Nonarteritic anterior ischemic optic neuropathy, susceptibility to
diseaseOn this page
Also known as susceptibility to nonarteritic anterior ischaemic optic neuropathy
Summary
Nonarteritic anterior ischemic optic neuropathy, susceptibility to (MONDO:0009789) is a disease with 1 cohort gene.
At a glance
- Cohort genes: 1
- ClinVar variants: 25
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | nonarteritic anterior ischemic optic neuropathy, susceptibility to |
| Mondo ID | MONDO:0009789 |
| OMIM | 258660 |
| UMLS | C1847711 |
| MedGen | 338294 |
| Is cancer (heuristic) | no |
Also known as: nonarteritic anterior ischemic optic neuropathy, susceptibility to · susceptibility to nonarteritic anterior ischaemic optic neuropathy
Data availability: 25 ClinVar variants.
Disease family
Classification path: disease susceptibility › inherited disease susceptibility › nonarteritic anterior ischemic optic neuropathy, susceptibility to
Related subtypes (283): microvascular complications of diabetes, susceptibility, Mycobacterium tuberculosis, susceptibility, bacteremia, susceptibility, pregnancy loss, recurrent, susceptibility, autoimmune thyroid disease, susceptibility to, susceptibility to HIV infection, appendicitis, proneness to, atherosclerosis susceptibility, multiple sclerosis, susceptibility to, dyslexia, susceptibility to, 1, endometriosis, susceptibility to, 1, osteoarthritis susceptibility 2, essential hypertension, genetic, osteoarthritis susceptibility 1, otitis media, susceptibility to, pelvic organ prolapse, susceptibility to, pulmonary edema of mountaineers, susceptibility to, sarcoidosis, susceptibility to, 1, strabismus, susceptibility to, thyrotoxic periodic paralysis, susceptibility to, 1, predisposition to invasive fungal disease due to CARD9 deficiency, celiac disease, susceptibility to, 1, hemolytic uremic syndrome, atypical, susceptibility to, 1, hypervitaminosis a, susceptibility to, kuru, susceptibility to, leprosy, susceptibility to, 3, diabetes mellitus, insulin-dependent, X-linked, susceptibility to, coronary heart disease, susceptibility to, 3, dyslexia, susceptibility to, 9, systemic lupus erythematosus, susceptibility to, 15, Leber optic atrophy, susceptibility to, dyslexia, susceptibility to, 2, Helicobacter pylori infection, susceptibility to, epilepsy, idiopathic generalized, susceptibility to, 1, inherited susceptibility to asthma, renal dysplasia, cystic, susceptibility to, systemic lupus erythematosus, susceptibility to, 1, leishmaniasis, tegumentary, susceptibility to, xanthomatosis, susceptibility to, hyperlipidemia, combined, 1, urinary tract infections, recurrent, susceptibility to, hypertension, essential, susceptibility to, 1, hepatic fibrosis, severe, susceptibility to, due to Schistosoma mansoni infection, dyslexia, susceptibility to, 3, Ascaris lumbricoides infection, susceptibility to, hypertension, essential, susceptibility to, 2, epilepsy, idiopathic generalized, susceptibility to, 7, systemic lupus erythematosus, susceptibility to, 2, systemic lupus erythematosus, susceptibility to, 3, nephrolithiasis, uric acid, susceptibility to, atrioventricular septal defect, susceptibility to, 2, vitiligo-associated multiple autoimmune disease susceptibility 1, polysubstance abuse, susceptibility to, dyslexia, susceptibility to, 6, glaucoma, normal tension, susceptibility to, anorexia nervosa, susceptibility to, 1, stroke, susceptibility to, 1, dyslexia, susceptibility to, 5, epilepsy, idiopathic generalized, susceptibility to, 2, familial meningioma, celiac disease, susceptibility to, 5, systemic lupus erythematosus with hemolytic anemia, susceptibility to, 1, hypertension, essential, susceptibility to, 3, coronary heart disease, susceptibility to, 1, bulimia nervosa, susceptibility to, 1, leprosy, susceptibility to, 2, epilepsy, idiopathic generalized, susceptibility to, 9, Parkinson disease 11, autosomal dominant, susceptibility to, focal segmental glomerulosclerosis 3, susceptibility to, autoimmune disease, susceptibility to, 1, osteoarthritis susceptibility 3, systemic lupus erythematosus with nephritis, susceptibility to, 1, systemic lupus erythematosus with nephritis, susceptibility to, 2, systemic lupus erythematosus with nephritis, susceptibility to, 3, coronary heart disease, susceptibility to, 2, coronary heart disease, susceptibility to, 4, autoimmune disease, susceptibility to, 2, autoimmune disease, susceptibility to, 3, systemic lupus erythematosus, susceptibility to, 4, myocardial infarction, susceptibility to, major depressive disorder 1, legionnaire disease, susceptibility to, myocardial infarction, susceptibility to, 2, major depressive disorder 2, hypertension, essential, susceptibility to, 4, epilepsy, idiopathic