Otosclerosis

Summary

Otosclerosis (MONDO:0005349) is a disease (an umbrella term covering 11 Mondo subtypes) caused by SMARCA4 (GenCC Strong), with 2 cohort genes (53 GWAS associations across 6 studies) and 21 clinical trials. Top therapeutic interventions include acetylcysteine and tiludronic acid.

At a glance

• Causal gene: SMARCA4 (GenCC Strong)
• Umbrella term: 11 Mondo subtypes
• Cohort genes: 2
• GWAS associations: 53
• Clinical trials: 21

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	otosclerosis
Mondo ID	MONDO:0005349
EFO	EFO:0004213
MeSH	D010040
OMIM	166800
Orphanet	2794
DOID	DOID:12185
ICD-10-CM	H80
ICD-11	1242649410
NCIT	C185242
SNOMED CT	11543004
UMLS	C0029899
MedGen	10508
GARD	0027719
Is cancer (heuristic)	no

Also known as: otosclerosis · otosclerosis (disease)

Data availability: 53 GWAS associations (6 studies) · 1 GenCC gene-disease record · 1 HPO phenotype · 2 cell lines.

Disease family

An umbrella term covering 11 Mondo subtypes.

Classification path: disease › human disease › disease by body system or component › auditory system disorder › inner ear disorder › otosclerosis

Related subtypes (14): bilateral hyperactive labyrinth, labyrinthine bilateral reactive loss, labyrinthitis, labyrinthine unilateral reactive loss, unilateral hyperactive labyrinth, vestibular disorder, cochlear disorder, bilateral hypoactive labyrinth, unilateral hypoactive labyrinth, motion sickness, X-linked mixed hearing loss with perilymphatic gusher, autoimmune inner ear disease, enlarged vestibular aqueduct syndrome, inner ear neoplasm

Subtypes (11): otosclerosis 1, otosclerosis 2, otosclerosis 3, congenital corneal opacities, cornea guttata, and corectopia, otosclerosis 5, otosclerosis 4, otosclerosis 7, otosclerosis 8, otosclerosis 10, otosclerosis 11, otosclerosis 12

Genetics & variants

GWAS landscape

53 GWAS associations across 6 studies. Top hits map to 39 distinct genes (as reported by GWAS).

Top associations by p-value

rsID	p-value	Gene	Risk allele	Odds ratio
rs77249084	2e-23	LINC00536 - EIF3H	G	1.31
rs11868207	1e-22	LINC01482	C	1.34
rs12270054	4e-20	LTBP3	T	0.75
rs10592836	3e-18	MARK3	C	1.25
rs71900142	1e-15	LINC02644 - ZNF438	G	0.82
rs7995158	2e-15	COL4A2, COL4A2-AS2	G	0.82
rs39375	3e-14	RELN	C	1.21
rs791903	1e-13	IP6K3	C	0.83
rs4917	3e-12	AHSG, HRG-AS1	C	0.84
rs181831514	3e-12	HSP90AB3P - SPP1	T	12.3
rs13192457	5e-11	SUPT3H	A	1.21
rs4636903	7e-11	IRX5 - MTND5P34	T	1.28
rs67284550	1e-10	RPS3AP2 - PTX4	T	1.17
rs11683921	3e-10	ANAPC1	G	1.17
rs553652	9e-10	MAML2	A	1.3
rs73172296	1e-09	LINC02341 - TNFSF11	A	1.26
rs485107	2e-09	CLDN23 - MFHAS1	G	1.16
rs2762049	2e-09	DLEU1	C	1.16
rs201694067	4e-09	LYPLAL1-AS1 - ZC3H11B	T	1.19
rs4877080	4e-09	SEMA4D	A	0.83
rs6066825	1e-08	PREX1	G	1.16
rs3914132	2e-08	RELN	?	1.54
rs66487118	2e-08	DNMT1	A	1.16
rs2118612	3e-08	SMAD3	T	0.85
rs8105161	3e-08	TGFB1	C	0.83
rs4464751	4e-08	CD109	T	1.14
rs80339979	4e-08	NAMA	G	1.15
rs6066131	5e-08	EYA2	C	1.14
rs10806231	5e-08	LINC02542	C	0.87
rs61684469	6e-08	LINC00326	T	1.14

Top studies (by case count)

