Summary
Rotator cuff syndrome (MONDO:0007028) is a disease with 14 cohort genes (19 GWAS associations across 12 studies) and 40 clinical trials. Top therapeutic interventions include dexamethasone and estrogen.
At a glance
- Cohort genes: 14
- GWAS associations: 19
- Clinical trials: 40
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|
| Canonical name | rotator cuff syndrome |
| Mondo ID | MONDO:0007028 |
| EFO | EFO:1001250 |
| ICD-10-CM | M75.1 |
| ICD-11 | 1471943310 |
| SNOMED CT | 4106009 |
| UMLS | C0263912 |
| MedGen | 538186 |
| Is cancer (heuristic) | no |
Data availability: 19 GWAS associations (12 studies).
Disease family
Classification path: disease › human disease › disease by body system or component › musculoskeletal system disorder › muscle tissue disorder › skeletal muscle disorder › rotator cuff syndrome
Related subtypes (12): anismus, skeletal muscle neoplasm, Volkmann contracture, myopathy, diaphragm disorder, anterior compartment of tibia syndrome, Cyprus facial-neuromusculoskeletal syndrome, Tel Hashomer camptodactyly syndrome, muscular dystrophy-white matter spongiosis syndrome, acquired skeletal muscle disease, myotonic syndrome, hereditary skeletal muscle disorder
Genetics & variants
GWAS landscape
19 GWAS associations across 12 studies. Top hits map to 15 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|
| rs141922545 | 3e-10 | LINC03126, CROCC | ? | |
| rs761804508 | 4e-10 | ACOT9 | A | 2.01 |
| rs144371252 | 2e-09 | FRMPD4 | A | 1.3 |
| rs145648292 | 3e-09 | C5orf63 | A | 1.59 |
| rs185496698 | 3e-09 | SERTM2 - EIF4BP7 | T | 3.41 |
| rs820218 | 4e-09 | SAP30BP | ? | |
| rs775583810 | 4e-09 | ZNF804A - ELF2P4 | T | 3.68 |
| rs575224171 | 5e-09 | THSD7A | T | 3.14 |
| rs143819145 | 6e-09 | CATSPER3 | ? | |
| rs4725069 | 7e-09 | GLCCI1 | T | 0.88 |
| rs71404070 | 2e-08 | GNPATP - RPS27AP16 | A | 1.25 |
| rs192110159 | 3e-08 | MIR3681HG | G | 2.41 |
| rs562775223 | 3e-08 | ASTN2 - RPL35AP22 | G | 2.1 |
| rs912336 | 3e-08 | STK24 | G | 0.86 |
| rs71509106 | 3e-08 | DEFB4B | ? | |
| rs13107325 | 4e-08 | SLC39A8 | T | 1.16 |
| rs2237352 | 4e-08 | CREB5 | C | 1.17 |
| rs12527089 | 2e-07 | SASH1 | ? | |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|
| GCST90479239 | Verma A | 2024 | 9,764 | 431,932 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST011374 | Roos TR | 2017 | 6,993 | 76,271 | Genome-wide association study identifies a locus associated with rotator cuff injury. |
| GCST90044700 | Tashjian RZ | 2020 | 5,701 | 406,310 | Genetic Variants Associated With Rotator Cuff Tearing Utilizing Multiple Population-Based Genetic Resources. |
| GCST90080533 | Backman JD | 2021 | 4,628 | 382,991 | Exome sequencing and analysis of 454,787 UK Biobank participants. |
| GCST90084519 | Backman JD | 2021 | 4,628 | 382,991 | Exome sequencing and analysis of 454,787 UK Biobank participants. |
| GCST011377 | Kim SK | 2021 | 3,864 | 614,568 | A Genome Wide Association Study For Shoulder Impingement and Rotator Cuff Disease. |
| GCST90020231 | Yanik EL | 2021 | 2,917 | 14,158 | Identification of a Novel Genetic Marker for Risk of Degenerative Rotator Cuff Disease Surgery in the UK Biobank. |
| GCST90479238 | Verma A | 2024 | 2,568 | 116,708 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90480976 | Verma A | 2024 | 2,568 | 116,708 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
