Microvascular complications of diabetes, susceptibility to, 4
diseaseOn this page
Also known as IL1RN microvascular complications of diabetes, susceptibilitymicrovascular complications of diabetes 4microvascular complications of diabetes, susceptibility caused by mutation in IL1RNmicrovascular complications of diabetes, susceptibility to, type 4MVCD4
Summary
Microvascular complications of diabetes, susceptibility to, 4 (MONDO:0012966) is a disease with 1 cohort gene.
At a glance
- Cohort genes: 1
- ClinVar variants: 7
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | microvascular complications of diabetes, susceptibility to, 4 |
| Mondo ID | MONDO:0012966 |
| OMIM | 612628 |
| UMLS | C2675112 |
| MedGen | 382527 |
| Is cancer (heuristic) | no |
Also known as: IL1RN microvascular complications of diabetes, susceptibility · microvascular complications of diabetes 4 · microvascular complications of diabetes, susceptibility caused by mutation in IL1RN · microvascular complications of diabetes, susceptibility to, 4 · microvascular complications of diabetes, susceptibility to, type 4 · MVCD4
Data availability: 7 ClinVar variants.
Disease family
Classification path: disease susceptibility › inherited disease susceptibility › microvascular complications of diabetes, susceptibility › microvascular complications of diabetes, susceptibility to, 4
Related subtypes (6): microvascular complications of diabetes, susceptibility to, 1, microvascular complications of diabetes, susceptibility to, 2, microvascular complications of diabetes, susceptibility to, 3, microvascular complications of diabetes, susceptibility to, 5, microvascular complications of diabetes, susceptibility to, 6, microvascular complications of diabetes, susceptibility to, 7
Genetics & variants
GWAS landscape
No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.
Variant details and genetic-evidence tiers
ClinVar germline variants
7 retrieved; paginated sample, class counts are floors:
4 uncertain significance, 1 pathogenic; risk factor, 1 likely benign, 1 benign/likely benign
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 14674 | NM_173842.3(IL1RN):c.206-516ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC[2] | IL1RN | Pathogenic; risk factor | no assertion criteria provided |
| 1015756 | NM_173842.3(IL1RN):c.212T>C (p.Ile71Thr) | IL1RN | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 572109 | NM_173841.3(IL1RN):c.58A>C (p.Asn20His) | IL1RN | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 827981 | NM_173842.3(IL1RN):c.68C>T (p.Thr23Met) | IL1RN | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 944477 | NM_173842.3(IL1RN):c.496G>A (p.Val166Ile) | IL1RN | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 1572045 | NM_173842.3(IL1RN):c.300G>A (p.Glu100=) | IL1RN | Likely benign | criteria provided, multiple submitters, no conflicts |
| 330823 | NM_173842.3(IL1RN):c.69G>A (p.Thr23=) | IL1RN | Benign/Likely benign | criteria provided, multiple submitters, no conflicts |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 1 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| IL1RN | Orphanet:210115 | Sterile multifocal osteomyelitis with periostitis and pustulosis |
Cohort genes → proteins
1 cohort genes, 1 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| IL1RN | HGNC:6000 | ENSG00000136689 | P18510 | Interleukin-1 receptor antagonist protein | clinvar |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| IL1RN | Interleukin-1 receptor antagonist protein | Anti-inflammatory antagonist of interleukin-1 family of proinflammatory cytokines such as interleukin-1beta/IL1B and interleukin-1alpha/IL1A. |
Protein-family classification
Druggable: 0 · Difficult: 0 · Unknown: 1 · Druggable fraction: 0.0
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Other/Unknown | 1 | 1.8× | 0.558 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| IL1RN | Other/Unknown | no | IL-1_fam, IL-1RA/IL-36, IL1/FGF |
Expression context
Cohort genes with no expression data: 0.
1 cohort gene are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 1 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| buccal mucosa cell | 1 |
| lower esophagus mucosa | 1 |
| palpebral conjunctiva | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| IL1RN | 220 | broad | marker | lower esophagus mucosa, buccal mucosa cell, palpebral conjunctiva |
Protein interactions among cohort
Intra-cohort edges: 0.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| IL1RN | 2,550 |
Structural data
PDB: 1 · AlphaFold-only: 0 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| IL1RN | P18510 | 5 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 2. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Interleukin-10 signaling | 1 | 233.1× | 0.008 | IL1RN |
| Interleukin-1 signaling | 1 | 124.1× | 0.008 | IL1RN |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| negative regulation of heterotypic cell-cell adhesion | 1 | 1872.4× | 0.002 | IL1RN |
| negative regulation of interleukin-1-mediated signaling pathway | 1 | 1685.2× | 0.002 | IL1RN |
| insulin secretion | 1 | 432.1× | 0.005 | IL1RN |
| acute-phase response | 1 | 421.3× | 0.005 | IL1RN |
| response to glucocorticoid | 1 | 324.1× | 0.005 | IL1RN |
| lipid metabolic process | 1 | 91.6× | 0.015 | IL1RN |
| immune response | 1 | 47.1× | 0.024 | IL1RN |
| inflammatory response | 1 | 37.7× | 0.027 | IL1RN |
Therapeutics
Drug target analysis
Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1
Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| IL1RN | 0 | 0 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 0.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| IL1RN | 26 | Binding:26 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 0 | |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 0 | |
| D | Druggable family + AlphaFold only, no drug | 0 | |
| E | Difficult family or no structure, no drug | 1 | IL1RN |
Undrugged target profiles
1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| IL1RN | 26 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 0.
Related Atlas pages
- Cohort genes: IL1RN