Study	Lead author	Year	Cases	Controls	Title
GCST90129575	Ramo JT	2023	3,504	861,198	Genome-wide screen of otosclerosis in population biobanks: 27 loci and shared associations with skeletal structure.
GCST90473490	UK Biobank Whole-Genome Sequencing Consortium	2025	1,024	457,416	Whole-genome sequencing of 490,640 UK Biobank participants.
GCST90481949	Verma A	2024	531	450,305	Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program.
GCST90436038	Zhou W	2018	310	404,888	Efficiently controlling for case-control imbalance and sample relatedness in large-scale genetic association studies.
GCST000345	Schrauwen I	2009	302	0	A genome-wide analysis identifies genetic variants in the RELN gene associated with otosclerosis.
GCST90043819	Jiang L	2021	288	456,060	A generalized linear mixed model association tool for biobank-scale data.

Variant details and genetic-evidence tiers

Tier distribution (top 50 variants)

Tier	Variants
Tier 1: coding	1
Tier 2: splice/UTR	2
Tier 3: regulatory	1
Tier 4: intronic/intergenic	46

MAF distribution

Bucket	Variants
common (>=0.05)	42
low_freq (0.01-0.05)	2
rare (<0.01)	6
unknown	0

Functional consequences

Consequence	Count
intron_variant	32
intergenic_variant	14
regulatory_region_variant	1
3_prime_UTR_variant	1
missense_variant	1
5_prime_UTR_variant	1

Top variants

rsID	Chr	Pos	Alleles	MAF	Consequence	Gene	p-value	Tier
rs77249084	8	116560300	A>C,G	0.3	regulatory_region_variant	LINC00536 - EIF3H	2e-23	Tier 3: regulatory
rs11868207	17	68679579	T>C	0.23	intron_variant	LINC01482	1e-22	Tier 4: intronic/intergenic
rs12270054	11	65555077	C>T	0.22	intron_variant	LTBP3	4e-20	Tier 4: intronic/intergenic
rs10592836	14	103471817	CAAT>C	0.34	intron_variant	MARK3	3e-18	Tier 4: intronic/intergenic
rs71900142	10	30775254	GCTTCTGGCTTAAGC>G,GCTTCTGGCTTAAGCCTTCTGGCTTAAGC	0.41	intergenic_variant	LINC02644 - ZNF438	1e-15	Tier 4: intronic/intergenic
rs7995158	13	110459370	A>G	0.45	3_prime_UTR_variant	COL4A2, COL4A2-AS2	2e-15	Tier 2: splice/UTR
rs39375	7	103837624	A>C,T	0.41	intron_variant	RELN	3e-14	Tier 4: intronic/intergenic
rs791903	6	33734868	G>C	0.5	intron_variant	IP6K3	1e-13	Tier 4: intronic/intergenic
rs4917	3	186619924	T>A,C	0.36	missense_variant	AHSG, HRG-AS1	3e-12	Tier 1: coding
rs181831514	4	87901594	C>T	0.002	intron_variant	HSP90AB3P - SPP1	3e-12	Tier 4: intronic/intergenic
rs13192457	6	44887654	C>A,G,T	0.44	intron_variant	SUPT3H	5e-11	Tier 4: intronic/intergenic
rs4636903	16	54995451	C>T	0.12	intergenic_variant	IRX5 - MTND5P34	7e-11	Tier 4: intronic/intergenic
rs67284550	16	1480948	C>T	0.42	intergenic_variant	RPS3AP2 - PTX4	1e-10	Tier 4: intronic/intergenic
rs11683921	2	111714056	T>A,C,G	0.38	intergenic_variant	ANAPC1	3e-10	Tier 4: intronic/intergenic
rs553652	11	96200151	G>A,C,T	0.08	intron_variant	MAML2	9e-10	Tier 4: intronic/intergenic
rs73172296	13	42525753	G>A	0.11	intergenic_variant	LINC02341 - TNFSF11	1e-09	Tier 4: intronic/intergenic
rs485107	8	8723898	C>G	0.47	intron_variant	CLDN23 - MFHAS1	2e-09	Tier 4: intronic/intergenic
rs2762049	13	50248227	G>C	0.39	intron_variant	DLEU1	2e-09	Tier 4: intronic/intergenic
rs201694067	1	219593024	TGA>T	0.33	intergenic_variant	LYPLAL1-AS1 - ZC3H11B	4e-09	Tier 4: intronic/intergenic
rs4877080	9	89398813	T>A,C,G	0.28	intron_variant	SEMA4D	4e-09	Tier 4: intronic/intergenic
rs6066825	20	48723580	A>G,T	0.32	intron_variant	PREX1	1e-08	Tier 4: intronic/intergenic
rs3914132	7	103886922	C>A,T	0.23	intron_variant	RELN	2e-08	Tier 4: intronic/intergenic
rs66487118	19	10142669	G>A	0.3	intron_variant	DNMT1	2e-08	Tier 4: intronic/intergenic
rs2118612	15	67108152	C>A,T	0.21	intron_variant	SMAD3	3e-08	Tier 4: intronic/intergenic
rs8105161	19	41333726	T>C	0.16	intron_variant	TGFB1	3e-08	Tier 4: intronic/intergenic
rs4464751	6	73707844	G>C,T	0.46	intron_variant	CD109	4e-08	Tier 4: intronic/intergenic
rs80339979	9	99889431	GA>G	0.36	intron_variant	NAMA	4e-08	Tier 4: intronic/intergenic
rs6066131	20	46941020	T>C,G	0.45	intron_variant	EYA2	5e-08	Tier 4: intronic/intergenic
rs10806231	6	81968979	T>C	0.39	intron_variant	LINC02542	5e-08	Tier 4: intronic/intergenic
rs61684469	6	132953615	TATCTATAAGTGA>T,TATCTATAAGTGAATCTATAAGTGA	0.43	intergenic_variant	LINC00326	6e-08	Tier 4: intronic/intergenic

