Periodontal disorder
diseaseOn this page
Also known as disease of periodontiumdisease or disorder of periodontiumdisorder of periodontiumperiodontal diseaseperiodontium diseaseperiodontium disease or disorder
Summary
Periodontal disorder (MONDO:0002635) is a disease with 20 GWAS associations across 8 studies and 674 clinical trials. Top therapeutic interventions include chlorhexidine, doxycycline anhydrous, and methylene blue cation. A subtype of skeletal system disorder — broader associated-gene and molecular evidence is on the parent page (see Disease family below).
At a glance
- GWAS associations: 20
- Clinical trials: 674
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | periodontal disorder |
| Mondo ID | MONDO:0002635 |
| MeSH | D010510 |
| DOID | DOID:3388 |
| NCIT | C63743 |
| SNOMED CT | 2556008 |
| UMLS | C0031090 |
| MedGen | 10658 |
| Anatomy (UBERON) | UBERON:0001758 |
| Is cancer (heuristic) | no |
Also known as: disease of periodontium · disease or disorder of periodontium · disorder of periodontium · periodontal disease · periodontal disorder · periodontium disease · periodontium disease or disorder
Data availability: 20 GWAS associations (8 studies).
Disease family
This is a subtype of skeletal system disorder. Genetic, therapeutic, and trial evidence is largely curated at the broader-term level — see the parent page for the associated-gene cohort and molecular evidence.
Classification path: disease › human disease › disease by body system or component › musculoskeletal system disorder › skeletal system disorder › periodontal disorder
Related subtypes (47): symphalangism, cartilage cancer, vertebral column disorder, patellar tendinitis, necrosis of ear ossicle, laryngeal cartilage cancer, ochronosis disorder, chondroma, posterior cranial fossa meningioma, anterior cranial fossa meningioma, middle cranial fossa meningioma, bone marrow disorder, cranial nodular fasciitis, flatfoot, bone disorder, skeletal tuberculosis, arthropathy, tooth disorder, primary basilar invagination, Brachymorphism-onychodysplasia-dysphalangism syndrome, cherubism, fibrodysplasia ossificans progressiva, Marfan syndrome, Buschke-Ollendorff syndrome, scalp defects-postaxial polydactyly syndrome, cartilage-hair hypoplasia, Teebi-Shaltout syndrome, short stature-auditory canal atresia-mandibular hypoplasia-skeletal anomalies syndrome, ossification of the posterior longitudinal ligament of the spine, temtamy preaxial brachydactyly syndrome, metaphyseal undermodeling, spondylar dysplasia, and overgrowth, Al-Gazali syndrome, brachydactyly-syndactyly syndrome, endocrine-cerebro-osteodysplasia syndrome, metaphyseal chondromatosis with D-2-hydroxyglutaric aciduria, multiple congenital anomalies-hypotonia-seizures syndrome 3, Rienhoff syndrome, Coffin-Siris syndrome, microcephaly-brachydactyly-kyphoscoliosis syndrome, cartilage development disorder, syndactyly, polydactyly, brachydactyly, sternal neoplasm, short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis, skeletal ligament disorder, brachydactyly-syndactyly-oligodactyly syndrome
Subtypes (4): gingival disorder, periodontitis, Papillon-Lefevre disease, regional odontodysplasia
