Occipital pachygyria and polymicrogyria

Summary

Occipital pachygyria and polymicrogyria (MONDO:0013583) is a disease caused by LAMC3 (GenCC Definitive), with 2 cohort genes.

At a glance

• Prevalence: <1 / 1 000 000 (Worldwide) [Orphanet-validated]
• Causal gene: LAMC3 (GenCC Definitive)
• Cohort genes: 2
• ClinVar variants: 98

Clinical features

Epidemiology

Prevalence records

2 prevalence record(s), Orphanet:

Type	Class	Value	Geography	Validation
Cases/families		3	Worldwide	Validated
Point prevalence	<1 / 1 000 000		Worldwide	Validated

Identifiers

Disease identifiers

Field	Value
Canonical name	occipital pachygyria and polymicrogyria
Mondo ID	MONDO:0013583
OMIM	614115
Orphanet	280640
UMLS	C3279875
MedGen	481505
GARD	0017299
Is cancer (heuristic)	no

Also known as: cortical malformations, occipital · occipital malformations of cortical development · occipital MCD · OCCM

Data availability: 98 ClinVar variants · 7 GenCC gene-disease records.

Disease family

Classification path: disease › human disease › disease by body system or component › nervous system disorder › central nervous system disorder › brain disorder › occipital pachygyria and polymicrogyria

Related subtypes (70): leukoencephalopathy, megalencephalic, encephalopathy, acute, infection-induced, diabetic encephalopathy, complex cortical dysplasia with other brain malformations, hydrocephalus, brain compression, cerebral sarcoidosis, hepatic encephalopathy, visual pathway disorder, central nervous system origin vertigo, cerebellar disorder, cerebritis, olfactory nerve disorder, thalamic disorder, pituitary gland disorder, disorder of optic chiasm, basal ganglia disorder, epilepsy, mental disorder, central nervous system cyst, migraine disorder, multiple sclerosis, prion disease, carbon monoxide-induced delayed encephalopathy, cerebral malaria, akinetic mutism, bulbar polio, Reye syndrome, brain edema, encephalomalacia, intracranial hypertension, intracranial hypotension, Wernicke encephalopathy, encephalopathy, recurrent, of childhood, XK aprosencephaly, progressive bulbar palsy, cerebrovascular disorder, glycine encephalopathy, autosomal recessive frontotemporal pachygyria, insomnia, narcolepsy-cataplexy syndrome, megalencephaly, meningoencephalocele, cerebral cortical dysplasia, encephaloclastic disorder, bilirubin encephalopathy, autoimmune encephalopathy with parasomnia and obstructive sleep apnea, narcolepsy without cataplexy, hypothalamic hamartomas with gelastic seizures, encephalitis, cerebral lipidosis with dementia, brain neoplasm, colpocephaly, corpus callosum agenesis of blepharophimosis robin type, corpus callosum dysgenesis X-linked recessive, corpus callosum dysgenesis cleft spasm, corpus callosum dysgenesis hypopituitarism, cerebral degeneration, acute bilirubin encephalopathy, chronic bilirubin encephalopathy, atelencephaly, aprosencephaly, brain injury, traumatic encephalopathy, cluster headache syndrome, cerebral cortex disorder, midbrain disorder, encephalopathy due to mitochondrial and peroxisomal fission defect, brain malformations with or without urinary tract defects, encephalopathy, acute transient

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

98 retrieved; paginated sample, class counts are floors:

36 uncertain significance, 20 benign, 16 conflicting classifications of pathogenicity, 13 likely pathogenic, 5 pathogenic, 4 benign/likely benign, 3 likely benign, 1 pathogenic/likely pathogenic

