Presbycusis

Summary

Presbycusis (MONDO:0043765) is a disease with 65 cohort genes (356 GWAS associations across 17 studies) and 23 clinical trials. The dominant Reactome pathway is Sensory processing of sound by outer hair cells of the cochlea (5 cohort genes). Top therapeutic interventions include huperzine a.

At a glance

• Cohort genes: 65
• GWAS associations: 356
• Clinical trials: 23

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	presbycusis
Mondo ID	MONDO:0043765
MeSH	D011304
ICD-10-CM	H91.1
ICD-11	1569854675
NCIT	C116367
SNOMED CT	49526009
UMLS	C0033074
MedGen	10911
Is cancer (heuristic)	no

Also known as: age-related hearing impairment · ARHI · Presbycuses · presbycusis

Data availability: 356 GWAS associations (17 studies).

Disease family

An umbrella term covering 2 Mondo subtypes.

Classification path: disease › human disease › disease by body system or component › auditory system disorder › hearing disorder › hearing loss disorder › sensorineural hearing loss disorder › presbycusis

Related subtypes (2): sudden sensorineural hearing loss, platinum-induced ototoxicity

Subtypes (2): age-related hearing impairment 1, age-related hearing impairment 2

Genetics & variants

GWAS landscape

356 GWAS associations across 17 studies. Top hits map to 27 distinct genes (as reported by GWAS).

Top associations by p-value

rsID	p-value	Gene	Risk allele	Odds ratio
rs36062310	4e-32	KLHDC7B	A	0.03
rs2125738	8e-28	ZNF318	?	1.06
rs11957938	2e-27	ARHGEF28	?	1.05
chr17:75927880	6e-27		?	4.2
rs10901863	2e-26	CTBP2	T	1.06
rs4413512	1e-25	ARHGEF28	A	0.01
rs2877561	3e-25	ILDR1	A	1.14
rs6453022	3e-23	ARHGEF28	A	1.05
rs34929759	1e-22	ARHGEF28	?	9.81
rs118174674	2e-22	LOXHD1	T	3.65
rs114926982	8e-22	TSBP1-AS1 - HLA-DRA	?	1.16
rs1126809	2e-21	TYR	A	1.05
rs759016271	6e-21	ZNF318	AGTAGTCCACTTTTCTTCTTTGCCTG	0.01
rs1981809	1e-20	UTP15 - ARHGEF28	T	0.01
rs137960856	2e-20	CHMP4C	T	1.56
rs4714678	7e-20	ZNF318 - ABCC10	A	0.01
rs72963168	4e-19	TYR	T	0.01
rs5756795	8e-19	TRIOBP	?	1.04
rs10948071	1e-18	ZNF318	?	8.84
rs2242416	1e-17	CRIP3	A	0.96
rs9493627	1e-17	EYA4	A	1.05
rs749405486	1e-16	KLHDC7B	?	2.39
rs2332035	2e-16	ILDR1	?	0.95
rs548522904	9e-16	GPBP1L1	?	1.05
rs6899939	1e-15	SYNJ2	?	1.04
rs121912560	3e-15	MYO6	?	30.67
rs1459651793	3e-15	COL11A2	?	6.93
rs1566129	4e-15	NID2	T	1.04
rs55635402	4e-15	TUB	?	0.95
rs143796236	4e-15	FSCN2	?	1.24

Top studies (by case count)

Study	Lead author	Year	Cases	Controls	Title
GCST90105058	Trpchevska N	2022	147,997	575,269	Genome-wide association meta-analysis identifies 48 risk variants and highlights the role of the stria vascularis in hearing loss.
GCST90132906	Praveen K	2022	125,749	469,497	Population-scale analysis of common and rare genetic variation associated with hearing loss in adults.
GCST90132907	Praveen K	2022	125,749	469,497	Population-scale analysis of common and rare genetic variation associated with hearing loss in adults.
GCST012442	Ivarsdottir EV	2021	121,934	591,699	The genetic architecture of age-related hearing impairment revealed by genome-wide association analysis.
GCST008899	Wells HRR	2019	87,056	163,333	GWAS Identifies 44 Independent Associated Genomic Loci for Self-Reported Adult Hearing Difficulty in UK Biobank.
GCST008898	Wells HRR	2019	13,178	240,740	GWAS Identifies 44 Independent Associated Genomic Loci for Self-Reported Adult Hearing Difficulty in UK Biobank.
GCST003763	Hoffmann TJ	2016	6,527	45,882	A Large Genome-Wide Association Study of Age-Related Hearing Impairment Using Electronic Health Records.
GCST90053841	Zainul Abidin FN	2021	228	0	Glucose hypometabolism in the Auditory Pathway in Age Related Hearing Loss in the ADNI cohort.
GCST90053842	Zainul Abidin FN	2021	228	0	Glucose hypometabolism in the Auditory Pathway in Age Related Hearing Loss in the ADNI cohort.
GCST90053843	Zainul Abidin FN	2021	228	0	Glucose hypometabolism in the Auditory Pathway in Age Related Hearing Loss in the ADNI cohort.

Variant details and genetic-evidence tiers

Tier distribution (top 50 variants)

Tier	Variants
Tier 1: coding	16
Tier 2: splice/UTR	1
Tier 3: regulatory	0
Tier 4: intronic/intergenic	33

MAF distribution

Bucket	Variants
common (>=0.05)	38
low_freq (0.01-0.05)	2
rare (<0.01)	0
unknown	10

Functional consequences

Consequence	Count
intron_variant	22
missense_variant	14
intergenic_variant	7
non_coding_transcript_exon_variant	2
unknown	1
synonymous_variant	1
splice_donor_5th_base_variant	1
frameshift_variant	1
inframe_insertion	1