generalized, susceptibility to, 3, myoclonic epilepsy, juvenile, susceptibility to, 3, orofacial cleft 6, susceptibility to, coronary heart disease, susceptibility to, 5, attention deficit-hyperactivity disorder, susceptibility to, 1, attention deficit-hyperactivity disorder, susceptibility to, 2, attention deficit-hyperactivity disorder, susceptibility to, 3, attention deficit-hyperactivity disorder, susceptibility to, 4, Alzheimer disease 9, susceptibility to respiratory infections associated with CD8alpha chain mutation, dyslexia, susceptibility to, 8, autoimmune disease, susceptibility to, 4, hepatitis C virus, susceptibility to, epilepsy, idiopathic generalized, susceptibility to, 4, celiac disease, susceptibility to, 4, celiac disease, susceptibility to, 2, celiac disease, susceptibility to, 3, leprosy, susceptibility to, 1, systemic lupus erythematosus, susceptibility to, 5, systemic lupus erythematosus, susceptibility to, 6, opioid dependence, susceptibility to, 1, systemic lupus erythematosus, susceptibility to, 7, systemic lupus erythematosus, susceptibility to, 8, hypertension, essential, susceptibility to, 5, hypertension, essential, susceptibility to, 6, Parkinson disease 13, autosomal dominant, susceptibility to, West Nile virus, susceptibility to, hepatitis B virus, susceptibility to, Buruli ulcer, susceptibility to, osteoarthritis susceptibility 4, systemic lupus erythematosus, susceptibility to, 9, coronary heart disease, susceptibility to, 7, hypertension, essential, susceptibility to, 7, leprosy, susceptibility to, 4, hypertension, essential, susceptibility to, 8, epilepsy, idiopathic generalized, susceptibility to, 13, coronary heart disease, susceptibility to, 8, myoclonic epilepsy, juvenile, susceptibility to, 4, susceptibility to visceral leishmaniasis, 2, susceptibility to visceral leishmaniasis, 3, celiac disease, susceptibility to, 6, epilepsy, idiopathic generalized, susceptibility to, 5, epilepsy, childhood absence, susceptibility to, 6, celiac disease, susceptibility to, 7, celiac disease, susceptibility to, 8, celiac disease, susceptibility to, 9, celiac disease, susceptibility to, 10, celiac disease, susceptibility to, 11, celiac disease, susceptibility to, 12, celiac disease, susceptibility to, 13, coronary heart disease, susceptibility to, 9, systemic lupus erythematosus, susceptibility to, 10, systemic lupus erythematosus, susceptibility to, 11, systemic lupus erythematosus, susceptibility to, 12, epilepsy, childhood absence, susceptibility to, 5, attention deficit-hyperactivity disorder, susceptibility to, 5, attention deficit-hyperactivity disorder, susceptibility to, 6, systemic lupus erythematosus, susceptibility to, 13, sarcoidosis, susceptibility to, 2, sarcoidosis, susceptibility to, 3, osteoarthritis susceptibility 5, osteoarthritis susceptibility 6, focal segmental glomerulosclerosis 4, susceptibility to, epilepsy, idiopathic generalized, susceptibility to, 8, herpes simplex encephalitis, susceptibility to, 2, attention deficit-hyperactivity disorder, susceptibility to, 7, epilepsy, idiopathic generalized, susceptibility to, 10, pelvic organ prolapse, susceptibility to, 2, systemic lupus erythematosus, susceptibility to, 14, leprosy, susceptibility to, 5, thyrotoxic periodic paralysis, susceptibility to, 2, hearing loss, cisplatin-induced, susceptibility to, susceptibility to mononeuropathy of the median nerve, mild, fatty liver disease, nonalcoholic, susceptibility to, 2, leprosy, susceptibility to, 6, autoimmune disease, susceptibility to, 6, Parkinson disease 5, autosomal dominant, susceptibility to, aspergillosis, susceptibility to, sick sinus syndrome 3, susceptibility to, Parkinson disease 18, autosomal dominant, susceptibility to, epilepsy, juvenile myoclonic, susceptibility to, 9, dengue virus, susceptibility to, coronary heart disease, susceptibility to, 6, podoconiosis, susceptibility to, peripartum cardiomyopathy, susceptibility to, influenza, severe, susceptibility to, thyrotoxic periodic paralysis, susceptibility to, 3, human herpesvirus 8, susceptibility to, epilepsy, idiopathic generalized, susceptibility to, 12, herpes simplex encephalitis, susceptibility to, 3, herpes simplex encephalitis, susceptibility to, 4, pulmonary hypertension, neonatal, susceptibility to, craniosynostosis 5, susceptibility to, melioidosis, susceptibility to, chronic mountain sickness, susceptibility to, herpes simplex encephalitis, susceptibility to, 7, epilepsy, idiopathic generalized, susceptibility to, 14, hereditary neoplastic syndrome, autosomal recessive Mendelian susceptibility to mycobacterial diseases due to partial IFNgammaR1 deficiency, autosomal recessive Mendelian susceptibility to mycobacterial diseases