Summary
Stevens-Johnson syndrome (MONDO:0018229) is a disease with 22 cohort genes (74 GWAS associations across 15 studies) and 24 clinical trials. Top therapeutic interventions include palifermin, riboflavin, and sodium chloride.
At a glance
- Prevalence: Unknown (Europe)
- Cohort genes: 22
- GWAS associations: 74
- Phenotypes (HPO): 39
- Clinical trials: 24
Clinical features
Epidemiology
Prevalence records
1 prevalence record(s), Orphanet:
| Type | Class | Value | Geography | Validation |
|---|
| Annual incidence | 1-9 / 1 000 000 | 0.36 | Europe | Not yet validated |
Signs & symptoms
Clinical features (HPO)
39 HPO clinical features (Orphanet curated; top 39 by frequency):
| HPO ID | Term | Frequency |
|---|
| HP:0001824 | Weight loss | Very frequent (80-99%) |
| HP:0001945 | Fever | Very frequent (80-99%) |
| HP:0002014 | Diarrhea | Very frequent (80-99%) |
| HP:0002017 | Nausea and vomiting | Very frequent (80-99%) |
| HP:0008066 | Abnormal blistering of the skin | Very frequent (80-99%) |
| HP:0010783 | Erythema | Very frequent (80-99%) |
| HP:0012378 | Fatigue | Very frequent (80-99%) |
| HP:0012733 | Macule | Very frequent (80-99%) |
| HP:0100792 | Acantholysis | Very frequent (80-99%) |
| HP:0001874 | Abnormality of neutrophils | Frequent (30-79%) |
| HP:0002015 | Dysphagia | Frequent (30-79%) |
| HP:0003781 | Excessive salivation | Frequent (30-79%) |
| HP:0000083 | Renal insufficiency | Occasional (5-29%) |
| HP:0000505 | Visual impairment | Occasional (5-29%) |
| HP:0000509 | Conjunctivitis | Occasional (5-29%) |
| HP:0000613 | Photophobia | Occasional (5-29%) |
| HP:0000621 | Entropion | Occasional (5-29%) |
| HP:0000795 | Abnormality of the urethra | Occasional (5-29%) |
| HP:0001637 | Abnormal myocardium morphology | Occasional (5-29%) |
| HP:0001645 | Sudden cardiac death | Occasional (5-29%) |
| HP:0001658 | Myocardial infarction | Occasional (5-29%) |
| HP:0001733 | Pancreatitis | Occasional (5-29%) |
| HP:0001873 | Thrombocytopenia | Occasional (5-29%) |
| HP:0001903 | Anemia | Occasional (5-29%) |
| HP:0001960 | Hypokalemic metabolic alkalosis | Occasional (5-29%) |
| HP:0002027 | Abdominal pain | Occasional (5-29%) |
| HP:0002043 | Esophageal stricture | Occasional (5-29%) |
| HP:0002091 | Restrictive ventilatory defect | Occasional (5-29%) |
| HP:0002094 | Dyspnea | Occasional (5-29%) |
| HP:0002103 | Abnormality of the pleura | Occasional (5-29%) |
| HP:0002205 | Recurrent respiratory infections | Occasional (5-29%) |
| HP:0002239 | Gastrointestinal hemorrhage | Occasional (5-29%) |
| HP:0002910 | Elevated circulating hepatic transaminase concentration | Occasional (5-29%) |
| HP:0006554 | Acute hepatic failure | Occasional (5-29%) |
| HP:0012735 | Cough | Occasional (5-29%) |
| HP:0030016 | Dyspareunia | Occasional (5-29%) |
| HP:0100518 | Dysuria | Occasional (5-29%) |
| HP:0100806 | Sepsis | Occasional (5-29%) |
| HP:0200020 | Corneal erosion | Occasional (5-29%) |
Identifiers
Disease identifiers
| Field | Value |
|---|
| Canonical name | Stevens-Johnson syndrome |
| Mondo ID | MONDO:0018229 |
| EFO | EFO:0004276 |
| MeSH | D013262 |
| OMIM | 608579 |
| Orphanet | 36426 |
| DOID | DOID:0050426 |
| ICD-10-CM | L51.1 |
| ICD-11 | 450167795 |
| NCIT | C79484 |
| SNOMED CT | 73442001 |
| UMLS | C0038325 |
| MedGen | 20955 |
| GARD | 0007700 |
| MedDRA | 10042033 |
| Is cancer (heuristic) | no |
Also known as: Dermatostomatitis, Stevens Johnson type · Stevens Johnson syndrome
Data availability: 74 GWAS associations (15 studies) · 6 cell lines.