Top variants

rsID	Chr	Pos	Alleles	MAF	Consequence	Gene	p-value	Tier
rs36062310	22	50549676	G>A,C,T	0.043	missense_variant	KLHDC7B	4e-32	Tier 1: coding
rs2125738	6	43360012	A>C,G,T	0.05	intron_variant	ZNF318	8e-28	Tier 4: intronic/intergenic
rs11957938	5	73777790	T>A,C,G	0.05	intron_variant	ARHGEF28	2e-27	Tier 4: intronic/intergenic
chr17:75927880							6e-27	Tier 4: intronic/intergenic
rs10901863	10	125123701	C>T	0.05	intron_variant	CTBP2	2e-26	Tier 4: intronic/intergenic
rs4413512	5	73781524	A>G	0.471	intron_variant	ARHGEF28	1e-25	Tier 4: intronic/intergenic
rs2877561	3	121993204	A>C,G,T	0.05	synonymous_variant	ILDR1	3e-25	Tier 4: intronic/intergenic
rs6453022	5	73780686	C>A,G,T	0.05	missense_variant	ARHGEF28	3e-23	Tier 1: coding
rs34929759	5	73777250	T>C	0.05	intron_variant	ARHGEF28	1e-22	Tier 4: intronic/intergenic
rs118174674	18	46557437	C>T	0.05	missense_variant	LOXHD1	2e-22	Tier 1: coding
rs114926982	6	32422420	A>G	0.05	intron_variant	TSBP1-AS1 - HLA-DRA	8e-22	Tier 4: intronic/intergenic
rs1126809	11	89284793	G>A	0.05	missense_variant	TYR	2e-21	Tier 1: coding
rs759016271	6	43313749		0.39	intergenic_variant	ZNF318	6e-21	Tier 4: intronic/intergenic
rs1981809	5	73624204	C>A,G,T	0.453	intergenic_variant	UTP15 - ARHGEF28	1e-20	Tier 4: intronic/intergenic
rs137960856	8	81753242	TGTGA>T	0.05	splice_donor_5th_base_variant	CHMP4C	2e-20	Tier 2: splice/UTR
rs4714678	6	43374853	A>G,T	0.403	intron_variant	ZNF318 - ABCC10	7e-20	Tier 4: intronic/intergenic
rs72963168	11	89209867	T>C	0.275	intron_variant	TYR	4e-19	Tier 4: intronic/intergenic
rs5756795	22	37726115	T>A,C	0.05	missense_variant	TRIOBP	8e-19	Tier 1: coding
rs10948071	6	43312975	C>A,G,T	0.05	intergenic_variant	ZNF318	1e-18	Tier 4: intronic/intergenic
rs2242416	6	43305866	A>C,G,T	0.05	missense_variant	CRIP3	1e-17	Tier 1: coding
rs9493627	6	133468590	G>A,C	0.05	missense_variant	EYA4	1e-17	Tier 1: coding
rs749405486	22	50549068	AG>A		frameshift_variant	KLHDC7B	1e-16	Tier 1: coding
rs2332035	3	121996585	T>A,C,G	0.05	intron_variant	ILDR1	2e-16	Tier 4: intronic/intergenic
rs548522904	1	45683752			intron_variant	GPBP1L1	9e-16	Tier 4: intronic/intergenic
rs6899939	6	158077058	T>A,C,G	0.05	intron_variant	SYNJ2	1e-15	Tier 4: intronic/intergenic
rs121912560	6	75841299	A>G		missense_variant	MYO6	3e-15	Tier 1: coding
rs1459651793	6	33189182	A>G		missense_variant	COL11A2	3e-15	Tier 1: coding
rs1566129	14	52048194	T>A,C	0.05	intron_variant	NID2	4e-15	Tier 4: intronic/intergenic
rs55635402	11	8035366	A>G,T	0.05	non_coding_transcript_exon_variant	TUB	4e-15	Tier 4: intronic/intergenic
rs143796236	17	81528943	C>T		missense_variant	FSCN2	4e-15	Tier 1: coding

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 0 · Orphanet: 60 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
SPTBN1	Orphanet:528084	Non-specific syndromic intellectual disability
TMPRSS3	Orphanet:90636	Rare autosomal recessive non-syndromic sensorineural deafness type DFNB
TUB	Orphanet:791	Retinitis pigmentosa
TYR	Orphanet:352734	Minimal pigment oculocutaneous albinism type 1
TYR	Orphanet:352737	Temperature-sensitive oculocutaneous albinism type 1
TYR	Orphanet:79431	Oculocutaneous albinism type 1A
TYR	Orphanet:79434	Oculocutaneous albinism type 1B
TYR	Orphanet:895	Waardenburg syndrome type 2
CDH23	Orphanet:231169	Usher syndrome type 1
CDH23	Orphanet:2965	Prolactinoma
CDH23	Orphanet:314777	Familial isolated pituitary adenoma
CDH23	Orphanet:90636	Rare autosomal recessive non-syndromic sensorineural deafness type DFNB
CDH23	Orphanet:91347	TSH-secreting pituitary adenoma
CDH23	Orphanet:96253	Cushing disease
CNTNAP2	Orphanet:163681	CNTNAP2-related developmental and epileptic encephalopathy
SLC4A11	Orphanet:1490	Corneal dystrophy-perceptive deafness syndrome
SLC4A11	Orphanet:293603	Congenital hereditary endothelial dystrophy type II
SLC4A11	Orphanet:98974	Fuchs endothelial corneal dystrophy
TRIOBP	Orphanet:90636	Rare autosomal recessive non-syndromic sensorineural deafness type DFNB
DEPDC5	Orphanet:442835	Non-specific early-onset epileptic encephalopathy
DEPDC5	Orphanet:98784	Sleep-related hypermotor epilepsy
DEPDC5	Orphanet:98820	Familial focal epilepsy with variable foci
LOXHD1	Orphanet:90636	Rare autosomal recessive non-syndromic sensorineural deafness type DFNB
ILDR1	Orphanet:90636	Rare autosomal recessive non-syndromic sensorineural deafness type DFNB
TBC1D24	Orphanet:163727	Rolandic epilepsy-paroxysmal exercise-induced dystonia-writer’s cramp syndrome
TBC1D24	Orphanet:293181	Epilepsy of infancy with migrating focal seizures
TBC1D24	Orphanet:352582	Familial infantile myoclonic epilepsy
TBC1D24	Orphanet:352587	Focal epilepsy-intellectual disability-cerebro-cerebellar malformation
TBC1D24	Orphanet:352596	Progressive myoclonic epilepsy with dystonia
TBC1D24	Orphanet:79500	DOORS syndrome
TBC1D24	Orphanet:90635	Rare autosomal dominant non-syndromic sensorineural deafness type DFNA
TBC1D24	Orphanet:90636	Rare autosomal recessive non-syndromic sensorineural deafness type DFNB
CCBE1	Orphanet:2136	Hennekam syndrome
ACAN	Orphanet:171866	Spondyloepimetaphyseal dysplasia, aggrecan type
ACAN	Orphanet:251262	Familial osteochondritis dissecans
ACAN	Orphanet:435804	Short stature-advanced bone age-early-onset osteoarthritis syndrome
ACAN	Orphanet:93283	Spondyloepiphyseal dysplasia, Kimberley type
AGO2	Orphanet:528084	Non-specific syndromic intellectual disability
MPZL2	Orphanet:90636	Rare autosomal recessive non-syndromic sensorineural deafness type DFNB
EYA4	Orphanet:217622	Sensorineural deafness with dilated cardiomyopathy
EYA4	Orphanet:90635	Rare autosomal dominant non-syndromic sensorineural deafness type DFNA
FSCN2	Orphanet:791	Retinitis pigmentosa
GRB10	Orphanet:96182	Silver-Russell syndrome due to maternal uniparental disomy of chromosome 7
HLA-DRB1	Orphanet:2073	Narcolepsy type 1
HLA-DRB1	Orphanet:220393	Diffuse cutaneous systemic sclerosis
HLA-DRB1	Orphanet:220402	Limited cutaneous systemic sclerosis
HLA-DRB1	Orphanet:220407	Limited systemic sclerosis
HLA-DRB1	Orphanet:3437	Vogt-Koyanagi-Harada disease
HLA-DRB1	Orphanet:397	Giant cell arteritis
HLA-DRB1	Orphanet:477738	Pediatric multiple sclerosis

Cohort genes → proteins

65 cohort genes, 64 distinct canonical proteins.