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 14 · Orphanet: 6 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
SMARCA4	Strong	Autosomal dominant	otosclerosis	14

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
SMARCA4	Orphanet:1465	Coffin-Siris syndrome
SMARCA4	Orphanet:231108	Rhabdoid tumor predisposition syndrome
SMARCA4	Orphanet:370396	Small cell carcinoma of the ovary
SMARCA4	Orphanet:466962	SMARCA4-deficient sarcoma of thorax
RELN	Orphanet:101046	Epilepsy with auditory features
RELN	Orphanet:89844	Lissencephaly syndrome, Norman-Roberts type

Cohort genes → proteins

2 cohort genes, 2 distinct canonical proteins.

Evidence partition

Subset	Genes
gwas_only	1
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
SMARCA4	HGNC:11100	ENSG00000127616	P51532	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 4	gencc
RELN	HGNC:9957	ENSG00000189056	P78509	Reelin	gwas

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
SMARCA4	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 4	ATPase involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology).
RELN	Reelin	Extracellular matrix serine protease secreted by pioneer neurons that plays a role in layering of neurons in the cerebral cortex and cerebellum by coordinating cell positioning during neurodevelopment.

Protein-family classification

Druggable: 0 · Difficult: 0 · Unknown: 2 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Other/Unknown	2	1.8×	0.312

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
SMARCA4	Other/Unknown	no		SNF2_N, Bromodomain, Helicase_C-like
RELN	Other/Unknown	no		EGF, Reeler_dom, EGF_extracell

Expression context

Cohort genes with no expression data: 0.

2 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	2
unknown	0

Top tissues across cohort

Tissue	Cohort genes
cervix squamous epithelium	1
cortical plate	1
ganglionic eminence	1
cerebellar vermis	1
cerebellum	1
olfactory bulb	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
SMARCA4	295	ubiquitous	marker	ganglionic eminence, cortical plate, cervix squamous epithelium
RELN	254	broad	marker	olfactory bulb, cerebellar vermis, cerebellum

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
SMARCA4	8,138
RELN	2,305

Structural data

PDB: 2 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
SMARCA4	P51532	31
RELN	P78509	1