| GCST90479237 | Verma A | 2024 | 1,323 | 57,324 | Diversity and scale: Genetic architecture of 2068 traits in the VA Million Veteran Program. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|
| Tier 1: coding | 2 |
| Tier 2: splice/UTR | 0 |
| Tier 3: regulatory | 0 |
| Tier 4: intronic/intergenic | 16 |
MAF distribution
| Bucket | Variants |
|---|
| common (>=0.05) | 10 |
| low_freq (0.01-0.05) | 1 |
| rare (<0.01) | 6 |
| unknown | 1 |
Functional consequences
| Consequence | Count |
|---|
| intron_variant | 12 |
| intergenic_variant | 4 |
| missense_variant | 2 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|
| rs141922545 | 1 | 16872023 | | | intron_variant | LINC03126, CROCC | 3e-10 | Tier 4: intronic/intergenic |
| rs761804508 | X | 23758874 | G>A | 0.007 | intergenic_variant | ACOT9 | 4e-10 | Tier 4: intronic/intergenic |
| rs144371252 | X | 12096802 | G>A | 0.084 | intron_variant | FRMPD4 | 2e-09 | Tier 4: intronic/intergenic |
| rs145648292 | 5 | 127073401 | G>A | 0.006 | intron_variant | C5orf63 | 3e-09 | Tier 4: intronic/intergenic |
| rs185496698 | X | 111594566 | C>G,T | 0.018 | intron_variant | SERTM2 - EIF4BP7 | 3e-09 | Tier 4: intronic/intergenic |
| rs820218 | 17 | 75691415 | G>A | 0.05 | intron_variant | SAP30BP | 4e-09 | Tier 4: intronic/intergenic |
| rs775583810 | 2 | 184966287 | C>T | 0.001 | intergenic_variant | ZNF804A - ELF2P4 | 4e-09 | Tier 4: intronic/intergenic |
| rs575224171 | 7 | 11393795 | G>A,T | 0.001 | intron_variant | THSD7A | 5e-09 | Tier 4: intronic/intergenic |
| rs143819145 | 5 | 135009570 | T>TGGTGCCTGTGTAGAGAGCAGGTGGCCTCAGGCATCTGCAGC,TGGTGCCTGTGTAGAGAGCAGGTGGCCTCAGGCATCTGCAGCGGTGCCTGTGTAGAGAGCAGGTGGCCTCAGGCATCTGCAGC | 0.05 | intron_variant | CATSPER3 | 6e-09 | Tier 4: intronic/intergenic |
| rs4725069 | 7 | 8092622 | T>A,C | 0.3 | intergenic_variant | GLCCI1 | 7e-09 | Tier 4: intronic/intergenic |
| rs71404070 | 16 | 61035911 | T>A | 0.05 | intergenic_variant | GNPATP - RPS27AP16 | 2e-08 | Tier 4: intronic/intergenic |
| rs192110159 | 2 | 12259621 | C>G,T | 0.001 | intron_variant | MIR3681HG | 3e-08 | Tier 4: intronic/intergenic |
| rs562775223 | 9 | 117445618 | C>G | 0.002 | intron_variant | ASTN2 - RPL35AP22 | 3e-08 | Tier 4: intronic/intergenic |
| rs912336 | 13 | 98525332 | G>A,C | 0.091 | intron_variant | STK24 | 3e-08 | Tier 4: intronic/intergenic |
| rs71509106 | 8 | 7416786 | A>C,G,T | 0.05 | missense_variant | DEFB4B | 3e-08 | Tier 1: coding |
| rs13107325 | 4 | 102267552 | C>A,T | 0.074 | missense_variant | SLC39A8 | 4e-08 | Tier 1: coding |
| rs2237352 | 7 | 28756292 | C>A,G,T | 0.468 | intron_variant | CREB5 | 4e-08 | Tier 4: intronic/intergenic |
| rs12527089 | 6 | 148466023 | C>T | 0.05 | intron_variant | SASH1 | 2e-07 | Tier 4: intronic/intergenic |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 6 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|
| SASH1 | Orphanet:231040 | Familial generalized lentiginosis |
| SASH1 | Orphanet:447961 | Pigmentation defects-palmoplantar keratoderma-skin carcinoma syndrome |
| SLC39A8 | Orphanet:468699 | SLC39A8-CDG |
| FRMPD4 | Orphanet:777 | X-linked non-syndromic intellectual disability |
| ALG13 | Orphanet:324422 | ALG13-CDG |
| ALG13 | Orphanet:777 | X-linked non-syndromic intellectual disability |
Cohort genes → proteins
14 cohort genes, 14 distinct canonical proteins.