Disease family
Classification path: disease › human disease › disease by body system or component › syndromic disease › Stevens-Johnson syndrome
Related subtypes (1183): Neu-Laxova syndrome, inclusion body myopathy with Paget disease of bone and frontotemporal dementia, syndromic intellectual disability, abdominal obesity-metabolic syndrome, fibrogenesis imperfecta ossium, Fanconi renotubular syndrome, palindromic rheumatism, hepatorenal syndrome, Potter sequence, vertebral artery insufficiency, sick sinus syndrome, Tietze syndrome, toxic shock syndrome, capillary leak syndrome, dumping syndrome, FG syndrome, basilar artery insufficiency, long QT syndrome, Treacher-Collins syndrome, superior mesenteric artery syndrome, disappearing bone disease, Brown-Sequard syndrome, Froelich syndrome, diffuse infiltrative lymphocytosis syndrome, Capgras syndrome, compartment syndrome, central sleep apnea syndrome, irritable bowel syndrome, nephrotic syndrome, myalgic encephalomeyelitis/chronic fatigue syndrome, acute coronary syndrome, fibromyalgia, substance withdrawal syndrome, acute chest syndrome, Barre-Lieou syndrome, cauda equina syndrome, Kluver-Bucy syndrome, Miller Fisher syndrome, persian gulf syndrome, Reye syndrome, thoracic outlet syndrome, Waterhouse-Friderichsen syndrome, Wissler syndrome, acute respiratory distress syndrome, Achenbach syndrome, miliaria, anterior spinal artery syndrome, burning mouth syndrome, dry eye syndrome, empty sella syndrome, euthyroid sick syndrome, lateral medullary syndrome, subclavian steal syndrome, tarsal tunnel syndrome, tethered spinal cord syndrome, branchio-oto-renal syndrome, prune belly syndrome, Achard syndrome, alopecia-epilepsy-pyorrhea-intellectual disability syndrome, Finnish type amyloidosis, Angelman syndrome, aniridia-absent patella syndrome, ankyloblepharon filiforme adnatum-cleft palate syndrome, Townes-Brocks syndrome, obstructive sleep apnea syndrome, Lown-Ganong-Levine syndrome, Behcet disease, brachydactyly-arterial hypertension syndrome, brachydactyly type A2, fibular aplasia-ectrodactyly syndrome, brachydactyly-nystagmus-cerebellar ataxia syndrome, Sillence syndrome, Brachymorphism-onychodysplasia-dysphalangism syndrome, brachytelephalangy-dysmorphism-Kallmann syndrome, dilated cardiomyopathy 1A, cat-eye syndrome, cerebrocostomandibular syndrome, Alagille syndrome, autosomal dominant chondrodysplasia punctata, cleidocranial dysplasia 1, cleidorhizomelic syndrome, cochleosaccular degeneration-cataract syndrome, renal coloboma syndrome, Cri-du-chat syndrome, autosomal dominant deafness - onychodystrophy syndrome, cerebral arteriopathy with subcortical infarcts and leukoencephalopathy, Duane retraction syndrome, 3-M syndrome, dyschondrosteosis-nephritis syndrome, hereditary benign intraepithelial dyskeratosis, encephalopathy, recurrent, of childhood, Camurati-Engelmann disease, Felty syndrome, chromosome 16p12.1 deletion syndrome, 520kb, Frasier syndrome, Gamstorp-Wohlfart syndrome, Tourette syndrome, glaucoma-sleep apnea syndrome, renal cysts and diabetes syndrome, hypotrichosis-lymphedema-telangiectasia syndrome (grouping), GMS syndrome, gray platelet syndrome, hand-foot-genital syndrome, facial hemiatrophy, Bencze syndrome, alpha thalassemia-intellectual disability syndrome type 1, Gilbert syndrome, mullerian duct anomalies-limb anomalies syndrome, hypoparathyroidism-deafness-renal disease syndrome, chromosome 18p deletion syndrome, Pallister-Hall syndrome, ichthyosis-cheek-eyebrow