due to partial IFNgammaR2 deficiency, susceptibility to localized juvenile periodontitis, inherited susceptibility to mycobacterial diseases, neural tube defects, susceptibility to, multiple system atrophy 1, susceptibility to, nephrolithiasis susceptibility caused by SLC26A1, myoclonic epilepsy, juvenile, susceptibility to, 1, epilepsy, childhood absence, susceptibility to, 1, autism, susceptiblity to, susceptibility to visceral leishmaniasis, 1, malaria, susceptibility to, spondyloarthropathy, susceptibility to, herpes simplex encephalitis, susceptibility to, 1, epilepsy, idiopathic generalized, susceptibility to, 18, epilepsy, idiopathic generalized, susceptibility to, 15, hepatitis, fulminant viral, susceptibility to, epilepsy, idiopathic generalized, susceptibility to, 16, autosomal recessive mendelian susceptibility to mycobacterial diseases due to partial jak1 deficiency, aortic aneurysm, familial thoracic 11, susceptibility to, craniosynostosis 7, amyotrophic lateral sclerosis, susceptibility to, 24, amyotrophic lateral sclerosis, susceptibility to, 25, epilepsy, juvenile myoclonic, susceptibility to, 10, susceptibility to angioedema induced by ACE inhibitors, epidermodysplasia verruciformis, susceptibility to, exfoliation syndrome, susceptibility to, basal cell carcinoma, susceptibility to, graft-versus-host disease, susceptibility to, narcolepsy, susceptibility to, pulmonary disease, chronic obstructive, susceptibility to, restless legs syndrome, susceptibility to, psoriasis, susceptibility to, age related macular degeneration, susceptibility to, allergic rhinitis, susceptibility to, dermatitis, atopic, susceptibility to, Hirschsprung disease, susceptibility to, diabetes mellitus, ketosis-prone, schizophrenia, susceptibility to, radioulnar synostosis, nonsyndromic, susceptibility to, lumbar disk herniation, susceptibility to, lumbar disk degeneration, susceptibility to, psoriatic arthritis, susceptibility to, migraine with or without aura, susceptibility to, Alzheimer disease, susceptibility to, mitochondrial, Asperger syndrome, susceptibility to, tobacco addiction, susceptibility to, lipodystrophy, partial, acquired, susceptibility to, Graves disease, susceptibility to, 1, epilepsy, idiopathic generalized, susceptibility to, 17, breast-ovarian cancer, familial, susceptibility to, blepharospasm, benign essential, susceptibility to, hemorrhage, intracerebral, susceptibility to, IgA nephropathy, susceptibility to, hemolytic uremic syndrome, atypical, susceptibility to, 7, vitiligo-associated multiple autoimmune disease susceptibility 6, delayed sleep phase syndrome, susceptibility to, encephalitis, acute, infection-induced, susceptibility to, malignant hyperthermia, susceptibility to, multicentric Castleman disease, susceptibility to, pelvic organ prolapse, susceptibility to, 1, amyotrophic lateral sclerosis, susceptibility to, 13, Graves disease, susceptibility to, X-linked 2, autoimmune thyroid disease, susceptibility to, 5, atrioventricular septal defect, susceptibility to, 1, epilepsy, juvenile myoclonic, susceptibility to, 6, autoimmune disease, susceptibility to, 5, epilepsy, idiopathic generalized, susceptibility to, 6, seasonal affective disorder, susceptibility to, ventricular fibrillation during myocardial infarction, susceptibility to, UV-induced skin damage, susceptibility to, antisocial behavior, susceptibility to, aplastic anemia, susceptibility to, cardiomyopathy, familial hypertrophic, 4, susceptibility to, cirrhosis, noncryptogenic, susceptibility to, coronary artery disease, severe, susceptibility to, dengue fever, susceptibility to, dengue hemorrhagic fever, susceptibility to, dengue shock syndrome, susceptibility to, dyslexia, susceptibility to, 4, dyslexia, susceptibility to, 7, efavirenz central nervous system toxicity, susceptibility to, obesity, susceptibility to, bleeding disorder, platelet-type, 13, susceptibility to, Schistosoma mansoni infection, susceptibility/resistance to, Parkinson disease 24, autosomal dominant, susceptibility to, iron overload, susceptibility to, hydrocephalus, congenital, 5, susceptibility to, hearing loss, noise-induced, susceptibility to, hyperemesis gravidarum, susceptibility to, Parkinson disease 26, autosomal dominant, susceptibility to, epilepsy, idiopathic generalized, susceptibility to, 19, polycystic kidney disease 9, susceptibility to, rhabdomyolysis, susceptibility to, scoliosis, isolated, susceptibility to, dystonia 38, susceptibility to, gallbladder disease 4, epilepsy, juvenile absence, susceptibility to, GBA1-related Parkinson disease, susceptibility, SH2B3-related immune system disorder
Genetics & variants
GWAS landscape
No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.