Evidence partition
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|
| STK24 | HGNC:11403 | ENSG00000102572 | Q9Y6E0 | Serine/threonine-protein kinase 24 | gwas |
| UBE2D3 | HGNC:12476 | ENSG00000109332 | P61077 | Ubiquitin-conjugating enzyme E2 D3 | gwas |
| SLC38A1 | HGNC:13447 | ENSG00000111371 | Q9H2H9 | Sodium-coupled neutral amino acid symporter 1 | gwas |
| ASTN2 | HGNC:17021 | ENSG00000148219 | O75129 | Astrotactin-2 | gwas |
| ACOT9 | HGNC:17152 | ENSG00000123130 | Q9Y305 | Acyl-coenzyme A thioesterase 9, mitochondrial | gwas |
| CDH8 | HGNC:1767 | ENSG00000150394 | P55286 | Cadherin-8 | gwas |
| SASH1 | HGNC:19182 | ENSG00000111961 | O94885 | SAM and SH3 domain-containing protein 1 | gwas |
| SLC39A8 | HGNC:20862 | ENSG00000138821 | Q9C0K1 | Metal cation symporter ZIP8 | gwas |
| ZNF804A | HGNC:21711 | ENSG00000170396 | Q7Z570 | Zinc finger protein 804A | gwas |
| FRMPD4 | HGNC:29007 | ENSG00000169933 | Q14CM0 | FERM and PDZ domain-containing protein 4 | gwas |
| SAP30BP | HGNC:30785 | ENSG00000161526 | Q9UHR5 | SAP30-binding protein | gwas |
| ALG13 | HGNC:30881 | ENSG00000101901 | Q9NP73 | UDP-N-acetylglucosamine transferase subunit ALG13 | gwas |
| C5orf63 | HGNC:40051 | ENSG00000164241 | A6NC05 | Glutaredoxin-like protein C5orf63 | gwas |
| SERTM2 | HGNC:48576 | ENSG00000260802 | A0A1B0GWG4 | Serine-rich and transmembrane domain-containing protein 2 | gwas |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|
| STK24 | Serine/threonine-protein kinase 24 | Serine/threonine-protein kinase that acts on both serine and threonine residues and promotes apoptosis in response to stress stimuli and caspase activation. |
| UBE2D3 | Ubiquitin-conjugating enzyme E2 D3 | Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. |
| SLC38A1 | Sodium-coupled neutral amino acid symporter 1 | Symporter that cotransports short-chain neutral amino acids and sodium ions from the extracellular to the intracellular side of the cell membrane. |
| ASTN2 | Astrotactin-2 | Mediates recycling of the neuronal cell adhesion molecule ASTN1 to the anterior pole of the cell membrane in migrating neurons. |
| ACOT9 | Acyl-coenzyme A thioesterase 9, mitochondrial | Mitochondrial acyl-CoA thioesterase. |
| CDH8 | Cadherin-8 | Cadherins are calcium-dependent cell adhesion proteins. |
| SASH1 | SAM and SH3 domain-containing protein 1 | Is a positive regulator of NF-kappa-B signaling downstream of TLR4 activation. |
| SLC39A8 | Metal cation symporter ZIP8 | Electroneutral divalent metal cation:bicarbonate symporter of the plasma membrane mediating the cellular uptake of zinc and manganese, two divalent metal cations important for development, tissue homeostasis and immunity. |
| FRMPD4 | FERM and PDZ domain-containing protein 4 | Positive regulator of dendritic spine morphogenesis and density. |
| SAP30BP | SAP30-binding protein | Plays a role in transcriptional repression by promoting histone deacetylase activity, leading to deacetylation of histone H3. |
| ALG13 | UDP-N-acetylglucosamine transferase subunit ALG13 | Catalytic subunit of the UDP-N-acetylglucosamine transferase complex that operates in the biosynthetic pathway of dolichol-linked oligosaccharides, the glycan precursors employed in protein asparagine (N)-glycosylation. |
| SERTM2 | Serine-rich and transmembrane domain-containing protein 2 | Promotes GDNF-mediated spinal cord motor neuron subtype specification, ensuring the maintenance of ETV4-expressing motor neurons. |
Protein-family classification