ClinVar	Variant (HGVS)	Gene	Classification	Review
1376853	NM_006059.4(LAMC3):c.332dup (p.Val112fs)	LAMC3	Pathogenic	criteria provided, multiple submitters, no conflicts
2444494	NM_006059.4(LAMC3):c.3423dup (p.Pro1142fs)	LAMC3	Pathogenic	criteria provided, single submitter
2796410	NM_006059.4(LAMC3):c.3502_3503del (p.Asp1168fs)	LAMC3	Pathogenic/Likely pathogenic	criteria provided, multiple submitters, no conflicts
30417	NM_006059.4(LAMC3):c.470G>A (p.Trp157Ter)	LAMC3	Pathogenic	no assertion criteria provided
30418	NM_006059.4(LAMC3):c.1156C>T (p.Gln386Ter)	LAMC3	Pathogenic	no assertion criteria provided
3776179	NM_006059.4(LAMC3):c.1939+1G>A	LAMC3	Pathogenic	criteria provided, single submitter
1324653	NM_006059.4(LAMC3):c.2479_2480del (p.Leu827fs)	LAMC3	Likely pathogenic	criteria provided, single submitter
1464952	NM_006059.4(LAMC3):c.809+2_809+8del	LAMC3	Likely pathogenic	criteria provided, multiple submitters, no conflicts
1698556	NM_006059.4(LAMC3):c.2819del (p.Pro940fs)	LAMC3	Likely pathogenic	criteria provided, single submitter
1701766	NM_006059.4(LAMC3):c.3211+2T>C	LAMC3	Likely pathogenic	criteria provided, multiple submitters, no conflicts
1947260	NM_006059.4(LAMC3):c.1166-1G>A	LAMC3	Likely pathogenic	criteria provided, multiple submitters, no conflicts
2441103	NM_006059.4(LAMC3):c.63del (p.Met22fs)	LAMC3	Likely pathogenic	criteria provided, single submitter
30416	NM_006059.4(LAMC3):c.903_904del (p.Cys301_Glu302delinsTer)	LAMC3	Likely pathogenic	criteria provided, multiple submitters, no conflicts
3064937	NM_006059.4(LAMC3):c.1141C>T (p.Gln381Ter)	LAMC3	Likely pathogenic	criteria provided, single submitter
3377536	NM_006059.4(LAMC3):c.3470_3483delinsGGTGCT (p.Thr1157fs)	LAMC3	Likely pathogenic	criteria provided, single submitter
3391056	NM_006059.4(LAMC3):c.3718C>T (p.Gln1240Ter)	LAMC3	Likely pathogenic	criteria provided, single submitter
3897798	NM_006059.4(LAMC3):c.175G>T (p.Glu59Ter)	LAMC3	Likely pathogenic	criteria provided, single submitter
4845826	NM_006059.4(LAMC3):c.2811del (p.Cys938fs)	LAMC3	Likely pathogenic	criteria provided, single submitter
4849285	NM_006059.4(LAMC3):c.2891-94AACCCAGCACGCACTGCCCCTGGCCCCTCTA[2]	LAMC3	Likely pathogenic	criteria provided, single submitter
1032400	NM_006059.4(LAMC3):c.1185C>T (p.Cys395=)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1069700	NM_006059.4(LAMC3):c.3871C>T (p.Arg1291Ter)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
129450	NM_006059.4(LAMC3):c.1330C>T (p.Arg444Cys)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1371107	NM_006059.4(LAMC3):c.4093G>A (p.Val1365Ile)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1429474	NM_006059.4(LAMC3):c.976C>T (p.Pro326Ser)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
1502050	NM_006059.4(LAMC3):c.2593+1G>A	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
194074	NM_006059.4(LAMC3):c.2066C>T (p.Pro689Leu)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
194958	NM_006059.4(LAMC3):c.3250G>C (p.Glu1084Gln)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
194959	NM_006059.4(LAMC3):c.3379G>A (p.Glu1127Lys)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
211367	NM_006059.4(LAMC3):c.4160C>T (p.Ala1387Val)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
2555010	NM_006059.4(LAMC3):c.4447G>A (p.Glu1483Lys)	LAMC3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 9 · Orphanet: 3 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
LAMC3	Definitive	Autosomal recessive	occipital pachygyria and polymicrogyria	6
TBR1	Supportive	Autosomal recessive	occipital pachygyria and polymicrogyria	3

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
LAMC3	Orphanet:280640	Occipital pachygyria and polymicrogyria
TBR1	Orphanet:1617	Developmental delay-language impairment-dopa responsive dystonia-parkinsonism syndrome due to 2q24 microdeletion
TBR1	Orphanet:528084	Non-specific syndromic intellectual disability

Cohort genes → proteins

2 cohort genes, 2 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	2

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
LAMC3	HGNC:6494	ENSG00000050555	Q9Y6N6	Laminin subunit gamma-3	gencc,clinvar
TBR1	HGNC:11590	ENSG00000136535	Q16650	T-box brain protein 1	gencc

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
LAMC3	Laminin subunit gamma-3	Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components.
TBR1	T-box brain protein 1	Transcriptional repressor involved in multiple aspects of cortical development, including neuronal migration, laminar and areal identity, and axonal projection.