Genetics & variants
GWAS landscape
20 GWAS associations across 8 studies. Top hits map to 10 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|---|---|---|---|
| rs4801882 | 2e-08 | SIGLEC5 | G | 5.66 |
| rs12624579 | 5e-07 | SYNDIG1 | T | 0.74 |
| rs142364448 | 1e-06 | LARP1B | G | 1.46 |
| rs75146159 | 1e-06 | DHFRP5 - FKBP1C | G | 1.19 |
| rs201237321 | 3e-06 | LINC01141 - CAMK2N1 | A | 1.22 |
| rs71624937 | 3e-06 | PPARG - TSEN2 | A | 1.39 |
| rs75384999 | 3e-06 | CFAP44 | A | 1.21 |
| rs11877743 | 4e-06 | NPM1P1 - PIK3C3 | A | 0.89 |
| rs117070266 | 4e-06 | MBP | T | 1.25 |
| rs11703014 | 4e-06 | EPIC1 - MIR3201 | T | 2.66 |
| rs72833931 | 5e-06 | AAK1 | T | 1.15 |
| rs16951530 | 5e-06 | LINC01228 - DYNLRB2-AS1 | A | 1.12 |
| rs12603336 | 6e-06 | CCR7 - SMARCE1 | C | 1.11 |
| rs3897709 | 6e-06 | LINC01904 - SLC25A3P3 | G | 0.91 |
| rs146949318 | 7e-06 | LINC01676 - SEPTIN2P1 | A | 1.64 |
| rs7636752 | 7e-06 | KALRN | C | 0.92 |
| rs550283829 | 7e-06 | FCHO2 | CTATT | 1.65 |
| rs72896186 | 8e-06 | ITGA4 | C | 1.1 |
| rs16844546 | 8e-06 | LINC02789 | G | 1.24 |
| rs144793564 | 8e-06 | CHCHD4P2 - RPL36P14 | C | 1.54 |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|---|---|---|---|---|
| GCST90565219 | Nogawa S | 2024 | 36,332 | 470,262 | Genome-wide association meta-analysis identifies two novel loci associated with dental caries. |
| GCST90565217 | Nogawa S | 2024 | 7,059 | 38,466 | Genome-wide association meta-analysis identifies two novel loci associated with dental caries. |
| GCST90473757 | UK Biobank Whole-Genome Sequencing Consortium | 2025 | 1,934 | 456,506 | Whole-genome sequencing of 490,640 UK Biobank participants. |
| GCST90080170 | Backman JD | 2021 | 1,081 | 386,036 | Exome sequencing and analysis of 454,787 UK Biobank participants. |
| GCST90084156 | Backman JD | 2021 | 1,081 | 386,036 | Exome sequencing and analysis of 454,787 UK Biobank participants. |
| GCST90726972 | Kim HI | 2026 | 912 | 43,114 | Exome sequencing and analysis of 44,028 British South Asians enriched for high autozygosity. |
| GCST90473758 | UK Biobank Whole-Genome Sequencing Consortium | 2025 | 809 | 457,631 | Whole-genome sequencing of 490,640 UK Biobank participants. |
| GCST90726973 | Kim HI | 2026 | 373 | 43,653 | Exome sequencing and analysis of 44,028 British South Asians enriched for high autozygosity. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|---|
| Tier 1: coding | 0 |
| Tier 2: splice/UTR | 1 |
| Tier 3: regulatory | 0 |
| Tier 4: intronic/intergenic | 19 |
MAF distribution
| Bucket | Variants |
|---|---|
| common (>=0.05) | 12 |
| low_freq (0.01-0.05) | 8 |
| rare (<0.01) | 0 |
| unknown | 0 |
Functional consequences
| Consequence | Count |
|---|---|
| intron_variant | 10 |
| intergenic_variant | 9 |
| 3_prime_UTR_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|---|---|---|---|---|---|---|---|
| rs4801882 | 19 | 51623800 | G>A | 0.05 | intron_variant | SIGLEC5 | 2e-08 | Tier 4: intronic/intergenic |
| rs12624579 | 20 | 24507057 | C>T | 0.079 | intron_variant | SYNDIG1 | 5e-07 | Tier 4: intronic/intergenic |
| rs142364448 | 4 | 128066678 | A>G | 0.022 | intron_variant | LARP1B | 1e-06 | Tier 4: intronic/intergenic |