Druggable: 4 · Difficult: 3 · Unknown: 7 · Druggable fraction: 0.29
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|
| Complement | 1 | 19.1× | 0.357 |
| Transporter | 1 | 5.6× | 0.580 |
| Kinase | 1 | 2.0× | 0.761 |
| Scaffold/PPI | 1 | 1.2× | 0.761 |
| Transcription factor | 2 | 1.2× | 0.761 |
| Other/Unknown | 7 | 0.9× | 0.761 |
| Enzyme (other) | 1 | 0.9× | 0.761 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|
| STK24 | Kinase | yes | | Prot_kinase_dom, Kinase-like_dom_sf, Protein_kinase_ATP_BS |
| UBE2D3 | Enzyme (other) | yes | 2.3.2.23 | UBC, UBQ-conjugating_enzyme/RWD, UBQ-conjugating_AS |
| SLC38A1 | Other/Unknown | no | | AA_transpt_TM |
| ASTN2 | Complement | yes | | MACPF, Astrotactin, FN3_sf |
| ACOT9 | Other/Unknown | no | | Thioestr_dom, HotDog_dom_sf, HOTDOG_ACOT |
| CDH8 | Other/Unknown | no | | Cadherin_Y-type_LIR, Cadherin-like_dom, Cadherin-like_sf |
| SASH1 | Transcription factor | no | | SH3_domain, SAM, SAM/pointed_sf |
| SLC39A8 | Transporter | yes | | ZIP, ZIP_Transporter |
| ZNF804A | Transcription factor | no | | Znf_C2H2_type, Znf_C2H2_sf, ZNF804A-like/GPATCH8 |
| FRMPD4 | Scaffold/PPI | no | | FERM_domain, WW_dom, PDZ |
| SAP30BP | Other/Unknown | no | | SAP30BP |
| ALG13 | Other/Unknown | no | | Tudor, OTU_dom, Glyco_trans_28_C |
| C5orf63 | Other/Unknown | no | | Glutaredoxin-like, Thioredoxin-like_sf, Glutaredoxin-like_YDR286C |
| SERTM2 | Other/Unknown | no | | SERTM |
Expression context
Cohort genes with no expression data: 0.
14 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 14 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|
| secondary oocyte | 3 |
| Brodmann (1909) area 23 | 3 |
| buccal mucosa cell | 2 |
| calcaneal tendon | 2 |
| endothelial cell | 2 |
| amniotic fluid | 1 |
| esophagus squamous epithelium | 1 |
| oocyte | 1 |
| sperm | 1 |
| lateral nuclear group of thalamus | 1 |
| seminal vesicle | 1 |
| superficial temporal artery | 1 |
| dorsal root ganglion | 1 |
| trigeminal ganglion | 1 |
| heart left ventricle | 1 |
| prefrontal cortex | 1 |
| lateral globus pallidus | 1 |
| skin of hip | 1 |
| synovial joint | 1 |
| lower lobe of lung | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|
| STK24 | 295 | ubiquitous | marker | secondary oocyte, esophagus squamous epithelium, amniotic fluid |
| UBE2D3 | 295 | ubiquitous | marker | secondary oocyte, oocyte, sperm |
| SLC38A1 | 282 | ubiquitous | marker | lateral nuclear group of thalamus, seminal vesicle, superficial temporal artery |
| ASTN2 | 236 | ubiquitous | marker | buccal mucosa cell, trigeminal ganglion, dorsal root ganglion |
| ACOT9 | 278 | ubiquitous | marker | secondary oocyte, heart left ventricle, calcaneal tendon |
| CDH8 | 188 | broad | marker | endothelial cell, Brodmann (1909) area 23, prefrontal cortex |
| SASH1 | 293 | ubiquitous | marker | synovial joint, lateral globus pallidus, skin of hip |
| SLC39A8 | 269 | ubiquitous | marker | parotid gland, lower lobe of lung, visceral pleura |
| ZNF804A | 144 | broad | marker | ganglionic eminence, Brodmann (1909) area 10, Brodmann (1909) area 23 |
| FRMPD4 | 117 | broad | marker | middle temporal gyrus, endothelial cell, Brodmann (1909) area 23 |
| SAP30BP | 291 | ubiquitous | marker | sural nerve, peripheral nervous system, nerve |
| ALG13 | 287 | ubiquitous | marker | calcaneal tendon, adrenal tissue, right uterine tube |
| C5orf63 | 232 | ubiquitous | marker | tendon of biceps brachii, buccal mucosa cell, left ventricle myocardium |