Evidence partition

Subset	Genes
gwas_only	65

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
SLC22A7	HGNC:10971	ENSG00000137204	Q9Y694	Solute carrier family 22 member 7	gwas
SPTBN1	HGNC:11275	ENSG00000115306	Q01082	Spectrin beta chain, non-erythrocytic 1	gwas
SYNJ2	HGNC:11504	ENSG00000078269	O15056	Synaptojanin-2	gwas
TBX2	HGNC:11597	ENSG00000121068	Q13207	T-box transcription factor TBX2	gwas
TMPRSS3	HGNC:11877	ENSG00000160183	P57727	Transmembrane protease serine 3	gwas
TUB	HGNC:12406	ENSG00000166402	P50607	Tubby protein homolog	gwas
TYR	HGNC:12442	ENSG00000077498	P14679	Tyrosinase	gwas
WDR3	HGNC:12755	ENSG00000065183	Q9UNX4	WD repeat-containing protein 3	gwas
NID2	HGNC:13389	ENSG00000087303	Q14112	Nidogen-2	gwas
ZNF318	HGNC:13578	ENSG00000171467	Q5VUA4	Zinc finger protein 318	gwas
CDH23	HGNC:13733	ENSG00000107736	Q9H251	Cadherin-23	gwas
CNTNAP2	HGNC:13830	ENSG00000174469	Q9UHC6	Contactin-associated protein-like 2	gwas
SNAP91	HGNC:14986	ENSG00000065609	O60641	Clathrin coat assembly protein AP180	gwas
CUL9	HGNC:15982	ENSG00000112659	Q8IWT3	Cullin-9	gwas
GALNT17	HGNC:16347	ENSG00000185274	Q6IS24	Polypeptide N-acetylgalactosaminyltransferase 17	gwas
SLC4A11	HGNC:16438	ENSG00000088836	Q8NBS3	Solute carrier family 4 member 11	gwas
EIF4ENIF1	HGNC:16687	ENSG00000184708	Q9NRA8	Eukaryotic translation initiation factor 4E transporter	gwas
SV2B	HGNC:16874	ENSG00000185518	Q7L1I2	Synaptic vesicle glycoprotein 2B	gwas
TRIOBP	HGNC:17009	ENSG00000100106	Q9H2D6	TRIO and F-actin-binding protein	gwas
ACVR1B	HGNC:172	ENSG00000135503	P36896	Activin receptor type-1B	gwas
CRIP3	HGNC:17751	ENSG00000146215	Q6Q6R5	Cysteine-rich protein 3	gwas
DEPDC5	HGNC:18423	ENSG00000100150	O75140	GATOR1 complex protein DEPDC5	gwas
TAMALIN	HGNC:18707	ENSG00000161835	Q7Z6J2	Protein TAMALIN	gwas
TTBK1	HGNC:19140	ENSG00000146216	Q5TCY1	Tau-tubulin kinase 1	gwas
DAOA	HGNC:21191	ENSG00000182346	P59103	D-amino acid oxidase regulator	gwas
DNPH1	HGNC:21218	ENSG00000112667	O43598	5-hydroxymethyl-dUMP N-hydrolase	gwas
HCG9	HGNC:21243	ENSG00000204625		HLA complex group 9	gwas
EXOC6	HGNC:23196	ENSG00000138190	Q8TAG9	Exocyst complex component 6	gwas
PHLDB1	HGNC:23697	ENSG00000019144	Q86UU1	Pleckstrin homology-like domain family B member 1	gwas
CCDC68	HGNC:24350	ENSG00000166510	Q9H2F9	Coiled-coil domain-containing protein 68	gwas
FBF1	HGNC:24674	ENSG00000188878	Q8TES7	Fas-binding factor 1	gwas
CTBP2	HGNC:2495	ENSG00000175029	P56545	C-terminal-binding protein 2	gwas
KLHDC7B	HGNC:25145	ENSG00000130487	Q96G42	Kelch domain-containing protein 7B	gwas
BAIAP2L2	HGNC:26203	ENSG00000128298	Q6UXY1	BAR/IMD domain-containing adapter protein 2-like 2	gwas
LOXHD1	HGNC:26521	ENSG00000167210	Q8IVV2	Lipoxygenase homology domain-containing protein 1	gwas
C10orf90	HGNC:26563	ENSG00000154493	Q96M02	(E2-independent) E3 ubiquitin-conjugating enzyme FATS	gwas
CCDC17	HGNC:26574	ENSG00000159588	Q96LX7	Coiled-coil domain-containing protein 17	gwas
PRR14L	HGNC:28738	ENSG00000183530	Q5THK1	Protein PRR14L	gwas
ILDR1	HGNC:28741	ENSG00000145103	Q86SU0	Immunoglobulin-like domain-containing receptor 1	gwas
ZNF536	HGNC:29025	ENSG00000198597	O15090	Zinc finger protein 536	gwas
SFI1	HGNC:29064	ENSG00000198089	A8K8P3	Protein SFI1 homolog	gwas
ABLIM3	HGNC:29132	ENSG00000173210	O94929	Actin-binding LIM protein 3	gwas
TBC1D24	HGNC:29203	ENSG00000162065	Q9ULP9	TBC1 domain family member 24	gwas
CCBE1	HGNC:29426	ENSG00000183287	Q6UXH8	Collagen and calcium-binding EGF domain-containing protein 1	gwas
TMPRSS9	HGNC:30079	ENSG00000178297	Q7Z410	Transmembrane protease serine 9	gwas
ARHGEF28	HGNC:30322	ENSG00000214944	Q8N1W1	Rho guanine nucleotide exchange factor 28	gwas
CHMP4C	HGNC:30599	ENSG00000164695	Q96CF2	Charged multivesicular body protein 4c	gwas
SH2D4B	HGNC:31440	ENSG00000178217	Q5SQS7	SH2 domain-containing protein 4B	gwas
ACAN	HGNC:319	ENSG00000157766	P16112	Aggrecan core protein	gwas
AGO2	HGNC:3263	ENSG00000123908	Q9UKV8	Protein argonaute-2	gwas

