mitochondrial complex I deficiency, nuclear type 22

Summary

mitochondrial complex I deficiency, nuclear type 22 (MONDO:0032626) is a disease caused by NDUFA10 (GenCC Strong), with 1 cohort gene.

At a glance

• Causal gene: NDUFA10 (GenCC Strong)
• Cohort genes: 1
• ClinVar variants: 22

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	mitochondrial complex I deficiency, nuclear type 22
Mondo ID	MONDO:0032626
OMIM	618243
DOID	DOID:0112069
UMLS	C4748796
MedGen	1648347
GARD	0018373
Is cancer (heuristic)	no

Also known as: MC1DN22

Data availability: 22 ClinVar variants · 3 GenCC gene-disease records.

Disease family

Classification path: disease › human disease › disease by developmental or physiological process › metabolic disease › developmental anomaly of metabolic origin › inborn mitochondrial metabolism disorder › mitochondrial oxidative phosphorylation disorder › mitochondrial respiratory chain complex deficiency › mitochondrial complex I deficiency › mitochondrial complex I deficiency, nuclear type › mitochondrial complex I deficiency, nuclear type 22

Related subtypes (36): mitochondrial complex I deficiency, nuclear type 12, mitochondrial complex I deficiency, nuclear type 30, Leber hereditary optic neuropathy, autosomal recessive, mitochondrial complex I deficiency, nuclear type 36, mitochondrial complex I deficiency, nuclear type 37, mitochondrial complex I deficiency, nuclear type 2, mitochondrial complex I deficiency, nuclear type 3, mitochondrial complex I deficiency, nuclear type 4, mitochondrial complex I deficiency, nuclear type 5, mitochondrial complex I deficiency, nuclear type 6, mitochondrial complex I deficiency, nuclear type 7, mitochondrial complex I deficiency, nuclear type 8, mitochondrial complex I deficiency, nuclear type 9, mitochondrial complex I deficiency, nuclear type 10, mitochondrial complex I deficiency, nuclear type 11, mitochondrial complex I deficiency, nuclear type 13, mitochondrial complex I deficiency, nuclear type 14, mitochondrial complex I deficiency, nuclear type 15, mitochondrial complex I deficiency, nuclear type 16, mitochondrial complex I deficiency, nuclear type 17, mitochondrial complex I deficiency, nuclear type 18, mitochondrial complex I deficiency, nuclear type 19, mitochondrial complex I deficiency, nuclear type 21, mitochondrial complex I deficiency, nuclear type 23, mitochondrial complex I deficiency, nuclear type 24, mitochondrial complex I deficiency, nuclear type 25, mitochondrial complex I deficiency, nuclear type 26, mitochondrial complex I deficiency, nuclear type 27, mitochondrial complex I deficiency, nuclear type 28, mitochondrial complex I deficiency, nuclear type 29, mitochondrial complex I deficiency, nuclear type 31, mitochondrial complex I deficiency, nuclear type 32, mitochondrial complex I deficiency, nuclear type 33, mitochondrial complex I deficiency, nuclear type 34, mitochondrial complex I deficiency, nuclear type 1, mitochondrial complex I deficiency, nuclear type 39

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

22 retrieved; paginated sample, class counts are floors:

7 uncertain significance, 5 conflicting classifications of pathogenicity, 3 benign, 3 likely pathogenic, 3 pathogenic, 1 benign/likely benign