syndrome, Jacobsen syndrome, palmoplantar keratoderma-hereditary motor and sensory neuropathy syndrome, palmoplantar keratoderma-esophageal carcinoma syndrome, Kleine-Levin syndrome, angioosteohypertrophic syndrome, congenital laryngeal web, Lenz-Majewski hyperostotic dwarfism, Noonan syndrome with multiple lentigines, lymphedema-cerebral arteriovenous anomaly syndrome, microcephaly with or without chorioretinopathy, lymphedema, or intellectual disability, yellow nail syndrome, lymphedema-distichiasis syndrome, Nager acrofacial dysostosis, jaw-winking syndrome, Marfan syndrome, Melkersson-Rosenthal syndrome, metaphyseal chondrodysplasia, Jansen type, Schmid metaphyseal chondrodysplasia, metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome, microgastria-limb reduction defect syndrome, Mobius syndrome, muscular atrophy-ataxia-retinitis pigmentosa-diabetes mellitus syndrome, nail-patella syndrome, Schilbach-Rott syndrome, syndromic orbital border hypoplasia, Buschke-Ollendorff syndrome, nasopalpebral lipoma-coloboma syndrome, Perry syndrome, Poland syndrome, polydactyly-myopia syndrome, Greig cephalopolysyndactyly syndrome, Prader-Willi syndrome, Guttmacher syndrome, Currarino triad, Hutchinson-Gilford progeria syndrome, progeria-short stature-pigmented nevi syndrome, Liddle syndrome, exfoliation syndrome, ptosis-strabismus-ectopic pupils syndrome, radial hypoplasia-triphalangeal thumbs-hypospadias-maxillary diastema syndrome, radial ray hypoplasia-choanal atresia syndrome, Roussy-Levy syndrome, Silver-Russell syndrome, Ruvalcaba syndrome, oculodental syndrome, Rutherfurd type, aplasia of lacrimal and salivary glands, scalp defects-postaxial polydactyly syndrome, ulnar-mammary syndrome, septooptic dysplasia, Czeizel-Losonci syndrome, polycystic ovary syndrome, stiff-person syndrome, syndactyly-polydactyly-ear lobe syndrome, HELLP syndrome, double uterus-hemivagina-renal agenesis syndrome, VACTERL/vater association, posterior fusion of lumbosacral vertebrae-blepharoptosis syndrome, ptosis-vocal cord paralysis syndrome, Freeman-Sheldon syndrome, Williams syndrome, Denys-Drash syndrome, Wolf-Hirschhorn syndrome, ablepharon macrostomia syndrome, acrocallosal syndrome, PAGOD syndrome, alopecia - intellectual disability syndrome, mitochondrial DNA depletion syndrome 4a, Alstrom syndrome, aniridia-cerebellar ataxia-intellectual disability syndrome, aniridia-renal agenesis-psychomotor retardation syndrome, aplasia cutis congenita-intestinal lymphangiectasia syndrome, fetal akinesia deformation sequence, blepharophimosis-ptosis-esotropia-syndactyly-short stature syndrome, Bloom syndrome, Elsahy-Waters syndrome, campomelia, Cumming type, camptomelic syndrome, long-limb type, congenital cataract-ichthyosis syndrome, colobomatous optic disc-macular atrophy-chorioretinopathy syndrome, hepatic fibrosis-renal cysts-intellectual disability syndrome, Charcot-Marie-Tooth disease-hearing loss-intellectual disability syndrome, CHARGE syndrome, Aagenaes syndrome, infantile choroidocerebral calcification syndrome, Yunis-Varon syndrome, corneal dystrophy-perceptive deafness syndrome, cortical blindness-intellectual disability-polydactyly syndrome, Crigler-Najjar syndrome, cataract-nephropathy-encephalopathy syndrome, Fraser syndrome, cystic fibrosis-gastritis-megaloblastic anemia syndrome, cystinuria, DOORS syndrome, high myopia-sensorineural deafness syndrome, dermochondrocorneal dystrophy, nephrogenic diabetes insipidus-intracranial calcification