| SERTM2 | 75 | tissue_specific | marker | body of uterus, myometrium, prostate gland |
Protein interactions among cohort
Intra-cohort edges: 1.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|
| FRMPD4 | 2,222 |
| ALG13 | 2,071 |
| STK24 | 2,041 |
| SAP30BP | 1,734 |
| SLC38A1 | 1,613 |
| ASTN2 | 1,610 |
| ACOT9 | 1,608 |
| CDH8 | 1,563 |
| SLC39A8 | 1,364 |
| UBE2D3 | 1,200 |
Intra-cohort edges
| A | B | Sources |
|---|
| SAP30BP | SASH1 | string_interaction |
Structural data
PDB: 6 · AlphaFold-only: 8 · No structure: 0
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|
| UBE2D3 | P61077 | 45 |
| STK24 | Q9Y6E0 | 40 |
| FRMPD4 | Q14CM0 | 5 |
| ASTN2 | O75129 | 3 |
| SAP30BP | Q9UHR5 | 3 |
| SASH1 | O94885 | 2 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|
| ACOT9 | Q9Y305 | 85.31 |
| SLC38A1 | Q9H2H9 | 79.81 |
| CDH8 | P55286 | 77.26 |
| SLC39A8 | Q9C0K1 | 73.46 |
| SERTM2 | A0A1B0GWG4 | 67.49 |
| ALG13 | Q9NP73 | 54.42 |
| ZNF804A | Q7Z570 | 45.51 |
| C5orf63 | A6NC05 | 45.45 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 56. Enrichment computed across 14 evidence-associated genes (8 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 8 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|
| Defective ALG14 causes ALG14-CMS | 1 | 713.8× | 0.053 | ALG13 |
| Neurotransmitter uptake and metabolism In glial cells | 1 | 475.8× | 0.053 | SLC38A1 |
| Astrocytic Glutamate-Glutamine Uptake And Metabolism | 1 | 237.9× | 0.053 | SLC38A1 |
| CDH11 homotypic and heterotypic interactions | 1 | 203.9× | 0.053 | CDH8 |
| Zinc transporters | 1 | 142.8× | 0.053 | SLC39A8 |
| Zinc influx into cells by the SLC39 gene family | 1 | 142.8× | 0.053 | SLC39A8 |
| Regulation of CDH11 function | 1 | 129.8× | 0.053 | CDH8 |
| Regulation of CDH11 Expression and Function | 1 | 102.0× | 0.053 | CDH8 |
| Regulation of Homotypic Cell-Cell Adhesion | 1 | 84.0× | 0.053 | CDH8 |
| Regulation of Expression and Function of Type II Classical Cadherins | 1 | 84.0× | 0.053 | CDH8 |
| Diseases associated with N-glycosylation of proteins | 1 | 79.3× | 0.053 | ALG13 |
| TICAM1, RIP1-mediated IKK complex recruitment | 1 | 75.1× | 0.053 | UBE2D3 |
| Metal ion SLC transporters | 1 | 75.1× | 0.053 | SLC39A8 |
| SLC-mediated transmembrane transport | 2 | 14.8× | 0.053 | SLC38A1, SLC39A8 |
| IKK complex recruitment mediated by RIP1 | 1 | 62.1× | 0.055 | UBE2D3 |
| Apoptotic cleavage of cellular proteins | 1 | 59.5× | 0.055 | STK24 |
| Apoptotic execution phase | 1 | 59.5× | 0.055 | STK24 |
| Inactivation of CSF3 (G-CSF) signaling | 1 | 54.9× | 0.056 | UBE2D3 |
| Mitochondrial Fatty Acid Beta-Oxidation | 1 | 47.6× | 0.057 | ACOT9 |
| Downregulation of SMAD2/3:SMAD4 transcriptional activity | 1 | 46.0× | 0.057 | UBE2D3 |
| Signaling by BMP | 1 | 44.6× | 0.057 | UBE2D3 |
| PINK1-PRKN Mediated Mitophagy | 1 | 44.6× | 0.057 | UBE2D3 |
| Negative regulators of DDX58/IFIH1 signaling | 1 | 40.8× | 0.059 | UBE2D3 |
| Amino acid transport across the plasma membrane | 1 | 37.6× | 0.061 | SLC38A1 |
| Negative epigenetic regulation of rRNA expression | 1 | 32.4× | 0.066 | SAP30BP |
| Adherens junctions interactions | 1 | 31.0× | 0.066 | CDH8 |
| Cell-cell junction organization | 1 | 31.0× | 0.066 | CDH8 |
| Regulation of TNFR1 signaling | 1 | 28.0× | 0.070 | UBE2D3 |
| Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein | 1 | 25.9× | 0.071 | ALG13 |
| Transport of small molecules | 2 | 6.3× | 0.071 | SLC38A1, SLC39A8 |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 12 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|