Variant details and genetic-evidence tiers
ClinVar germline variants
25 retrieved; paginated sample, class counts are floors:
10 likely pathogenic, 6 uncertain significance, 4 pathogenic, 3 benign, 1 likely benign, 1 benign/likely benign
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 1691251 | NM_000173.7(GP1BA):c.1480del (p.Thr494fs) | GP1BA | Pathogenic | reviewed by expert panel |
| 4156 | NM_000173.7(GP1BA):c.515C>T (p.Ala172Val) | GP1BA | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 4157 | NM_000173.7(GP1BA):c.1620G>A (p.Trp540Ter) | GP1BA | Pathogenic | reviewed by expert panel |
| 872581 | NM_000173.7(GP1BA):c.1601_1602del (p.Tyr534fs) | GP1BA | Pathogenic | reviewed by expert panel |
| 3251584 | NM_000173.7(GP1BA):c.987G>A (p.Trp329Ter) | GP1BA | Likely pathogenic | reviewed by expert panel |
| 3582320 | NM_000173.7(GP1BA):c.70A>T (p.Lys24Ter) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3582321 | NM_000173.7(GP1BA):c.298del (p.Leu100fs) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3582323 | NM_000173.7(GP1BA):c.624del (p.Phe208fs) | GP1BA | Likely pathogenic | reviewed by expert panel |
| 3582324 | NM_000173.7(GP1BA):c.783dup (p.Val262fs) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3582326 | NM_000173.7(GP1BA):c.883del (p.Tyr295fs) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3582327 | NM_000173.7(GP1BA):c.1009C>T (p.Gln337Ter) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3582329 | NM_000173.7(GP1BA):c.1426del (p.Ser476fs) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3582330 | NM_000173.7(GP1BA):c.1436T>A (p.Leu479Ter) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3582331 | NM_000173.7(GP1BA):c.1699C>T (p.Gln567Ter) | GP1BA | Likely pathogenic | criteria provided, single submitter |
| 3251816 | NM_000173.7(GP1BA):c.376A>G (p.Asn126Asp) | GP1BA | Uncertain significance | reviewed by expert panel |
| 3582322 | NM_000173.7(GP1BA):c.527T>G (p.Leu176Trp) | GP1BA | Uncertain significance | criteria provided, single submitter |
| 3582328 | NM_000173.7(GP1BA):c.1093C>T (p.Leu365Phe) | GP1BA | Uncertain significance | criteria provided, single submitter |
| 3893145 | NM_000173.7(GP1BA):c.1880G>A (p.Arg627Lys) | GP1BA | Uncertain significance | criteria provided, single submitter |
| 449564 | NM_000173.7(GP1BA):c.586C>T (p.Gln196Ter) | GP1BA | Uncertain significance | reviewed by expert panel |
| 808198 | NM_000173.7(GP1BA):c.1761A>C (p.Gln587His) | GP1BA | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 255462 | NM_000173.7(GP1BA):c.106A>G (p.Arg36Gly) | GP1BA | Benign | reviewed by expert panel |
| 4152 | NM_000173.7(GP1BA):c.1272GGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCC[3] (p.Thr453_Pro454insSerGluProAlaProSerProThrThrProGluProThrSerGluProAlaProSerProThrThrProGluProThr) | GP1BA | Benign | no assertion criteria provided |
| 417940 | NM_000173.7(GP1BA):c.256C>T (p.Leu86Phe) | GP1BA | Benign | reviewed by expert panel |
| 435346 | NM_000173.7(GP1BA):c.1322_1344del (p.Ser441fs) | GP1BA | Benign/Likely benign | criteria provided, multiple submitters, no conflicts |
| 1338214 | NM_000173.7(GP1BA):c.1845_1849del (p.Asn616fs) | LOC130060044 | Likely benign | reviewed by expert panel |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 4 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| GP1BA | Orphanet:140957 | Autosomal dominant macrothrombocytopenia |
| GP1BA | Orphanet:274 | Bernard-Soulier syndrome |
| GP1BA | Orphanet:52530 | Pseudo-von Willebrand disease |
| GP1BA | Orphanet:853 | Fetal and neonatal alloimmune thrombocytopenia |
Cohort genes → proteins