syndrome, diverticulosis of bowel, hernia, and retinal detachment, Dyggve-Melchior-Clausen disease, cerebellar ataxia, intellectual disability, and dysequilibrium, ectrodactyly-polydactyly syndrome, Bonnemann-Meinecke-Reich syndrome, epidermolysis bullosa simplex 5B, with muscular dystrophy, Wolcott-Rallison syndrome, ermine phenotype, eyebrow duplication-syndactyly syndrome, Fanconi-like syndrome, gingival fibromatosis-facial dysmorphism syndrome, frontofacionasal dysplasia, Fryns syndrome, German syndrome, Bernard-Soulier syndrome, triple-A syndrome, Grubben-de Cock-Borghgraef syndrome, mullerian derivatives-lymphangiectasia-polydactyly syndrome, Hirschsprung disease-hearing loss-polydactyly syndrome, Hirschsprung disease-nail hypoplasia-dysmorphism syndrome, Holzgreve-Wagner-Rehder syndrome, multinucleated neurons-anhydramnios-renal dysplasia-cerebellar hypoplasia-hydranencephaly syndrome, growth delay-hydrocephaly-lung hypoplasia syndrome, Dubin-Johnson syndrome, ornithine translocase deficiency, acrofrontofacionasal dysostosis 2, hypertrichotic osteochondrodysplasia Cantu type, hypergonadotropic hypogonadism-cataract syndrome, primary hypergonadotropic hypogonadism-partial alopecia syndrome, hypoparathyroidism-retardation-dysmorphism syndrome, hypospadias-intellectual disability, Goldblatt type syndrome, Bamforth-Lazarus syndrome, ichthyosis-hepatosplenomegaly-cerebellar degeneration syndrome, ichthyosis-intellectual disability-dwarfism-renal impairment syndrome, Vici syndrome, channelopathy-associated congenital insensitivity to pain, autosomal recessive, Joubert syndrome with oculorenal defect, oculocerebrofacial syndrome, Kaufman type, Landau-Kleffner syndrome, laryngo-onycho-cutaneous syndrome, Laurence-Moon syndrome, Donohue syndrome, Miller-Dieker lissencephaly syndrome, Marinesco-Sjogren syndrome, Frank-Ter Haar syndrome, Mietens syndrome, mesomelic dwarfism-cleft palate-camptodactyly syndrome, metaphyseal chondrodysplasia-retinitis pigmentosa syndrome, metaphyseal dysostosis-intellectual disability-conductive deafness syndrome, microcephalic primordial dwarfism, Toriello type, Say-Barber-Miller syndrome, microcephaly and chorioretinopathy 1, Galloway-Mowat syndrome, microtia with meatal atresia and conductive deafness, mucopolysaccharidosis type 6, mulibrey nanism, lethal multiple pterygium syndrome, lethal congenital contracture syndrome 1, Schwartz-Jampel syndrome, Nathalie syndrome, nephronophthisis 1, nephropathy - deafness - hyperparathyroidism syndrome, nephrosis-deafness-urinary tract-digital malformations syndrome, Netherton syndrome, Norman-Roberts syndrome, cloacal exstrophy, ichthyosis-oral and digital anomalies syndrome, Primrose syndrome, familial osteodysplasia, Anderson type, multicentric osteolysis, nodulosis, and arthropathy, osteopenia-intellectual disability-sparse hair syndrome, osteoporosis-pseudoglioma syndrome, Shwachman-Diamond syndrome, Parana hard-skin syndrome, PEHO syndrome, Imerslund-Grasbeck syndrome, Peters plus syndrome, pili torti-developmental delay-neurological abnormalities syndrome, Rabson-Mendenhall syndrome, postaxial acrofacial dysostosis, Gitelman syndrome, Wiedemann-Rautenstrauch syndrome, Acrootoocular syndrome, holoprosencephaly-postaxial polydactyly syndrome, autosomal recessive multiple pterygium syndrome, Perlman syndrome, retinitis pigmentosa-intellectual disability-deafness-hypogenitalism syndrome, EEC syndrome, SHORT syndrome, Sjogren syndrome, spastic tetraplegia-retinitis pigmentosa-intellectual