ClinVar	Variant (HGVS)	Gene	Classification	Review
30393	NM_004544.4(NDUFA10):c.425A>G (p.Gln142Arg)	NDUFA10	Pathogenic	no assertion criteria provided
372194	NM_004544.4(NDUFA10):c.881T>C (p.Leu294Pro)	NDUFA10	Pathogenic	no assertion criteria provided
372195	NM_004544.4(NDUFA10):c.384_385insAAT (p.Ser128_Tyr129insAsn)	NDUFA10	Pathogenic	no assertion criteria provided
2577650	NM_004544.4(NDUFA10):c.415C>T (p.Arg139Cys)	NDUFA10	Likely pathogenic	criteria provided, multiple submitters, no conflicts
30392	NM_004544.4(NDUFA10):c.1A>G (p.Met1Val)	NDUFA10	Likely pathogenic	criteria provided, single submitter
3767163	NM_004544.4(NDUFA10):c.890T>C (p.Leu297Pro)	NDUFA10	Likely pathogenic	criteria provided, single submitter
1806358	NM_004544.4(NDUFA10):c.1000-12427TCCCTCCTTGAAGCTGATCGT[2]	NDUFA10	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
214708	NM_004544.4(NDUFA10):c.404T>C (p.Leu135Ser)	NDUFA10	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
632354	NM_004544.4(NDUFA10):c.604dup (p.His202fs)	NDUFA10	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
895859	NM_004544.4(NDUFA10):c.41C>G (p.Ser14Cys)	NDUFA10	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
986071	NM_004544.4(NDUFA10):c.233_235del (p.Ala78del)	NDUFA10	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1342399	NM_004544.4(NDUFA10):c.590A>G (p.Asp197Gly)	NDUFA10	Uncertain significance	criteria provided, single submitter
1400345	NM_004544.4(NDUFA10):c.976C>T (p.Arg326Cys)	NDUFA10	Uncertain significance	criteria provided, multiple submitters, no conflicts
2413144	NM_004544.4(NDUFA10):c.557A>C (p.His186Pro)	NDUFA10	Uncertain significance	criteria provided, single submitter
2434080	NM_004544.4(NDUFA10):c.1025_1026insATGG (p.Tyr343fs)	NDUFA10	Uncertain significance	criteria provided, single submitter
2671932	NM_004544.4(NDUFA10):c.1000-12367C>G	NDUFA10	Uncertain significance	criteria provided, single submitter
2671953	NM_004544.4(NDUFA10):c.1000-12409C>G	NDUFA10	Uncertain significance	criteria provided, single submitter
3068039	NM_004544.4(NDUFA10):c.844C>T (p.Pro282Ser)	NDUFA10	Uncertain significance	criteria provided, single submitter
129685	NM_004544.4(NDUFA10):c.105A>G (p.Lys35=)	NDUFA10	Benign	criteria provided, multiple submitters, no conflicts
129686	NM_004544.4(NDUFA10):c.771A>G (p.Gln257=)	NDUFA10	Benign	criteria provided, multiple submitters, no conflicts
138437	NM_004544.4(NDUFA10):c.712G>A (p.Glu238Lys)	NDUFA10	Benign/Likely benign	criteria provided, multiple submitters, no conflicts
214702	NM_004544.4(NDUFA10):c.1000-5del	NDUFA10	Benign	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 4 · Orphanet: 0 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
NDUFA10	Strong	Autosomal recessive	mitochondrial complex I deficiency, nuclear type 22	4

Cohort genes → proteins

1 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
NDUFA10	HGNC:7684	ENSG00000130414	O95299	NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 10, mitochondrial	gencc,clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
NDUFA10	NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 10, mitochondrial	Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis.

Protein-family classification

Druggable: 1 · Difficult: 0 · Unknown: 0 · Druggable fraction: 1.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Kinase	1	27.7×	0.036

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
NDUFA10	Kinase	yes		NDUFA10, P-loop_NTPase, DNK_dom

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	1
unknown	0

Top tissues across cohort

Tissue	Cohort genes
apex of heart	1
cardiac ventricle	1
heart left ventricle	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
NDUFA10	291	ubiquitous	marker	apex of heart, heart left ventricle, cardiac ventricle

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
NDUFA10	2,368

Structural data

PDB: 1 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
NDUFA10	O95299	6

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 4. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Complex I biogenesis	1	165.5×	0.015	NDUFA10
Respiratory electron transport	1	95.2×	0.015	NDUFA10
Aerobic respiration and respiratory electron transport	1	88.5×	0.015	NDUFA10
Metabolism	1	11.6×	0.086	NDUFA10

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
mitochondrial electron transport, NADH to ubiquinone	1	358.6×	0.004	NDUFA10
proton motive force-driven mitochondrial ATP synthesis	1	263.3×	0.004	NDUFA10
aerobic respiration	1	247.8×	0.004	NDUFA10

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1

Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
NDUFA10	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
NDUFA10	5	Binding:5

Pharmacogenomics

Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	1	NDUFA10
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	0

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
NDUFA10	5	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.