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
SLC22A7	Solute carrier family 22 member 7	Functions as a Na(+)-independent bidirectional multispecific transporter.
SPTBN1	Spectrin beta chain, non-erythrocytic 1	Fodrin, which seems to be involved in secretion, interacts with calmodulin in a calcium-dependent manner and is thus candidate for the calcium-dependent movement of the cytoskeleton at the membrane.
SYNJ2	Synaptojanin-2	Inositol 5-phosphatase which may be involved in distinct membrane trafficking and signal transduction pathways.
TBX2	T-box transcription factor TBX2	Transcription factor which acts as a transcriptional repressor.
TMPRSS3	Transmembrane protease serine 3	Probable serine protease that plays a role in hearing.
TUB	Tubby protein homolog	Functions in signal transduction from heterotrimeric G protein-coupled receptors.
TYR	Tyrosinase	This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds.
WDR3	WD repeat-containing protein 3	Part of the small subunit (SSU) processome, first precursor of the small eukaryotic ribosomal subunit.
NID2	Nidogen-2	Cell adhesion glycoprotein which is widely distributed in basement membranes.
ZNF318	Zinc finger protein 318	Acts as a transcriptional corepressor for AR-mediated transactivation function.
CDH23	Cadherin-23	Cadherins are calcium-dependent cell adhesion proteins.
CNTNAP2	Contactin-associated protein-like 2	Required for gap junction formation.
SNAP91	Clathrin coat assembly protein AP180	Adaptins are components of the adapter complexes which link clathrin to receptors in coated vesicles.
CUL9	Cullin-9	Core component of a Cul9-RING ubiquitin-protein ligase complex composed of CUL9 and RBX1.
GALNT17	Polypeptide N-acetylgalactosaminyltransferase 17	May catalyze the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor.
SLC4A11	Solute carrier family 4 member 11	Multifunctional transporter with an impact in cell morphology and differentiation.
EIF4ENIF1	Eukaryotic translation initiation factor 4E transporter	EIF4E-binding protein that regulates translation and stability of mRNAs in processing bodies (P-bodies).
SV2B	Synaptic vesicle glycoprotein 2B	Probably plays a role in the control of regulated secretion in neural and endocrine cells.
TRIOBP	TRIO and F-actin-binding protein	Regulates actin cytoskeletal organization, cell spreading and cell contraction by directly binding and stabilizing filamentous F-actin and prevents its depolymerization.
ACVR1B	Activin receptor type-1B	Transmembrane serine/threonine kinase activin type-1 receptor forming an activin receptor complex with activin receptor type-2 (ACVR2A or ACVR2B).
DEPDC5	GATOR1 complex protein DEPDC5	As a component of the GATOR1 complex functions as an inhibitor of the amino acid-sensing branch of the mTORC1 pathway.
TAMALIN	Protein TAMALIN	Plays a role in intracellular trafficking and contributes to the macromolecular organization of group 1 metabotropic glutamate receptors (mGluRs) at synapses.
TTBK1	Tau-tubulin kinase 1	Serine/threonine kinase which is able to phosphorylate TAU on serine, threonine and tyrosine residues.
DAOA	D-amino acid oxidase regulator	May suppress DAO (D-amino acid oxidase) and SOD1 activity and promote their degradation.
DNPH1	5-hydroxymethyl-dUMP N-hydrolase	Part of a nucleotide salvage pathway that eliminates epigenetically modified 5-hydroxymethyl-dCMP (hmdCMP) in a two-step process entailing deamination to cytotoxic 5-hydroxymethyl-dUMP (hmdUMP), followed by its hydrolysis into 5-hydroxymet…
EXOC6	Exocyst complex component 6	Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane.
CCDC68	Coiled-coil domain-containing protein 68	Centriolar protein required for centriole subdistal appendage assembly and microtubule anchoring in interphase cells.
FBF1	Fas-binding factor 1	Keratin-binding protein required for epithelial cell polarization.
CTBP2	C-terminal-binding protein 2	Corepressor targeting diverse transcription regulators.
BAIAP2L2	BAR/IMD domain-containing adapter protein 2-like 2	Phosphoinositides-binding protein that induces the formation of planar or gently curved membrane structures.
LOXHD1	Lipoxygenase homology domain-containing protein 1	Involved in hearing.
C10orf90	(E2-independent) E3 ubiquitin-conjugating enzyme FATS	Tumor suppressor that is required to sustain G2/M checkpoint after DNA damage.
ILDR1	Immunoglobulin-like domain-containing receptor 1	Maintains epithelial barrier function by recruiting MARVELD2/tricellulin to tricellular tight junctions (tTJs).
ZNF536	Zinc finger protein 536	Transcriptional repressor that negatively regulates neuron differentiation by repressing retinoic acid-induced gene transcription.
SFI1	Protein SFI1 homolog	Plays a role in the dynamic structure of centrosome-associated contractile fibers via its interaction with CETN2.
ABLIM3	Actin-binding LIM protein 3	May act as scaffold protein.
TBC1D24	TBC1 domain family member 24	May act as a GTPase-activating protein for Rab family protein(s).
CCBE1	Collagen and calcium-binding EGF domain-containing protein 1	Required for lymphangioblast budding and angiogenic sprouting from venous endothelium during embryogenesis.
TMPRSS9	Transmembrane protease serine 9	Serase-1 and serase-2 are serine proteases that hydrolyze the peptides N-t-Boc-Gln-Ala-Arg-AMC and N-t-Boc-Gln-Gly-Arg-AMC.
ARHGEF28	Rho guanine nucleotide exchange factor 28	Functions as a RHOA-specific guanine nucleotide exchange factor regulating signaling pathways downstream of integrins and growth factor receptors.
CHMP4C	Charged multivesicular body protein 4c	Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs.
ACAN	Aggrecan core protein	This proteoglycan is a major component of extracellular matrix of cartilagenous tissues.
AGO2	Protein argonaute-2	Required for RNA-mediated gene silencing (RNAi) by the RNA-induced silencing complex (RISC).
CLRN2	Clarin-2	Plays a key role to hearing function.
MPZL2	Myelin protein zero-like protein 2	Mediates homophilic cell-cell adhesion.
EYA4	Protein phosphatase EYA4	Tyrosine phosphatase that specifically dephosphorylates ‘Tyr-142’ of histone H2AX (H2AXY142ph). ‘Tyr-142’ phosphorylation of histone H2AX plays a central role in DNA repair and acts as a mark that distinguishes between apoptotic and repair…
FSCN2	Fascin-2	Acts as an actin bundling protein.
GRB10	Growth factor receptor-bound protein 10	Adapter protein which modulates coupling of a number of cell surface receptor kinases with specific signaling pathways.
HLA-DRB1	HLA class II histocompatibility antigen, DRB1 beta chain	A beta chain of antigen-presenting major histocompatibility complex class II (MHCII) molecule.
ABCC10	ATP-binding cassette sub-family C member 10	ATP-dependent transporter of the ATP-binding cassette (ABC) family that actively extrudes physiological compounds, and xenobiotics from cells.