disability syndrome, corneal-cerebellar syndrome, spastic ataxia-corneal dystrophy syndrome, spondylocostal dysostosis-anal and genitourinary malformations syndrome, familial infantile bilateral striatal necrosis, subaortic stenosis-short stature syndrome, thrombocytopenia-absent radius syndrome, thyrocerebrorenal syndrome, Pendred syndrome, VACTERL with hydrocephalus, Weaver syndrome, Werner syndrome, Wernicke-Korsakoff syndrome, wooly hair-hypotrichosis-everted lower lip-outstanding ears syndrome, de Sanctis-Cacchione syndrome, corpus callosum agenesis-abnormal genitalia syndrome, Alport syndrome-intellectual disability-midface hypoplasia-elliptocytosis syndrome, X-linked lissencephaly with abnormal genitalia, X-linked myotubular myopathy-abnormal genitalia syndrome, Christianson syndrome, Armfield syndrome, Lesch-Nyhan syndrome, Atkin-Flaitz syndrome, alpha-thalassemia-myelodysplastic syndrome, deafness-intellectual disability, Martin-Probst type syndrome, fragile X-associated tremor/ataxia syndrome, fragile X syndrome, syndactyly-telecanthus-anogenital and renal malformations syndrome, X-linked dominant chondrodysplasia, Chassaing-Lacombe type, X-linked central congenital hypothyroidism with late-onset testicular enlargement, Meester-Loeys syndrome, Arts syndrome, X-linked mandibulofacial dysostosis, Abruzzo-Erickson syndrome, Aicardi syndrome, craniofrontonasal syndrome, deafness-hypogonadism syndrome, X-linked corneal dermoid, immune dysregulation-polyendocrinopathy-enteropathy-X-linked syndrome, hydrocephaly-cerebellar agenesis syndrome, keratosis follicularis-dwarfism-cerebral atrophy syndrome, laryngeal abductor paralysis-intellectual disability syndrome, oculocerebrorenal syndrome, Menkes disease, paraplegia-intellectual disability-hyperkeratosis syndrome, mucopolysaccharidosis type 2, orofaciodigital syndrome I, otopalatodigital syndrome type 1, Pallister-W syndrome, Rett syndrome, SCARF syndrome, Simpson-Golabi-Behmel syndrome, torticollis-keloids-cryptorchidism-renal dysplasia syndrome, trigonocephaly-short stature-developmental delay syndrome, ulnar hypoplasia-split foot syndrome, van den Bosch syndrome, Wildervanck syndrome, Kearns-Sayre syndrome, MELAS syndrome, MERRF syndrome, Pearson syndrome, proximal tubulopathy-diabetes mellitus-cerebellar ataxia syndrome, pancreatic hypoplasia-diabetes-congenital heart disease syndrome, chondrodysplasia-pseudohermaphroditism syndrome, Qazi Markouizos syndrome, familial developmental dysphasia, atrioventricular defect-blepharophimosis-radial and anal defect syndrome, CODAS syndrome, lethal hemolytic anemia-genital anomalies syndrome, HEC syndrome, anophthalmia plus syndrome, infundibulopelvic stenosis-multicystic kidney syndrome, Ayme-Gripp syndrome, dilated cardiomyopathy 1E, diaphragmatic defect-limb deficiency-skull defect syndrome, skeletal dysplasia-epilepsy-short stature syndrome, Potocki-Shaffer syndrome, amelia cleft lip palate hydrocephalus iris coloboma, human HOXA1 syndromes, dyssegmental dysplasia-glaucoma syndrome, lung agenesis-heart defect-thumb anomalies syndrome, tetrasomy 12p, chromosome 18q deletion syndrome, lymphedema-atrial septal defects-facial changes syndrome, infantile convulsions and choreoathetosis, RHYNS syndrome, Pierre Robin sequence with pectus excavatum and rib and scapular anomalies, colobomatous macrophthalmia-microcornea syndrome, Marshall-Smith syndrome, distal monosomy 13q, MPI-congenital disorder of glycosylation, camptodactyly, myopia, and