| leukocyte adhesion to arterial endothelial cell | 1 | 1404.3× | 0.014 | SLC39A8 |
| plasma membrane selenite transport | 1 | 1404.3× | 0.014 | SLC39A8 |
| regulation of protein K63-linked ubiquitination | 1 | 1404.3× | 0.014 | SASH1 |
| regulation of protein autoubiquitination | 1 | 1404.3× | 0.014 | SASH1 |
| mitochondrial manganese ion transmembrane transport | 1 | 1404.3× | 0.014 | SLC39A8 |
| protein N-linked glycosylation | 2 | 43.9× | 0.015 | SLC39A8, ALG13 |
| mercury ion transport | 1 | 702.2× | 0.018 | SLC39A8 |
| iron ion import across plasma membrane | 1 | 702.2× | 0.018 | SLC39A8 |
| short-chain fatty acid metabolic process | 1 | 468.1× | 0.018 | ACOT9 |
| positive regulation of synapse structural plasticity | 1 | 468.1× | 0.018 | FRMPD4 |
| manganese ion transmembrane transport | 1 | 468.1× | 0.018 | SLC39A8 |
| cellular detoxification of cadmium ion | 1 | 468.1× | 0.018 | SLC39A8 |
| intracellular manganese ion homeostasis | 1 | 280.9× | 0.020 | SLC39A8 |
| amino acid import | 1 | 280.9× | 0.020 | SLC38A1 |
| establishment of body hair planar orientation | 1 | 280.9× | 0.020 | ASTN2 |
| cadmium ion transmembrane transport | 1 | 280.9× | 0.020 | SLC39A8 |
| positive regulation of dendritic spine maintenance | 1 | 280.9× | 0.020 | ZNF804A |
| cartilage homeostasis | 1 | 280.9× | 0.020 | SLC39A8 |
| regulation of epithelial cell migration | 1 | 234.1× | 0.021 | SASH1 |
| L-alpha-amino acid transmembrane transport | 1 | 234.1× | 0.021 | SLC38A1 |
| arginine metabolic process | 1 | 200.6× | 0.021 | SLC39A8 |
| cobalt ion transport | 1 | 200.6× | 0.021 | SLC39A8 |
| regulation of axon regeneration | 1 | 200.6× | 0.021 | STK24 |
| protein polyubiquitination | 2 | 19.2× | 0.021 | UBE2D3, SASH1 |
| GABA biosynthetic process | 1 | 175.5× | 0.022 | SLC38A1 |
| L-glutamine import across plasma membrane | 1 | 175.5× | 0.022 | SLC38A1 |
| zinc ion import across plasma membrane | 1 | 140.4× | 0.026 | SLC39A8 |
| zinc ion transport | 1 | 127.7× | 0.027 | SLC39A8 |
| positive regulation of lipopolysaccharide-mediated signaling pathway | 1 | 127.7× | 0.027 | SASH1 |
| neurotransmitter uptake | 1 | 117.0× | 0.027 | SLC38A1 |
Therapeutics
Drugs indicated or in trials for this disease
No drug has an approved disease-direct ChEMBL indication for this disease.
17 drugs in clinical trials for this disease (phase 2–3, investigational): efficacy not established — a trial record, not an indication.
Drug target analysis
Approved (phase 4): 1 · Phase ≥3: 1 · Phased (≥1): 2 · Undrugged: 12
Druggability breadth: 5 of 14 evidence-associated genes (36%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|
| STK24 | NERATINIB |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|
| STK24 | 18 | 4 |
| SAP30BP | 1 | 2 |
| UBE2D3 | 0 | 0 |
| SLC38A1 | 0 | 0 |
| ASTN2 | 0 | 0 |
| ACOT9 | 0 | 0 |
| CDH8 | 0 | 0 |
| SASH1 | 0 | 0 |
| SLC39A8 | 0 | 0 |
| ZNF804A | 0 | 0 |
Drugs targeting cohort genes (top 30)
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 1.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|
| STK24 | 314 | Binding:314 |
| UBE2D3 | 18 | Binding:18 |
| SAP30BP | 7 | Binding:7 |
| SLC38A1 | 2 | Binding:2 |
| ACOT9 | 1 | Binding:1 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|
| UBE2D3 | 2.3.2.23, 2.3.2.24 | E2 ubiquitin-conjugating enzyme, (E3-independent) E2 ubiquitin-conjugating enzyme |
Cohort genes with high screening signal
≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.