Protein-family classification

Druggable: 15 · Difficult: 17 · Unknown: 33 · Druggable fraction: 0.23

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Transporter	4	4.8×	0.088
Scaffold/PPI	8	2.1×	0.149
Complement	1	4.1×	0.486
Antibody/Immunoglobulin	4	1.8×	0.486
Transcription factor	9	1.1×	0.699
Protease	2	1.1×	0.800
Kinase	2	0.8×	0.881
Other/Unknown	33	0.9×	0.932
Enzyme (other)	2	0.4×	0.976

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
SLC22A7	Transporter	yes		Orgcat_transp/SVOP, MFS, MFS_dom
SPTBN1	Scaffold/PPI	no		Actinin_actin-bd_CS, PH_dom-spectrin-type, CH_dom
SYNJ2	Other/Unknown	no		IPPc, RRM_dom, SAC_dom
TBX2	Transcription factor	no		TF_T-box, TF_Brachyury, p53-like_TF_DNA-bd_sf
TMPRSS3	Protease	yes		SRCR, Trypsin_dom, Peptidase_S1A
TUB	Other/Unknown	no		Tubby_C, Tubby_N, Tubby_C_CS
TYR	Enzyme (other)	yes	1.14.18.1	Tyrosinase_Cu-bd, Di-copper_centre_dom_sf, Tyrosinase/Hemocyanin
WDR3	Scaffold/PPI	no		WD40_rpt, SSU_processome_Utp12, WD40/YVTN_repeat-like_dom_sf
NID2	Other/Unknown	no		LDLR_classB_rpt, EGF-type_Asp/Asn_hydroxyl_site, Thyroglobulin_1
ZNF318	Transcription factor	no		Matrin/U1-like-C_Znf_C2H2, Znf318-like
CDH23	Other/Unknown	no		Cadherin-like_dom, Cadherin-like_sf, Cadherin_CS
CNTNAP2	Other/Unknown	no		FA58C, EGF, Laminin_G
SNAP91	Other/Unknown	no		ENTH_VHS, ANTH_dom, ENTH
CUL9	Transcription factor	no		Znf_RING, IBR_dom, APC_su10/DOC_dom
GALNT17	Other/Unknown	no		Ricin_B_lectin, Glyco_trans_2-like, Nucleotide-diphossugar_trans
SLC4A11	Other/Unknown	no		HCO3_transpt_euk, HCO3_transpt-like_TM_dom, PTrfase/Anion_transptr
EIF4ENIF1	Other/Unknown	no		eIF4E-T
SV2B	Transporter	yes		MFS_sugar_transport-like, Sugar_transporter_CS, MFS
TRIOBP	Scaffold/PPI	no		PH_domain, PH-like_dom_sf, M-RIP_PH
ACVR1B	Kinase	yes	2.7.10.2	TGFB_receptor, Activin_recp, Prot_kinase_dom
CRIP3	Transcription factor	no		Znf_LIM
DEPDC5	Other/Unknown	no		DEP_dom, IML1, WH-like_DNA-bd_sf
TAMALIN	Scaffold/PPI	no		PDZ, PDZ_sf, Intracell_Traff_Signaling_Reg
TTBK1	Kinase	yes	2.7.11.26	Prot_kinase_dom, Kinase-like_dom_sf, Protein_kinase_ATP_BS
DAOA	Other/Unknown	no		DAOA
DNPH1	Other/Unknown	no		Nucleoside_deoxyribTrfase, DNPH1, 2’-dNMP_N-hydrolase
HCG9	Other/Unknown	no
EXOC6	Other/Unknown	no		EXOC6/Sec15, EXOC6PINT-1/Sec15/Tip20_C_dom2, EXOC6/Sec15_C_dom1
PHLDB1	Scaffold/PPI	no		FHA_dom, PH_domain, SMAD_FHA_dom_sf
CCDC68	Other/Unknown	no		Tuftelin_GRINL1A/MYZAP/CCD68
FBF1	Other/Unknown	no		FBF1, FBF1_C
CTBP2	Other/Unknown	no		D-isomer_2_OHA_DH_cat_dom, D-isomer_DH_NAD-bd, D-isomer_DH_CS
KLHDC7B	Other/Unknown	no		Kelch_1, Kelch-typ_b-propeller, Kelch/BTB_domain_protein
BAIAP2L2	Transcription factor	no		SH3_domain, I-BAR_dom, AH/BAR_dom_sf
LOXHD1	Other/Unknown	no		PLAT/LH2_dom, PLAT/LH2_dom_sf, Inner_ear_hair_cell_LOXHD
C10orf90	Other/Unknown	no		ALMS_motif, C10orf90_N
CCDC17	Other/Unknown	no		CCDC17
PRR14L	Other/Unknown	no		PRR14, Tantalus-like
ILDR1	Antibody/Immunoglobulin	yes		Ig_sub, LISCH7, Ig-like_fold
ZNF536	Transcription factor	no		Znf_C2H2_type, Znf_C2H2_sf, Krueppel_C2H2-ZF
SFI1	Other/Unknown	no		CACF_protein
ABLIM3	Transcription factor	no		Znf_LIM, Villin_headpiece, AbLIM_anchor
TBC1D24	Other/Unknown	no		Rab-GAP-TBC_dom, TLDc_dom, Rab-GAP_TBC_sf
CCBE1	Other/Unknown	no		EGF-type_Asp/Asn_hydroxyl_site, EGF, EGF-like_Ca-bd_dom
TMPRSS9	Protease	yes		Trypsin_dom, Peptidase_S1A, LDrepeatLR_classA_rpt
ARHGEF28	Scaffold/PPI	no		DH_dom, PH_domain, PKC_DAG/PE
CHMP4C	Other/Unknown	no		Snf7_fam
SH2D4B	Scaffold/PPI	no		SH2, SH2D4B_SH2, SH2_dom_sf
ACAN	Complement	yes		Sushi_SCR_CCP_dom, Link_dom, EGF
AGO2	Other/Unknown	no		PAZ_dom, Piwi, RNaseH-like_sf

Expression context

Cohort genes with no expression data: 0.

55 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	1
moderate (6-20)	1
broad (>20)	63
unknown	0

Top tissues across cohort

Tissue	Cohort genes
middle temporal gyrus	6
left testis	6
right testis	6
apex of heart	6
male germ line stem cell (sensu Vertebrata) in testis	5
secondary oocyte	5
right lung	4
oocyte	4
granulocyte	4
C1 segment of cervical spinal cord	3
right uterine tube	3
gingival epithelium	3
cartilage tissue	3
corpus callosum	3
Brodmann (1909) area 23	3
lower lobe of lung	3
frontal pole	3
middle frontal gyrus	3
right adrenal gland cortex	3
sural nerve	3