fibrosis of the medial rectus muscle of eye, radioulnar synostosis-microcephaly-scoliosis syndrome, blepharophimosis - intellectual disability syndrome, SBBYS type, complex regional pain syndrome type 1, temtamy preaxial brachydactyly syndrome, Diamond-Blackfan anemia 2, genitopatellar syndrome, Phelan-McDermid syndrome, hypotonia-cystinuria syndrome, DNA ligase IV deficiency, Hurler syndrome, Hurler-Scheie syndrome, Scheie syndrome, Duane-radial ray syndrome, psoriatic arthritis, neonatal ichthyosis-sclerosing cholangitis syndrome, skin fragility-woolly hair-palmoplantar keratoderma syndrome, tubulointerstitial nephritis and uveitis syndrome, caudal duplication, sweet syndrome, ichthyosis prematurity syndrome, Meacham syndrome, BNAR syndrome, PCWH syndrome, foveal hypoplasia - optic nerve decussation defect - anterior segment dysgenesis syndrome, B-cell immunodeficiency, distal limb anomalies, and urogenital malformations, MEDNIK syndrome, Cerebrorenodigital syndrome, fetal valproate syndrome, Goldberg-Shprintzen syndrome, Al-Gazali syndrome, CEDNIK syndrome, osteosclerosis-ichthyosis-premature ovarian failure syndrome, cortical dysplasia-focal epilepsy syndrome, DK1-congenital disorder of glycosylation, Potocki-Lupski syndrome, Pitt-Hopkins syndrome, XFE progeroid syndrome, deafness-infertility syndrome, COG1-congenital disorder of glycosylation, autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome, microtia-eye coloboma-imperforation of the nasolacrimal duct syndrome, mitochondrial DNA depletion syndrome, encephalomyopathic form with methylmalonic aciduria, ANE syndrome, CLOVES syndrome, Hirschsprung disease-ganglioneuroblastoma syndrome, parkinsonism-dystonia, infantile, alpha 1-antitrypsin deficiency, COG5-congenital disorder of glycosylation, chromosome 13q14 deletion syndrome, deafness-lymphedema-leukemia syndrome, microcephaly-capillary malformation syndrome, EDICT syndrome, peripheral neuropathy-myopathy-hoarseness-hearing loss syndrome, hypomyelinating leukodystrophy 8 with or without oligodontia and-or hypogonadotropic hypogonadism, IMAGe syndrome, short stature-onychodysplasia-facial dysmorphism-hypotrichosis syndrome, microcephalic primordial dwarfism, Alazami type, intellectual disability-strabismus syndrome, estrogen resistance syndrome, Hartsfield-Bixler-Demyer syndrome, severe dermatitis-multiple allergies-metabolic wasting syndrome, alacrima, achalasia, and intellectual disability syndrome, familial episodic pain syndrome with predominantly lower limb involvement, congenital microcephaly - severe encephalopathy - progressive cerebral atrophy syndrome, diffuse cerebral and cerebellar atrophy - intractable seizures - progressive microcephaly syndrome, postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome, tall stature-scoliosis-macrodactyly of the great toes syndrome, intellectual disability, autosomal dominant 29, intellectual disability, autosomal dominant 30, congenital sideroblastic anemia-B-cell immunodeficiency-periodic fever-developmental delay syndrome, retinitis pigmentosa-juvenile cataract-short stature-intellectual disability syndrome, polyendocrine-polyneuropathy syndrome, chronic atrial and intestinal dysrhythmia, motor developmental delay due to 14q32.2 paternally expressed gene defect, peeling skin-leukonuchia-acral punctate keratoses-cheilitis-knuckle pads syndrome, mandibulofacial dysostosis with alopecia, epilepsy with myoclonic atonic seizures, short stature, microcephaly, and endocrine