| rs75146159 | 6 | 63210372 | A>G | 0.073 | intergenic_variant | DHFRP5 - FKBP1C | 1e-06 | Tier 4: intronic/intergenic |
| rs201237321 | 1 | 20454485 | G>A | 0.075 | intergenic_variant | LINC01141 - CAMK2N1 | 3e-06 | Tier 4: intronic/intergenic |
| rs71624937 | 3 | 12448369 | G>A,T | 0.019 | intergenic_variant | PPARG - TSEN2 | 3e-06 | Tier 4: intronic/intergenic |
| rs75384999 | 3 | 113332981 | G>A | 0.072 | intron_variant | CFAP44 | 3e-06 | Tier 4: intronic/intergenic |
| rs11877743 | 18 | 41816792 | A>G | 0.216 | intergenic_variant | NPM1P1 - PIK3C3 | 4e-06 | Tier 4: intronic/intergenic |
| rs117070266 | 18 | 76996198 | C>A,T | 0.042 | intron_variant | MBP | 4e-06 | Tier 4: intronic/intergenic |
| rs11703014 | 22 | 48102600 | C>T | 0.013 | intergenic_variant | EPIC1 - MIR3201 | 4e-06 | Tier 4: intronic/intergenic |
| rs72833931 | 2 | 69462377 | A>T | 0.135 | 3_prime_UTR_variant | AAK1 | 5e-06 | Tier 2: splice/UTR |
| rs16951530 | 16 | 79848461 | G>A | 0.179 | intergenic_variant | LINC01228 - DYNLRB2-AS1 | 5e-06 | Tier 4: intronic/intergenic |
| rs12603336 | 17 | 40613955 | T>C | 0.254 | intergenic_variant | CCR7 - SMARCE1 | 6e-06 | Tier 4: intronic/intergenic |
| rs3897709 | 18 | 936511 | A>G | 0.349 | intergenic_variant | LINC01904 - SLC25A3P3 | 6e-06 | Tier 4: intronic/intergenic |
| rs146949318 | 1 | 105669907 | T>A,G | 0.011 | intron_variant | LINC01676 - SEPTIN2P1 | 7e-06 | Tier 4: intronic/intergenic |
| rs7636752 | 3 | 124257947 | T>A,C,G | 0.493 | intron_variant | KALRN | 7e-06 | Tier 4: intronic/intergenic |
| rs550283829 | 5 | 73050295 | C>CTATCTATCTATT,CTATCTATCTATTTATT,CTATCTATT,CTATCTATTTATT,CTATCTATTTATTTATT,CTATCTATTTATTTATTTATT,CTATCTCTT | 0.025 | intron_variant | FCHO2 | 7e-06 | Tier 4: intronic/intergenic |
| rs72896186 | 2 | 181465856 | T>C,G | 0.285 | intron_variant | ITGA4 | 8e-06 | Tier 4: intronic/intergenic |
| rs16844546 | 1 | 199280238 | T>C,G | 0.04 | intron_variant | LINC02789 | 8e-06 | Tier 4: intronic/intergenic |
| rs144793564 | 9 | 108205577 | T>C | 0.011 | intergenic_variant | CHCHD4P2 - RPL36P14 | 8e-06 | Tier 4: intronic/intergenic |
Genes & proteins
No associated-gene cohort resolved for this disease. Atlas builds the molecular and therapeutic sections — associated genes, protein families, druggability, pathways, interactions, and drug associations — by aggregating over a disease’s associated genes (resolved via GWAS / GenCC / ClinVar / CIViC), and none resolved here. This is expected for antibody-mediated, autoimmune, or otherwise non-gene-defined conditions; the curated evidence for this disease is its clinical features, GWAS susceptibility, and clinical trials (above).
Function
No pathway enrichment — requires an associated-gene cohort.
Therapeutics
Drugs indicated for this disease
0 approved, 2 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
| Drug | Development status |
|---|---|
| Sodium Fluoride | Phase 3 (in late-stage trials) |
| Triclosan | Phase 3 (in late-stage trials) |
Earlier-phase candidates (phase 2, investigational — efficacy not yet established): Aloe, Amoxicillin, Chlorhexidine, Metronidazole, Olive Oil, Propolis Wax, Sodium Chloride.