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 33. Enrichment computed across 2 evidence-associated genes (2 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Reelin signalling pathway	1	951.7×	0.022	RELN
Formation of the non-canonical BAF (ncBAF) complex	1	335.9×	0.022	SMARCA4
Formation of the canonical BAF (cBAF) complex	1	317.2×	0.022	SMARCA4
Formation of the polybromo-BAF (pBAF) complex	1	317.2×	0.022	SMARCA4
Formation of the embryonic stem cell BAF (esBAF) complex	1	300.5×	0.022	SMARCA4
Formation of neuronal progenitor and neuronal BAF (npBAF and nBAF)	1	228.4×	0.022	SMARCA4
EGR2 and SOX10-mediated initiation of Schwann cell myelination	1	184.2×	0.022	SMARCA4
Regulation of endogenous retroelements	1	184.2×	0.022	SMARCA4
Interleukin-7 signaling	1	158.6×	0.022	SMARCA4
RUNX1 interacts with co-factors whose precise effect on RUNX1 targets is not known	1	150.3×	0.022	SMARCA4
Regulation of MITF-M-dependent genes involved in pigmentation	1	132.8×	0.023	SMARCA4
MITF-M-dependent gene expression	1	90.6×	0.028	SMARCA4
RMTs methylate histone arginines	1	73.2×	0.028	SMARCA4
Transcriptional regulation by RUNX1	1	73.2×	0.028	SMARCA4
Differentiation of naive CD4+ T cells to T helper 2 cells (Th2 cells)	1	73.2×	0.028	SMARCA4
Formation of the beta-catenin:TCF transactivating complex	1	60.1×	0.028	SMARCA4
Negative Regulation of CDH1 Gene Transcription	1	60.1×	0.028	SMARCA4
TCF dependent signaling in response to WNT	1	58.9×	0.028	SMARCA4
Regulation of endogenous retroelements by Piwi-interacting RNAs (piRNAs)	1	58.9×	0.028	SMARCA4
MITF-M-regulated melanocyte development	1	57.1×	0.028	SMARCA4
Signaling by WNT	1	56.0×	0.028	SMARCA4
Chromatin organization	1	40.8×	0.037	SMARCA4
Chromatin modifying enzymes	1	36.1×	0.038	SMARCA4
Epigenetic regulation of gene expression	1	35.7×	0.038	SMARCA4
Signaling by Interleukins	1	32.1×	0.041	SMARCA4
Nervous system development	1	21.5×	0.058	SMARCA4
Cytokine Signaling in Immune system	1	20.4×	0.059	SMARCA4
RNA Polymerase II Transcription	1	11.3×	0.102	SMARCA4
Gene expression (Transcription)	1	8.9×	0.124	SMARCA4
Generic Transcription Pathway	1	7.5×	0.141	SMARCA4

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 2 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
spinal cord patterning	1	8426.0×	0.005	RELN
positive regulation of lateral motor column neuron migration	1	8426.0×	0.005	RELN
lateral motor column neuron migration	1	2808.7×	0.006	RELN
positive regulation of glucose mediated signaling pathway	1	2808.7×	0.006	SMARCA4
cerebral cortex tangential migration	1	2106.5×	0.006	RELN
regulation of synaptic activity	1	2106.5×	0.006	RELN
RNA polymerase I preinitiation complex assembly	1	1685.2×	0.006	SMARCA4
NMDA glutamate receptor clustering	1	1685.2×	0.006	RELN
postsynaptic density protein 95 clustering	1	1404.3×	0.006	RELN
positive regulation of small GTPase mediated signal transduction	1	1053.2×	0.006	RELN
receptor localization to synapse	1	1053.2×	0.006	RELN
ventral spinal cord development	1	936.2×	0.006	RELN
positive regulation of synapse maturation	1	936.2×	0.006	RELN
postsynaptic density assembly	1	936.2×	0.006	RELN
radial glial cell differentiation	1	766.0×	0.006	RELN
positive regulation of transcription of nucleolar large rRNA by RNA polymerase I	1	766.0×	0.006	SMARCA4
interneuron migration	1	766.0×	0.006	RELN
regulation of behavior	1	702.2×	0.006	RELN
reelin-mediated signaling pathway	1	601.9×	0.006	RELN
positive regulation of signal transduction by p53 class mediator	1	601.9×	0.006	SMARCA4
layer formation in cerebral cortex	1	561.7×	0.006	RELN
neural retina development	1	468.1×	0.006	SMARCA4
negative regulation of androgen receptor signaling pathway	1	468.1×	0.006	SMARCA4
glial cell differentiation	1	443.5×	0.006	RELN
host-mediated activation of viral transcription	1	443.5×	0.006	SMARCA4
response to pain	1	443.5×	0.006	RELN
positive regulation of dendritic spine morphogenesis	1	443.5×	0.006	RELN
nucleosome disassembly	1	401.2×	0.007	SMARCA4
protein localization to synapse	1	383.0×	0.007	RELN
regulation of neuron differentiation	1	366.4×	0.007	RELN

Therapeutics

Drugs indicated for this disease

0 approved, 1 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.