dysfunction, progressive microcephaly-seizures-cortical blindness-developmental delay syndrome, PMP22-RAI1 contiguous gene duplication syndrome, acute infantile liver failure-cerebellar ataxia-peripheral sensory motor neuropathy syndrome, familial progressive retinal dystrophy-iris coloboma-congenital cataract syndrome, macrothrombocytopenia-lymphedema-developmental delay-facial dysmorphism-camptodactyly syndrome, Luscan-Lumish syndrome, even-plus syndrome, MIRAGE syndrome, growth retardation, intellectual developmental disorder, hypotonia, and hepatopathy, intellectual disability-epilepsy-extrapyramidal syndrome, 48,XXYY syndrome, FRAXF syndrome, complex hereditary spastic paraplegia, aniridia-ptosis-intellectual disability-familial obesity syndrome, aniridia - intellectual disability syndrome, ankyloblepharon filiforme-imperforate anus syndrome, pentasomy X, Bardet-Biedl syndrome, anophthalmia-megalocornea-cardiopathy-skeletal anomalies syndrome, Bartter syndrome, arachnodactyly-intellectual disability-dysmorphism syndrome, ataxia-photosensitivity-short stature syndrome, Brugada syndrome, Feingold syndrome, cardiomyopathy-cataract-hip spine disease syndrome, cataract - microcornea syndrome, autism-facial port-wine stain syndrome, cataract-intellectual disability-anal atresia-urinary defects syndrome, cataract-deafness-hypogonadism syndrome, syndromic craniosynostosis, drug rash with eosinophilia and systemic symptoms, multicentric reticulohistiocytosis, hereditary sensory and autonomic neuropathy with deafness and global delay, craniofacial microsomia, ring chromosome 10, Coffin-Siris syndrome, corpus callosum agenesis-double urinary collecting system syndrome, short rib-polydactyly syndrome, oromandibular-limb anomalies syndrome, hemophagocytic syndrome, cataract-glaucoma syndrome, diencephalic syndrome, hypereosinophilic syndrome, distal trisomy 14q, intellectual disability-cataracts-kyphosis syndrome, progressive familial intrahepatic cholestasis, thoraco-abdominal enteric duplication, oculomaxillofacial dysostosis, growth hormone insensitivity syndrome, syndromic dyslipidemia, macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss, epiphyseal dysplasia-hearing loss-dysmorphism syndrome, eosinophilic granulomatosis with polyangiitis, axial mesodermal dysplasia spectrum, fetal hydantoin syndrome, vitamin K-antagonist embryofetopathy, fetal alcohol syndrome, methimazole embryofetopathy, Evans syndrome, Cornelia de Lange syndrome, cleft lip-retinopathy syndrome, cleft lip/palate-deafness-sacral lipoma syndrome, Crandall syndrome, syndromic microphthalmia, Cole-Carpenter syndrome, myotonic syndrome, Guillain-Barre syndrome, atypical hemolytic-uremic syndrome, Hennekam syndrome, Hernández-Aguirre Negrete syndrome, nodular neuronal heterotopia, Hirschsprung disease-type D brachydactyly syndrome, holoprosencephaly, hydrocephalus-obesity-hypogonadism syndrome, hydrocephalus-blue sclerae-nephropathy syndrome, xeroderma pigmentosum-Cockayne syndrome complex, Joubert syndrome with ocular defect, hypogonadism-mitral valve prolapse-intellectual disability syndrome, hypogonadotropic hypogonadism-retinitis pigmentosa syndrome, hypotrichosis-intellectual disability, Lopes type, congenital ichthyosis-microcephalus-tetraplegia syndrome, Hughes-Stovin syndrome, heart-hand syndrome, ptosis-upper ocular movement limitation-absence of lacrimal punctum syndrome, syndromic agammaglobulinemia, isotretinoin syndrome, microcornea-posterior megalolenticonus-persistent