1 cohort genes, 1 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| GP1BA | HGNC:4439 | ENSG00000185245 | P07359 | Platelet glycoprotein Ib alpha chain | clinvar |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| GP1BA | Platelet glycoprotein Ib alpha chain | GP-Ib, a surface membrane protein of platelets, participates in the formation of platelet plugs by binding to the A1 domain of vWF, which is already bound to the subendothelium. |
Protein-family classification
Druggable: 0 · Difficult: 0 · Unknown: 1 · Druggable fraction: 0.0
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Other/Unknown | 1 | 1.8× | 0.558 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| GP1BA | Other/Unknown | no | LRRNT, Cys-rich_flank_reg_C, Leu-rich_rpt |
Expression context
Cohort genes with no expression data: 0.
1 cohort gene are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 1 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| leukocyte | 1 |
| monocyte | 1 |
| mononuclear cell | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| GP1BA | 186 | tissue_specific | marker | monocyte, mononuclear cell, leukocyte |
Protein interactions among cohort
Intra-cohort edges: 0.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| GP1BA | 1,703 |
Structural data
PDB: 1 · AlphaFold-only: 0 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| GP1BA | P07359 | 22 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 10. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Defective F9 activation | 1 | 1903.3× | 0.002 | GP1BA |
| Enhanced binding of GP1BA variant to VWF multimer:collagen | 1 | 1631.4× | 0.002 | GP1BA |
| Defective binding of VWF variant to GPIb:IX:V | 1 | 1631.4× | 0.002 | GP1BA |
| FXIIa, PKa-dependent activation of coagulation pathway | 1 | 1142.0× | 0.002 | GP1BA |
| GP1b-IX-V activation signalling | 1 | 951.7× | 0.002 | GP1BA |
| Platelet Adhesion to exposed collagen | 1 | 671.8× | 0.002 | GP1BA |
| Amplification and propagation of coagulation cascade | 1 | 634.4× | 0.002 | GP1BA |
| Platelet Aggregation (Plug Formation) | 1 | 439.2× | 0.003 | GP1BA |
| Regulation of clotting cascade | 1 | 233.1× | 0.005 | GP1BA |
| RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function | 1 | 120.2× | 0.008 | GP1BA |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| blood coagulation, intrinsic pathway | 1 | 2106.5× | 0.003 | GP1BA |
| regulation of blood coagulation | 1 | 1872.4× | 0.003 | GP1BA |
| positive regulation of platelet activation | 1 | 1296.3× | 0.003 | GP1BA |
| fibrinolysis | 1 | 842.6× | 0.003 | GP1BA |
| megakaryocyte development | 1 | 702.2× | 0.003 | GP1BA |
| release of sequestered calcium ion into cytosol | 1 | 343.9× | 0.005 | GP1BA |
| platelet activation | 1 | 267.5× | 0.006 | GP1BA |
| blood coagulation | 1 | 173.7× | 0.008 | GP1BA |
| cell morphogenesis | 1 | 157.5× | 0.008 | GP1BA |
| cell surface receptor signaling pathway | 1 | 64.1× | 0.017 | GP1BA |
| cell adhesion | 1 | 37.5× | 0.027 | GP1BA |
Therapeutics
Drug target analysis
Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1
Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| GP1BA | 0 | 0 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 0.
Pharmacogenomics
Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 0 | |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 0 | |
| D | Druggable family + AlphaFold only, no drug | 0 | |
| E | Difficult family or no structure, no drug | 1 | GP1BA |
Undrugged target profiles
1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| GP1BA | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 0.
Related Atlas pages
- Cohort genes: GP1BA