| Symbol | ChEMBL assays |
|---|
| STK24 | 314 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 14; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
19 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
| Compound | Max phase | Cohort target (bioactivity) |
|---|
| NERATINIB | 4 | STK24 |
| BOSUTINIB | 4 | STK24 |
| GILTERITINIB | 4 | STK24 |
| NINTEDANIB | 4 | STK24 |
| SUNITINIB | 4 | STK24 |
| QUIZARTINIB | 4 | STK24 |
| LOSMAPIMOD | 3 | STK24 |
| CRENOLANIB | 3 | STK24 |
| DOVITINIB | 3 | STK24 |
| LESTAURTINIB | 3 | STK24 |
| SU-014813 | 2 | STK24 |
| GOLVATINIB | 2 | STK24 |
| TOZASERTIB | 2 | STK24 |
| PELITINIB | 2 | STK24 |
| MOLIBRESIB | 2 | SAP30BP |
| KW-2449 | 1 | STK24 |
| PF-03758309 | 1 | STK24 |
| PF-03814735 | 1 | STK24 |
| AST-487 | 1 | STK24 |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|
| A | Approved (phase 4 drug) | 1 | STK24 |
| B | Phased (≥1) drug, not yet approved | 1 | SAP30BP |
| C | Druggable family + PDB, no drug | 2 | UBE2D3, ASTN2 |
| D | Druggable family + AlphaFold only, no drug | 1 | SLC39A8 |
| E | Difficult family or no structure, no drug | 9 | SLC38A1, ACOT9, CDH8, SASH1, ZNF804A, FRMPD4, ALG13, C5orf63, SERTM2 |
Undrugged target profiles
12 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|
| SASH1 | 0 | SAP30BP |
| UBE2D3 | 18 | — |
| SLC38A1 | 2 | — |
| ASTN2 | 0 | — |
| ACOT9 | 1 | — |
| CDH8 | 0 | — |
| SLC39A8 | 0 | — |
| ZNF804A | 0 | — |
| FRMPD4 | 0 | — |
| ALG13 | 0 | — |
| C5orf63 | 0 | — |
| SERTM2 | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 40.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|
| Not specified | 35 |
| PHASE3 | 2 |
| PHASE2 | 2 |
| PHASE1 | 1 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|
| NCT01702233 | PHASE3 | COMPLETED | TRARO (Traumeel® S in Rotator Cuff Syndrome)-Study |
| NCT05648032 | PHASE3 | UNKNOWN | PLT and Steroid in Lateral Epicondylopathy and Supraspinatus Calcific Tendinopathy |
| NCT06318403 | PHASE2 | NOT_YET_RECRUITING | Estradiol Supplementation and Rotator Cuff Repair |
| NCT02495818 | PHASE2 | COMPLETED | Suprascapular Nerve Block Guided by Ultrasound |
| NCT01355549 | PHASE1 | COMPLETED | Platelet-Rich Plasma Therapy for Shoulder Pain in Persons With Spinal Cord Injury |
| NCT05976035 | Not specified | NOT_YET_RECRUITING | Exercise vs. Supplements in Rotator Cuff-Related Shoulder Pain |
| NCT06016439 | Not specified | NOT_YET_RECRUITING | Outcomes of Massive Rotator Cuff Tendon Tear Treatment. |
| NCT06228625 | Not specified | RECRUITING | Comparison of Rehabilitative Game Exercise and Body Awareness Therapy in Rotator Cuff Syndrome |
| NCT06276192 | Not specified | NOT_YET_RECRUITING | Digital Physiotherapy Treatment for Patients With Subacromial Pain Compared to Usual Physiotherapy in Primary Care |
| NCT06435494 | Not specified | ENROLLING_BY_INVITATION | Cross-sectorial Use of Patient-Reported Outcomes in Chronic Degenerative Shoulder Conditions |
| NCT06723730 | Not specified | RECRUITING | ADDITIONAL EFFECTS OF MOBILIZATION WITH MOVEMENT WITH UPPER QUADRANT CORE STRENGTHENING IN ROTATOR CUFF RELATED PAIN:A RANDOMIZED CONTROLLED TRAIL |
| NCT07093905 | Not specified | RECRUITING | Study Comparing Two Anesthetics for Arthroscopic Rotator Cuff Repair |
| NCT07183774 | Not specified | RECRUITING | Does Sarcopenia Influence Rotator Cuff Tear Patterns? Radiological Insights From Patients With Rotator Cuff Syndrome |
| NCT07294729 | Not specified | ACTIVE_NOT_RECRUITING | Mulligan and Proprioceptive Neuromuscular Facilitation Techniques in Individuals With Rotator Cuff Lesions |
| NCT07376811 | Not specified | NOT_YET_RECRUITING | Effect Of Sleeping Posture Guidance On Sleep Quality In Patients With Rotator Cuff Syndrome |