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
SLC22A7	170	tissue_specific	yes	right lobe of liver, liver, adult mammalian kidney
SPTBN1	295	ubiquitous	marker	endothelial cell, trigeminal ganglion, skin of hip
SYNJ2	282	ubiquitous	marker	inferior vagus X ganglion, medial globus pallidus, C1 segment of cervical spinal cord
TBX2	236	ubiquitous	marker	right lung, right coronary artery, upper lobe of left lung
TMPRSS3	177	tissue_specific	marker	pancreatic ductal cell, right uterine tube, bronchial epithelial cell
TUB	240	ubiquitous	marker	substantia nigra pars reticulata, substantia nigra pars compacta, middle temporal gyrus
TYR	59	tissue_specific	marker	pigmented layer of retina, male germ line stem cell (sensu Vertebrata) in testis, upper leg skin
WDR3	278	ubiquitous	marker	cervix squamous epithelium, squamous epithelium, gingival epithelium
NID2	236	ubiquitous	marker	cartilage tissue, stromal cell of endometrium, tibia
ZNF318	274	ubiquitous	marker	left testis, right testis, testis
CDH23	161	broad	marker	ventricular zone, left ovary, right ovary
CNTNAP2	127	broad	marker	corpus callosum, superior frontal gyrus, C1 segment of cervical spinal cord
SNAP91	195	broad	marker	middle temporal gyrus, Brodmann (1909) area 23, cerebellar vermis
CUL9	275	ubiquitous	marker	right testis, left testis, right frontal lobe
GALNT17	199	broad	marker	trigeminal ganglion, dorsal root ganglion, cerebellar vermis
SLC4A11	197	broad	marker	nasal cavity epithelium, olfactory segment of nasal mucosa, metanephros cortex
EIF4ENIF1	283	ubiquitous	marker	secondary oocyte, oocyte, left testis
SV2B	202	broad	marker	middle temporal gyrus, Brodmann (1909) area 10, Brodmann (1909) area 23
TRIOBP	289	ubiquitous	marker	lower lobe of lung, cervix squamous epithelium, apex of heart
ACVR1B	296	ubiquitous	marker	secondary oocyte, oocyte, middle temporal gyrus
CRIP3	165	broad	yes	apex of heart, right testis, left testis
DEPDC5	236	ubiquitous	marker	paraflocculus, frontal pole, middle frontal gyrus
TAMALIN	239	ubiquitous	marker	right lung, upper lobe of left lung, left uterine tube
TTBK1	126	broad	yes	lateral nuclear group of thalamus, prefrontal cortex, postcentral gyrus
DAOA	1		marker	endothelial cell, upper leg skin, lower lobe of lung
DNPH1	243	ubiquitous	marker	right uterine tube, mucosa of transverse colon, right adrenal gland cortex
HCG9	124		yes	calcaneal tendon, male germ line stem cell (sensu Vertebrata) in testis, duodenum
EXOC6	249	ubiquitous	marker	deltoid, epithelial cell of pancreas, vastus lateralis
PHLDB1	281	ubiquitous	marker	sural nerve, tibial nerve, middle frontal gyrus
CCDC68	202	broad	marker	rectum, jejunal mucosa, right lung

Protein interactions among cohort

Intra-cohort edges: 29.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
AGO2	7,108
CTBP2	4,399
TYR	3,663
EIF4ENIF1	3,595
HLA-DRB1	3,448
ACADVL	2,988
CHMP4C	2,775
ZNF318	2,705
WDR3	2,623
ACVR1B	2,433

Intra-cohort edges

A	B	Sources
ABCC10	ZNF318	string_interaction
BAIAP2L2	CLRN2	string_interaction
BAIAP2L2	KLHDC7B	string_interaction
C10orf90	CLRN2	string_interaction
C10orf90	SH2D4B	string_interaction
CCDC68	FBF1	string_interaction
CCDC68	KLHDC7B	string_interaction
CDH23	LOXHD1	string_interaction
CDH23	SLC26A5	string_interaction
CDH23	TMPRSS3	string_interaction
CDH23	TRIOBP	string_interaction
CHMP4C	LMO7	biogrid_interaction
CHMP4C	SPTBN1	biogrid_interaction
CLRN2	KLHDC7B	string_interaction
CLRN2	SH2D4B	string_interaction
CRIP3	SH2D4B	string_interaction
FSCN2	KLHDC7B	string_interaction
HLA-DRB1	MPZL2	intact
ILDR1	LOXHD1	string_interaction
ILDR1	TMPRSS3	string_interaction
ILDR1	TRIOBP	string_interaction
KLHDC7B	SYNJ2	string_interaction
KLHDC7B	TRIOBP	string_interaction
LMO7	TAMALIN	intact
LOXHD1	SLC4A11	string_interaction
LOXHD1	TMPRSS3	string_interaction
LOXHD1	TRIOBP	string_interaction
SNAP91	SYNJ2	string_interaction
TMPRSS3	TRIOBP	string_interaction

Structural data

PDB: 32 · AlphaFold-only: 32 · No structure: 1

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
HLA-DRB1	P01911	108
AGO2	Q9UKV8	67
DNPH1	O43598	25
TTBK1	Q5TCY1	16
DEPDC5	O75140	11
CDH23	Q9H251	6
SV2B	Q7L1I2	6
CTBP2	P56545	5
CUL9	Q8IWT3	4
SLC4A11	Q8NBS3	4
CHMP4C	Q96CF2	4
ACAN	P16112	4
SLC26A5	P58743	4
SPTBN1	Q01082	3
WDR3	Q9UNX4	3
EIF4ENIF1	Q9NRA8	3
LMX1A	Q8TE12	3
ACADVL	P49748	3
ACVR1B	P36896	2
ABLIM3	O94929	2
ARHGEF28	Q8N1W1	2
GRB10	Q13322	2
ISG20	Q96AZ6	2
ATP6V0A4	Q9HBG4	2
SYNJ2	O15056	1
TUB	P50607	1
TYR	P14679	1
CNTNAP2	Q9UHC6	1
TAMALIN	Q7Z6J2	1
SFI1	A8K8P3	1

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
FSCN2	O14926	93.79
CLRN2	A0PK11	91.15
GALNT17	Q6IS24	90.68
MPZL2	O60487	89.54
TMPRSS3	P57727	87.09
NCALD	P61601	86.88
SLC22A7	Q9Y694	84.93
TBC1D24	Q9ULP9	84.46
LOXHD1	Q8IVV2	84.00
SH2D4B	Q5SQS7	83.87
EXOC6	Q8TAG9	82.02
ABCC10	Q5T3U5	81.32
CCDC68	Q9H2F9	81.20
TMPRSS9	Q7Z410	74.96
CRIP3	Q6Q6R5	74.81
NID2	Q14112	74.40
BAIAP2L2	Q6UXY1	71.34
KLHDC7B	Q96G42	69.93
CCDC17	Q96LX7	68.58
CCBE1	Q6UXH8	65.61
FBF1	Q8TES7	64.11
EYA4	O95677	63.79
PHLDB1	Q86UU1	60.40
ILDR1	Q86SU0	58.87
TBX2	Q13207	58.13
SNAP91	O60641	55.46
ZNF536	O15090	47.76
C10orf90	Q96M02	47.67
DAOA	P59103	46.78
ZNF318	Q5VUA4	41.32