Clinical trials & evidence
Clinical trials
Clinical trials: 674.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| Not specified | 577 |
| PHASE4 | 39 |
| PHASE3 | 21 |
| PHASE2 | 16 |
| PHASE1/PHASE2 | 6 |
| PHASE2/PHASE3 | 5 |
| EARLY_PHASE1 | 5 |
| PHASE1 | 5 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT04669717 | PHASE4 | RECRUITING | Antibiotics as Adjuncts to Periodontal Therapy:Pharmacokinetic Considerations and Dosing Strategies |
| NCT06894667 | PHASE4 | ACTIVE_NOT_RECRUITING | The Effect of an Antioxidant Gel Compared to Chlorhexidine Gel During the Soft Tissue Healing Process: A Randomized Controlled Clinical Trial |
| NCT07489924 | PHASE4 | ACTIVE_NOT_RECRUITING | Microbiological Effect of 0.12% Chlorhexidine Digluconate and 0.05% Cetylpyridinium Chloride vs Probiotics (Lactobacillus Reuteri Prodentis) on Porphyromonas Gingivalis. |
| NCT07602309 | PHASE4 | NOT_YET_RECRUITING | Tedlar Bag Stability of Volatile Sulfur Compounds for Remote Halitosis Diagnosis |
| NCT00064766 | PHASE4 | UNKNOWN | Norplant and Irregular Bleeding/Spotting |
| NCT00594334 | PHASE4 | WITHDRAWN | Effect of Actonel on Periodontal Health of Postmenopausal Women |
| NCT00757159 | PHASE4 | COMPLETED | Study on Regenerative Treatment of Intra-bony Defects |
| NCT01591616 | PHASE4 | COMPLETED | Pediatric Study to Access Pharmacokinetics and Safety of Oraqix Gel |
| NCT01798225 | PHASE4 | COMPLETED | Relationship of Periodontal Disease Treatment and Type 2 Diabetes Mellitus in the Gullah Population |
| NCT02102360 | PHASE4 | COMPLETED | Conventional or Minimally Invasive Surgical Technique for the Treatment of Furcation Defects Using Enamel Matrix Derivative and Anorganic Bovine Bone - a Randomized Controlled Clinical Trial. |
| NCT02185209 | PHASE4 | COMPLETED | Surgical Treatment of Peri-implantitis With and Without Systemically Adjunctive Antibiotics |
| NCT02202304 | PHASE4 | WITHDRAWN | The Effects of Chlorhexidine/Thymol Varnish on Partial Denture Patient |
| NCT02461030 | PHASE4 | COMPLETED | Efficacy of Two Oral Hygiene Regimens in the Reduction of Dentin Hypersensitivity After Periodontal Treatment |
| NCT02474498 | PHASE4 | COMPLETED | EMD and/or Bone Substitute for the Treatment of Class II Furcations |
| NCT02487186 | PHASE4 | COMPLETED | Locally Delivered Doxycycline Adjunct to Nonsurgical Periodontal Therapy. |
| NCT02500654 | PHASE4 | COMPLETED | Regenerative Surgical Treatment of Peri-implantitis |
| NCT02666573 | PHASE4 | COMPLETED | Photodynamic Therapy During Supportive Periodontal Therapy |
| NCT02670135 | PHASE4 | COMPLETED | Clinical Investigation of the Effects of Colgate Total Toothpaste as Compared to a Matching Placebo on Periodontal Disease and Systemic Inflammatory Markers |
| NCT02826109 | PHASE4 | UNKNOWN | The Efficacy of Cyanoacrylate Adhesive (PeriAcryl®90 HV) in Periodontal Wound Healing |
| NCT02935322 | PHASE4 | COMPLETED | Interaction Between Chlorhexidine and Fluoride |