| NCT07390227 | Not specified | NOT_YET_RECRUITING | Virtual Reality Intervention in Patients With Persistent Shoulder Pain |
| NCT07464639 | Not specified | ENROLLING_BY_INVITATION | Comparison of Dynamic Ultrasound Visual Feedback to Manual Feedback on Scapular Stabilizer Activation and Change in the Subacromial Space in Persons With Pain During Shoulder Elevation |
| NCT07578168 | Not specified | ENROLLING_BY_INVITATION | Acute Effects of Kinesio Taping in Rotator Cuff Syndrome: A Randomized Controlled Trial |
| NCT07602478 | Not specified | ACTIVE_NOT_RECRUITING | Eccentric Contraction Exercise For Shoulder Pain Syndrome |
| NCT01987973 | Not specified | COMPLETED | Allograft Reconstruction of Massive Rotator Cuff Tears vs Partial Repair Alone |
| NCT01996904 | Not specified | COMPLETED | Prospective Randomized Comparative Study of Outcome of Subscapularis Tear |
| NCT02493660 | Not specified | COMPLETED | A Pivotal Study to Assess the InSpace™ Device for Treatment of Full Thickness Massive Rotator Cuff Tears |
| NCT02655848 | Not specified | COMPLETED | Tenotomy or Tenodesis of Long Head Biceps in Arthroscopic Rotator Cuff Repair |
| NCT02725320 | Not specified | UNKNOWN | Rotator Cuff Surgical Outcomes in Women |
| NCT04716855 | Not specified | COMPLETED | Evaluation of Functional Status, Physical Activity and Quality of Life in Patients With Rotator Cuff Syndrome |
| NCT05561452 | Not specified | COMPLETED | The Efficacy of PRP Injection in the Treatment of Rotator Cuff Syndrome |
| NCT05584345 | Not specified | COMPLETED | EFFECTS OF BREATHING EXERCISES ON PAIN AND FUNCTIONALITY IN ROTATOR CUFF TEARS: A RANDOMIZED CONTROLLED TRIAL |
| NCT05817578 | Not specified | UNKNOWN | Profiling the RCRSP Patient: a Pain Phenotype Classification Algorithm |
| NCT05829096 | Not specified | COMPLETED | The COMBINED Study to Integrate Health Behaviour Change for People With a Rotator Cuff Disorder |
| NCT05863806 | Not specified | COMPLETED | Mulligan Mobilization vs Transverse Friction Massage in Rotator Cuff Syndrome |
| NCT06194435 | Not specified | COMPLETED | Teleexercise for Rotator Cuff Syndrome: A Comparison |
| NCT06503549 | Not specified | COMPLETED | Tactile Acuity, Right-left Discrimination, and Motor Imagery in Chronic Rotator Cuff-related Shoulder Pain |
| NCT06535750 | Not specified | COMPLETED | Comparison Of The Effects Of Conventional Physiotherapy And Strengthening Exercises With Rotator Cuff Syndrome |
| NCT06599567 | Not specified | COMPLETED | Graded Motor Imagery and Biofeedback in Rotator Cuff Injury |
| NCT06786013 | Not specified | COMPLETED | Effects of Interscalene Block on Visual Clarity in Arthroscopic Surgery |
| NCT06797232 | Not specified | COMPLETED | The Effect of Body Awareness Level on Shoulder Functionality and Psychological Factors in Rotator Cuff Pathologies |
| NCT06899945 | Not specified | COMPLETED | Effects of Vibration Frequencies in Rotator Cuff Syndrome |
| NCT07086066 | Not specified | COMPLETED | Diaphragm Mobilization With Rotator Cuff Lesions |
| NCT07458711 | Not specified | COMPLETED | Comparative Effects of Spencer Techniques and Movement With Mobilization in Improving Pain, Range of Motion, and Functional Disability in Rotator Cuff Syndrome. |
| NCT07587502 | Not specified | COMPLETED | Blood Flow Restriction Therapy and Gua Sha Therapy in Rotator Cuff Tendinopathy Patients |
Drugs tested across these trials (top 30)
- Cohort genes: STK24, UBE2D3, SLC38A1, ASTN2, ACOT9, CDH8, SASH1, SLC39A8, ZNF804A, FRMPD4, SAP30BP, ALG13, C5orf63, SERTM2
- Drugs: Dexamethasone, Estrogen