome b5 reductase 3 | gencc,clinvar |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| CYB5R3 | NADH-cytochrome b5 reductase 3 | Catalyzes the reduction of two molecules of cytochrome b5 using NADH as the electron donor. |
Protein-family classification
Druggable: 1 · Difficult: 0 · Unknown: 0 · Druggable fraction: 1.0
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Enzyme (other) | 1 | 12.0× | 0.083 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| CYB5R3 | Enzyme (other) | yes | 1.6.2.2 | OxRdtase_FAD/NAD-bd, Flavoprot_Pyr_Nucl_cyt_Rdtase, CBR-like |
Expression context
Cohort genes with no expression data: 0.
1 cohort gene are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 1 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| descending thoracic aorta | 1 |
| right coronary artery | 1 |
| thoracic aorta | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| CYB5R3 | 294 | ubiquitous | marker | right coronary artery, descending thoracic aorta, thoracic aorta |
Protein interactions among cohort
Intra-cohort edges: 0.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| CYB5R3 | 2,715 |
Structural data
PDB: 1 · AlphaFold-only: 0 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| CYB5R3 | P00387 | 5 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 9. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Vitamin C (ascorbate) metabolism | 1 | 1427.5× | 0.006 | CYB5R3 |
| Phase I - Functionalization of compounds | 1 | 219.6× | 0.015 | CYB5R3 |
| Metabolism of water-soluble vitamins and cofactors | 1 | 181.3× | 0.015 | CYB5R3 |
| Biological oxidations | 1 | 129.8× | 0.015 | CYB5R3 |
| Metabolism of vitamins and cofactors | 1 | 116.5× | 0.015 | CYB5R3 |
| Innate Immune System | 1 | 25.5× | 0.056 | CYB5R3 |
| Neutrophil degranulation | 1 | 23.1× | 0.056 | CYB5R3 |
| Immune System | 1 | 13.0× | 0.086 | CYB5R3 |
| Metabolism | 1 | 11.6× | 0.086 | CYB5R3 |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| nitric oxide biosynthetic process | 1 | 702.2× | 0.002 | CYB5R3 |
| blood circulation | 1 | 510.7× | 0.002 | CYB5R3 |
| cholesterol biosynthetic process | 1 | 421.3× | 0.002 | CYB5R3 |
Therapeutics
Drug target analysis
Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1
Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| CYB5R3 | 0 | 0 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 1.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| CYB5R3 | 18 | Binding:18 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|---|---|
| CYB5R3 | 1.6.2.2 | cytochrome-b5 reductase |
Pharmacogenomics
Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 0 | |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 1 | CYB5R3 |
| D | Druggable family + AlphaFold only, no drug | 0 | |
| E | Difficult family or no structure, no drug | 0 |
Undrugged target profiles
1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| CYB5R3 | 18 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 0.
Related Atlas pages
- Cohort genes: CYB5R3