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 218. Enrichment computed across 65 evidence-associated genes (39 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 39 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Sensory processing of sound by outer hair cells of the cochlea	5	26.1×	3e-04	SPTBN1, CDH23, TRIOBP, FSCN2, SLC26A5
Sensory processing of sound by inner hair cells of the cochlea	5	20.9×	4e-04	SPTBN1, CDH23, TRIOBP, CTBP2, FSCN2
Sensory processing of sound	3	23.7×	0.019	SPTBN1, CDH23, SLC26A5
Ionotropic activity of kainate receptors	1	146.4×	0.190	NCALD
Activation of kainate receptors upon glutamate binding	1	146.4×	0.190	NCALD
Toxicity of botulinum toxin type E (botE)	1	97.6×	0.190	SV2B
Beta oxidation of palmitoyl-CoA to myristoyl-CoA	1	97.6×	0.190	ACADVL
Toxicity of botulinum toxin type A (botA)	1	73.2×	0.190	SV2B
Signaling by TCF7L2 mutants	1	73.2×	0.190	CTBP2
Toxicity of botulinum toxin type D (botD)	1	58.6×	0.190	SV2B
Toxicity of botulinum toxin type F (botF)	1	58.6×	0.190	SV2B
Organic anion transport by SLC22 transporters	1	58.6×	0.190	SLC22A7
Melanin biosynthesis	1	58.6×	0.190	TYR
IRS activation	1	58.6×	0.190	GRB10
Regulation of NPAS4 gene expression	1	48.8×	0.190	AGO2
Post-transcriptional silencing by small RNAs	1	41.8×	0.190	AGO2
mitochondrial fatty acid beta-oxidation of saturated fatty acids	1	41.8×	0.190	ACADVL
Neurotoxicity of clostridium toxins	1	36.6×	0.190	SV2B
Defective CHST6 causes MCDC1	1	36.6×	0.190	ACAN
Defective ST3GAL3 causes MCT12 and EIEE15	1	36.6×	0.190	ACAN
Defective B4GALT1 causes B4GALT1-CDG (CDG-2d)	1	36.6×	0.190	ACAN
Competing endogenous RNAs (ceRNAs) regulate PTEN translation	1	36.6×	0.190	AGO2
Regulation of CDH11 mRNA translation by microRNAs	1	32.5×	0.190	AGO2
Regulation of NPAS4 mRNA translation	1	32.5×	0.190	AGO2
Regulation of PD-L1(CD274) translation	1	32.5×	0.190	AGO2
Small interfering RNA (siRNA) biogenesis	1	29.3×	0.190	AGO2
Activation of Ca-permeable Kainate Receptor	1	29.3×	0.190	NCALD
Regulation of PTEN mRNA translation	1	29.3×	0.190	AGO2
FLT3 signaling in disease	1	29.3×	0.190	SPTBN1
Purine catabolism	1	26.6×	0.190	DNPH1

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 58 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
sensory perception of sound	8	13.9×	4e-05	TMPRSS3, TUB, CDH23, TRIOBP, LOXHD1, CLRN2, ATP6V0A4, SLC26A5
auditory receptor cell stereocilium organization	3	43.6×	0.009	CDH23, TRIOBP, CLRN2
positive regulation of trophoblast cell migration	2	83.0×	0.035	ACVR1B, AGO2
response to salicylic acid	1	290.6×	0.065	SLC26A5
chemorepulsion of branchiomotor axon	1	290.6×	0.065	PLXNA4
regulation of interleukin-4 production	1	290.6×	0.065	HLA-DRB1
D-amino acid metabolic process	1	290.6×	0.065	DAOA
borate transport	1	290.6×	0.065	SLC4A11
regulation of negative chemotaxis	1	290.6×	0.065	PLXNA4
positive regulation of astrocyte activation	1	290.6×	0.065	TTBK1
siRNA-mediated gene silencing by mRNA destabilization	1	290.6×	0.065	AGO2
negative regulation of deadenylation-dependent decapping of nuclear-transcribed mRNA	1	290.6×	0.065	EIF4ENIF1
negative regulation of heart looping	1	290.6×	0.065	TBX2
negative regulation of cardiac chamber formation	1	290.6×	0.065	TBX2
positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	2	44.7×	0.065	EIF4ENIF1, AGO2
vesicle budding from membrane	2	38.7×	0.065	SNAP91, CHMP4C
P-body assembly	2	36.3×	0.065	EIF4ENIF1, AGO2
plasma membrane organization	2	30.6×	0.065	SPTBN1, BAIAP2L2
miRNA-mediated gene silencing by inhibition of translation	2	30.6×	0.065	EIF4ENIF1, AGO2
bicarbonate transport	2	27.7×	0.065	SLC4A11, SLC26A5
obsolete organic anion transport	2	27.7×	0.065	SLC22A7, ABCC10
embryonic heart tube development	2	26.4×	0.065	TBX2, PLXNA4
negative regulation of neuron differentiation	3	14.1×	0.065	EIF4ENIF1, ZNF536, LMX1A
antigen processing and presentation of endogenous peptide antigen via MHC class II	1	145.3×	0.071	HLA-DRB1
eye pigment biosynthetic process	1	145.3×	0.071	TYR
muscle cell fate determination	1	145.3×	0.071	TBX2
deoxyribonucleoside monophosphate catabolic process	1	145.3×	0.071	DNPH1
energy derivation by oxidation of organic compounds	1	145.3×	0.071	ACADVL
central nervous system formation	1	145.3×	0.071	SPTBN1
vagus nerve morphogenesis	1	145.3×	0.071	PLXNA4

Therapeutics

Drug target analysis

Approved (phase 4): 5 · Phase ≥3: 5 · Phased (≥1): 9 · Undrugged: 56

Druggability breadth: 17 of 65 evidence-associated genes (26%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Genes with an approved drug

The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.

Symbol	Example approved molecule
SYNJ2	PYRVINIUM
TYR	ASCORBIC ACID
ACVR1B	FEDRATINIB
DNPH1	ADENOSINE PHOSPHATE
AGO2	SULFANILAMIDE

Top cohort targets by molecule count

Symbol	Molecules	Max phase
ACVR1B	21	4
TYR	10	4
AGO2	4	4
SYNJ2	3	4
SPTBN1	1	2
WDR3	1	2
DNPH1	1	4
CTBP2	1	2
ACADVL	1	2
SLC22A7	0	0

Drugs targeting cohort genes (top 30)

Molecule	Max phase	Targets in cohort
PYRVINIUM	4	SYNJ2
CHLORHEXIDINE	4	SYNJ2
ASCORBIC ACID	4	TYR
HEXYLRESORCINOL	4	TYR
HYDROQUINONE	4	TYR
FEDRATINIB	4	ACVR1B
DABRAFENIB	4	ACVR1B
NINTEDANIB	4	ACVR1B
DASATINIB	4	ACVR1B
CRIZOTINIB	4	ACVR1B
ADENOSINE PHOSPHATE	4	DNPH1
SULFANILAMIDE	4	AGO2
SULFAGUANIDINE	4	AGO2
SULFISOMIDINE	4	AGO2
CURCUMIN	3	TYR
RESVERATROL	3	TYR
QUERCETIN	3	TYR
SARACATINIB	3	ACVR1B
CEDIRANIB	3	ACVR1B
LESTAURTINIB	3	ACVR1B
SURAMIN	3	AGO2
MOLIBRESIB	2	CTBP2, SPTBN1, WDR3
AMPELOPSIN	2	SYNJ2
BUTYLATED HYDROXYTOLUENE	2	TYR
LUTEOLIN	2	TYR
ARBUTIN	2	TYR
DORAMAPIMOD	2	ACVR1B
GALUNISERTIB	2	ACVR1B
OSI-632	2	ACVR1B
OSI-027	2	ACVR1B

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 5.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
ACVR1B	286	Binding:282, ADMET:3, Functional:1
TYR	211	Binding:209, ADMET:2
TTBK1	74	Binding:74
ABCC10	30	Functional:24, Binding:6
SLC22A7	24	Functional:18, ADMET:5, Binding:1
HLA-DRB1	17	Binding:17
DNPH1	13	Binding:13
CTBP2	10	Binding:10
GRB10	9	Binding:9
SPTBN1	7	Binding:7
SYNJ2	7	Binding:7
WDR3	6	Binding:6
AGO2	6	Binding:6
CUL9	2	Binding:2
ACADVL	2	Binding:2
PHLDB1	1	Binding:1

Cohort enzymes (BRENDA EC)

Symbol	EC numbers	Names
TYR	1.14.18.1	tyrosinase
ACVR1B	2.7.10.2	non-specific protein-tyrosine kinase
TTBK1	2.7.11.26	tau-protein kinase
ABCC10	7.6.2.2	ABC-type xenobiotic transporter
ACADVL	1.3.8.8, 1.3.8.9	long-chain acyl-CoA dehydrogenase, very-long-chain acyl-CoA dehydrogenase

Cohort genes with high screening signal

≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.