Protein-family classification

Druggable: 0 · Difficult: 1 · Unknown: 1 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Transcription factor	1	4.1×	0.455
Other/Unknown	1	0.9×	0.805

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
LAMC3	Other/Unknown	no		Laminin_IV, EGF, LE_dom
TBR1	Transcription factor	no		TF_T-box, p53-like_TF_DNA-bd_sf, TF_T-box_CS

Expression context

Cohort genes with no expression data: 0.

2 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	2
unknown	0

Top tissues across cohort

Tissue	Cohort genes
endocervix	1
metanephros cortex	1
right lung	1
Brodmann (1909) area 10	1
cortical plate	1
ganglionic eminence	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
LAMC3	184	broad	marker	endocervix, metanephros cortex, right lung
TBR1	58	tissue_specific	marker	cortical plate, ganglionic eminence, Brodmann (1909) area 10

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
TBR1	2,438
LAMC3	1,466

Structural data

PDB: 0 · AlphaFold-only: 2 · No structure: 0

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
LAMC3	Q9Y6N6	75.23
TBR1	Q16650	56.17

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 11. Enrichment computed across 2 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
MET promotes cell motility	1	601.0×	0.006	LAMC3
Attachment of bacteria to epithelial cells	1	496.5×	0.006	LAMC3
Laminin interactions	1	380.7×	0.006	LAMC3
MET activates PTK2 signaling	1	380.7×	0.006	LAMC3
Signaling by MET	1	317.2×	0.006	LAMC3
Formation of the dystrophin-glycoprotein complex (DGC)	1	308.6×	0.006	LAMC3
Developmental Lineage of Pancreatic Ductal Cells	1	228.4×	0.007	LAMC3
Non-integrin membrane-ECM interactions	1	154.3×	0.009	LAMC3
Extracellular matrix organization	1	63.1×	0.019	LAMC3
Signaling by Receptor Tyrosine Kinases	1	51.7×	0.021	LAMC3
Signal Transduction	1	10.2×	0.098	LAMC3

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
specification of animal organ identity	1	8426.0×	0.002	TBR1
conditioned taste aversion	1	2808.7×	0.003	TBR1
amygdala development	1	1404.3×	0.003	TBR1
commitment of neuronal cell to specific neuron type in forebrain	1	1404.3×	0.003	TBR1
regulation of axon guidance	1	1203.7×	0.003	TBR1
radial glial cell differentiation	1	766.0×	0.005	LAMC3
astrocyte development	1	561.7×	0.005	LAMC3
hindbrain development	1	561.7×	0.005	TBR1
cell fate specification	1	263.3×	0.009	TBR1
regulation of neuron projection development	1	216.1×	0.010	TBR1
retina development in camera-type eye	1	127.7×	0.015	LAMC3
cerebral cortex development	1	102.8×	0.017	TBR1
cell morphogenesis	1	78.8×	0.020	LAMC3
gene expression	1	39.9×	0.033	TBR1
brain development	1	39.8×	0.033	TBR1
visual perception	1	39.8×	0.033	LAMC3
chromatin remodeling	1	36.5×	0.034	TBR1
cell adhesion	1	18.7×	0.061	LAMC3
negative regulation of DNA-templated transcription	1	15.8×	0.069	TBR1
positive regulation of transcription by RNA polymerase II	1	7.4×	0.136	TBR1
regulation of transcription by RNA polymerase II	1	5.8×	0.164	TBR1

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 2

Druggability breadth: 1 of 2 evidence-associated genes (50%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
LAMC3	0	0
TBR1	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Pharmacogenomics

Cohort genes with a PharmGKB record: 2; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	2	LAMC3, TBR1

Undrugged target profiles

2 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
LAMC3	0	—
TBR1	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.