| NCT02987634 | PHASE4 | UNKNOWN | Evaluation and Comparison of Efficacy of PeriActive Mouthwash to Chlorhexidine 0.12% Mouth Rinse |
| NCT03219840 | PHASE4 | COMPLETED | Cetylpyridium Chloride (CPC) Based Chewing Gum and Gingivitis |
| NCT03368430 | PHASE4 | COMPLETED | Melatonin as an Adjunctive Therapy for Chronic Periodontitis. |
| NCT03452891 | PHASE4 | COMPLETED | Effect of Locally-Applied Simvastatin on Clinical Attachment Level and Alveolar Bone in Periodontal Maintenance Patients |
| NCT04059445 | PHASE4 | TERMINATED | Mandibular Furcation II Regeneration |
| NCT04059458 | PHASE4 | TERMINATED | Mandibular Furcation III Regeneration (FURC-III-REGEN) |
| NCT04149327 | PHASE4 | COMPLETED | Systemic Amoxicillin Plus Metronidazole in Peri-implantitis Treatment |
| NCT04223076 | PHASE4 | UNKNOWN | Clinical Effect of Chlorhexidine Mouthwash After Periodontal Surgery |
| NCT04422184 | PHASE4 | COMPLETED | Comparative Clinical Evaluation of Three Different Agents in Reducing Dental Hypersensitivity in Periodontal Patients |
| NCT04450849 | PHASE4 | COMPLETED | Regenerative Potential of a Collagen Membrane Associated or Not to Bovine Bone in Class II Furcation Defects. |
| NCT04580355 | PHASE4 | UNKNOWN | Impact of Non-surgical Periodontal Therapy on Oral and Gut Microbiome |
| NCT05188924 | PHASE4 | UNKNOWN | Efficacy and Safety of DKF-306 in Patients With Periodontal Diseases |
| NCT05936450 | PHASE4 | COMPLETED | Assessment Of Healing After Periodontal Flap Surgery With And Without The Use Of Placental Extracts |
| NCT06836401 | PHASE4 | COMPLETED | Topical Metronidazole vs Control in Reducing Periodontal Pockets in a Split Mouth Clinical Trial |
| NCT06904742 | PHASE4 | COMPLETED | Clinical and Microbiological Evaluation Of The Efficacy Of Herbal Mouthwashes in Gingivitis |
| NCT07119307 | PHASE4 | COMPLETED | Papilla Preservation Technique in Combination With Tooth Enamel Proteins and Animal Derived Bone Graft in Treating Isolated Bone Defects Between Teeth |
| NCT07135674 | PHASE4 | COMPLETED | Evaluation of a Herbal Antiseptic Gel as a Supportive Treatment for Teeth Cleaning in Patients With Periodontal Disease |
| NCT07183631 | PHASE4 | COMPLETED | Healing of Intrabony Defects Following Treatment With PRF or EMD |
| NCT07605767 | PHASE4 | COMPLETED | Adjunctive Topical Melatonin Gel in Non-Surgical Periodontal Therapy for Periodontitis |
| NCT07553286 | PHASE3 | NOT_YET_RECRUITING | Periodontal Disease and Small Vulnerable Newborns in Rural Nepal: A Community-based Trial |
Drugs tested across these trials (top 30)
Related Atlas pages
- Drugs: Chlorhexidine, Doxycycline, Methylene Blue Cation, Triclosan, Lidocaine, Metronidazole, Amoxicillin, Apixaban, Dabigatran Etexilate, Fluvastatin, Hyaluronic Acid, Inulin, Melatonin, Methylcellulose, Minocycline, Penicillin V, Polihexanide, Prilocaine, Risedronic Acid, Fluoride Ion, Cetylpyridinium, Honey, Propolis Wax, Calcium Hydroxide, Cyproterone Acetate, Dabigatran, Licorice, Nitric Acid, Poliglusam, Propylene Glycol