Symbol	ChEMBL assays
TYR	211
ACVR1B	286

Pharmacogenomics

Cohort genes with a PharmGKB record: 65; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

30 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Compound	Max phase	Cohort target (bioactivity)
PYRVINIUM	4	SYNJ2
CHLORHEXIDINE	4	SYNJ2
ASCORBIC ACID	4	TYR
HEXYLRESORCINOL	4	TYR
HYDROQUINONE	4	TYR
FEDRATINIB	4	ACVR1B
DABRAFENIB	4	ACVR1B
NINTEDANIB	4	ACVR1B
DASATINIB	4	ACVR1B
CRIZOTINIB	4	ACVR1B
ADENOSINE PHOSPHATE	4	DNPH1
SULFANILAMIDE	4	AGO2
SULFAGUANIDINE	4	AGO2
SULFISOMIDINE	4	AGO2
CURCUMIN	3	TYR
RESVERATROL	3	TYR
QUERCETIN	3	TYR
SARACATINIB	3	ACVR1B
CEDIRANIB	3	ACVR1B
LESTAURTINIB	3	ACVR1B
SURAMIN	3	AGO2
MOLIBRESIB	2	CTBP2, SPTBN1, WDR3
AMPELOPSIN	2	SYNJ2
BUTYLATED HYDROXYTOLUENE	2	TYR
LUTEOLIN	2	TYR
ARBUTIN	2	TYR
DORAMAPIMOD	2	ACVR1B
GALUNISERTIB	2	ACVR1B
OSI-632	2	ACVR1B
OSI-027	2	ACVR1B

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	5	SYNJ2, TYR, ACVR1B, DNPH1, AGO2
B	Phased (≥1) drug, not yet approved	4	SPTBN1, WDR3, CTBP2, ACADVL
C	Druggable family + PDB, no drug	6	SV2B, TTBK1, ACAN, HLA-DRB1, PLXNA4, SLC26A5
D	Druggable family + AlphaFold only, no drug	6	SLC22A7, TMPRSS3, ILDR1, TMPRSS9, MPZL2, ABCC10
E	Difficult family or no structure, no drug	44	TBX2, TUB, NID2, ZNF318, CDH23, CNTNAP2, SNAP91, CUL9, GALNT17, SLC4A11 (+34 more)

Undrugged target profiles

56 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
SLC22A7	24	—
TBX2	0	—
TMPRSS3	0	—
TUB	0	—
NID2	0	—
ZNF318	0	—
CDH23	0	—
CNTNAP2	0	—
SNAP91	0	—
CUL9	2	—
GALNT17	0	—
SLC4A11	0	—
EIF4ENIF1	0	—
SV2B	0	—
TRIOBP	0	—
CRIP3	0	—
DEPDC5	0	—
TAMALIN	0	—
TTBK1	74	—
DAOA	0	—
HCG9	0	—
EXOC6	0	—
PHLDB1	1	—
CCDC68	0	—
FBF1	0	—
KLHDC7B	0	—
BAIAP2L2	0	—
LOXHD1	0	—
C10orf90	0	—
CCDC17	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 23.

Phase distribution (across all retrieved trials)

Phase	Trials
Not specified	20
PHASE2	1
EARLY_PHASE1	1
PHASE1	1

Top trials by phase / activity

NCT	Phase	Status	Title
NCT05125081	PHASE2	COMPLETED	Efficacy and Safety of Liuwei Dihuang Pill Versus Placebo in Presbycusis With Shen (Kidney)-Yin Deficiency
NCT04601909	PHASE1	COMPLETED	FX-322 in Adults With Age-Related Sensorineural Hearing Loss
NCT01732289	EARLY_PHASE1	COMPLETED	Genetic Study of Age Related Hearing Loss
NCT03101722	Not specified	ENROLLING_BY_INVITATION	Effects of Huperzine a on Presbycusis(Δ,kHz, DB,MMSE, AD)
NCT06183450	Not specified	NOT_YET_RECRUITING	Hearing and Cognition in Aging Adults
NCT06499805	Not specified	RECRUITING	Barriers and Facilitators to OTC Hearing Aids Success
NCT06803394	Not specified	ENROLLING_BY_INVITATION	Hearing Health Equity Through Accessible Research and Solutions for Korean Americans
NCT07192757	Not specified	RECRUITING	Improving Speech in Noise Perception for Individuals With Age-related Hearing Loss
NCT00371449	Not specified	COMPLETED	Predicting Success With Hearing Aids
NCT00488007	Not specified	COMPLETED	Clinical Trial on Alzheimer Disease, Presbycusis and Hearing Aids
NCT01788423	Not specified	COMPLETED	Evaluating Hearing Aid Service Delivery Models
NCT01950013	Not specified	COMPLETED	At-home Auditory Training Clinical Trial
NCT02147847	Not specified	COMPLETED	Computer-Based Auditory Rehabilitation
NCT02448706	Not specified	COMPLETED	Variability In Hearing Aid Outcomes In Older Adults
NCT02729402	Not specified	COMPLETED	Evaluation of the Impact of Cochlear Implants on Cognition in Older Adults
NCT03579563	Not specified	COMPLETED	Impact of Hearing Aid Service-delivery Model and Technology on Patient Outcomes
NCT03638323	Not specified	COMPLETED	Age-related Hearing Loss and Lexical Disorders
NCT03720964	Not specified	UNKNOWN	Mitochondrial Genetics of Presbycusis
NCT04030299	Not specified	COMPLETED	Longitudinal Outcomes of Hearing Aids
NCT04200664	Not specified	COMPLETED	Audiovestibular Function in Infratentorial Superficial Siderosis
NCT04360109	Not specified	UNKNOWN	Study of the Association Between Presbycusis With the Incidence of Frailty
NCT04923087	Not specified	UNKNOWN	Impact of Auditory Stimulation in Eating Pleasure (EDERE 2021)
NCT06068933	Not specified	TERMINATED	Hearing Health for Korean American Older Adults With Mild Cognitive Impairment

Drugs tested across these trials (top 30)

Molecule	Max phase	Trials referencing
HUPERZINE A	2	1
CHEMBL394259	0	1