Drug	Development status
Tiludronic Acid	Phase 3 (in late-stage trials)

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 1 · Undrugged: 1

Druggability breadth: 1 of 2 evidence-associated genes (50%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
SMARCA4	2	2
RELN	0	0

Drugs targeting cohort genes (top 30)

Molecule	Max phase	Targets in cohort
MOLIBRESIB	2	SMARCA4
CAMIBIRSTAT	2	SMARCA4

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
SMARCA4	230	Binding:207, ADMET:12, Functional:11

Cohort genes with high screening signal

≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.

Symbol	ChEMBL assays
SMARCA4	230

Pharmacogenomics

Cohort genes with a PharmGKB record: 2; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

2 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Compound	Max phase	Cohort target (bioactivity)
MOLIBRESIB	2	SMARCA4
CAMIBIRSTAT	2	SMARCA4

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	1	SMARCA4
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	1	RELN

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
RELN	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 21.

Phase distribution (across all retrieved trials)

Phase	Trials
Not specified	19
PHASE4	1
PHASE3	1

Top trials by phase / activity

NCT	Phase	Status	Title
NCT00525551	PHASE4	COMPLETED	Efficacy of Acetylcysteine in Patients Undergoing Surgery for Otosclerosis
NCT01617057	PHASE3	TERMINATED	Therapeutic Efficacy of Tiludronic Acid on Inner Ear Involvement in Advanced Otosclerosis
NCT05921578	Not specified	RECRUITING	Cone-beam CT in the Diagnosis and Surgical Treatment of Otosclerosis.
NCT07304999	Not specified	NOT_YET_RECRUITING	Surgical and Audiological Outcomes of Endoscopic Stapes Surgery
NCT00222417	Not specified	UNKNOWN	Audiometric Parameters in Conductive Hearing Loss and Middle Ear Disease
NCT01855425	Not specified	COMPLETED	Cone Beam CT for Diagnosis of Select Otorhinolaryngology (ENT) Indications at Lower Dose
NCT02019888	Not specified	COMPLETED	Wide Frequency Band Test of Hearing in Veterans
NCT02435446	Not specified	TERMINATED	Cone Beam and CT Scan for the Diagnosis of Otosclerosis (TACOS)
NCT02456272	Not specified	COMPLETED	Hearing Aid Versus Surgical Rehabilitation as Treatment of Otosclerosis: Pilot Study
NCT02901093	Not specified	COMPLETED	Quantification of Prosthesis Penetration With Conebeam in Otosclerosis
NCT03888079	Not specified	COMPLETED	Patient Satisfaction After Surgery for Otosclerosis Under Local ou General Anesthesia
NCT04908839	Not specified	COMPLETED	Validation of the French Version of the Stapesplasty Outcome Test 25 (SPOT-25)
NCT05214053	Not specified	TERMINATED	Cone Beam vs MDCT for Diagnosis and Pre-operative Evaluation of Otosclerosis
NCT05799404	Not specified	UNKNOWN	Stapes Footplate Thickness Measured With UHR-CT
NCT05987215	Not specified	UNKNOWN	Interest of Using Deep Learning Algorithm for Otosclerosis Detection on Temporal Bone High Resolution CT
NCT06022471	Not specified	UNKNOWN	Outcome of Stapes Surgery in Otosclerotic Patients With Tinnitus Using Tinnitogram
NCT06179251	Not specified	UNKNOWN	KNOW HOW TO POSITION THE SACCULE AND UTRICULE IN SCANNING
NCT06221007	Not specified	COMPLETED	Long-Term Results of Bone Cement in Stapes Surgery
NCT06283836	Not specified	COMPLETED	Dexmedetomidine vs. Remifentanil Conscious Sedation for Stapedotomy/Stapedectomy
NCT06323863	Not specified	UNKNOWN	Ultra-high Resolution CT: the End of Stapes Prosthesis Measurement Misestimation
NCT06618053	Not specified	COMPLETED	The Cost-effectiveness of Stapes Surgery for Otosclerosis Performed Under Local Versus General Anesthesia

Drugs tested across these trials (top 30)

Molecule	Max phase	Trials referencing
ACETYLCYSTEINE	4	1
TILUDRONIC ACID	4	1