fetal vasculature-coloboma syndrome, Kabuki syndrome, Kenny-Caffey syndrome, muscular pseudohypertrophy-hypothyroidism syndrome, Kousseff syndrome, limb body wall complex, Lennox-Gastaut syndrome, Lowe-Kohn-Cohen syndrome, macrocephaly-short stature-paraplegia syndrome, primary ciliary dyskinesia, familial intestinal malrotation-facial anomalies syndrome, primary hypertrophic osteoarthropathy, Melhem-Fahl syndrome, lower limb deficiency-hypospadias syndrome, 8p23.1 microdeletion syndrome, sickle cell-beta-thalassemia disease syndrome, sickle cell-hemoglobin c disease syndrome, sickle cell-hemoglobin d disease syndrome, sickle cell-hemoglobin E disease syndrome, hereditary persistence of fetal hemoglobin-sickle cell disease syndrome, microcephaly-brain defect-spasticity-hypernatremia syndrome, microcephaly-microcornea syndrome, Seemanova type, Meier-Gorlin syndrome, Mikati-Najjar-Sahli syndrome, shoulder and girdle defects-familial intellectual disability syndrome, myopathy-growth delay-intellectual disability-hypospadias syndrome, Fuchs heterochromic iridocyclitis, microcephalic osteodysplastic primordial dwarfism types I and III, osteochondrodysplatic nanism-deafness-retinitis pigmentosa syndrome, arthrogryposis-renal dysfunction-cholestasis syndrome, oculo-skeletal-renal syndrome, olivopontocerebellar atrophy-deafness syndrome, Opitz G/BBB syndrome, imperforate oropharynx-costo vetebral anomalies syndrome, Bruck syndrome, osteoporosis-macrocephaly-blindness-joint hyperlaxity syndrome, calciphylaxis, recessive intellectual disability-motor dysfunction-multiple joint contractures syndrome, X-linked ichthyosis syndrome, autoimmune polyendocrinopathy, renal caliceal diverticuli-deafness syndrome, tempi syndrome, syndromic oculocutaneous albinism, short stature-deafness-neutrophil dysfunction-dysmorphism syndrome, congenital varicella syndrome, polyneuropathy-intellectual disability-acromicria-premature menopause syndrome, celiac trunk compression syndrome, hypoplastic pancreas-intestinal atresia-hypoplastic gallbalder syndrome, fetal cytomegalovirus syndrome, Reunion island Larsen syndrome, 46,XX disorder of sex development-anorectal anomalies syndrome, mitochondrial neurogastrointestinal encephalomyopathy, Baraitser-Winter cerebrofrontofacial syndrome, mirror polydactyly-vertebral segmentation-limbs defects syndrome, intellectual disability-hypotonia-skin hyperpigmentation syndrome, congenital hereditary facial paralysis-variable hearing loss syndrome, intellectual disability-microcephaly-phalangeal-facial abnormalities syndrome, Mayer-Rokitansky-Kuster-Hauser syndrome, developmental and speech delay due to SOX5 deficiency, Spigelian hernia-cryptorchidism syndrome, autosomal recessive leukoencephalopathy-ischemic stroke-retinitis pigmentosa syndrome, severe neonatal hypotonia-seizures-encephalopathy syndrome due to 5q31.3 microdeletion, multiple sclerosis-ichthyosis-factor VIII deficiency syndrome, X-linked spasticity-intellectual disability-epilepsy syndrome, spina bifida-hypospadias syndrome, hantavirus pulmonary syndrome, white matter hypoplasia-corpus callosum agenesis-intellectual disability syndrome, deafness-genital anomalies-metacarpal and metatarsal synostosis syndrome, hearing loss-familial salivary gland insensitivity to aldosterone syndrome, multiple synostoses syndrome, central nervous system calcification-deafness-tubular acidosis-anemia syndrome, multiple paragangliomas associated with polycythemia, syngnathia multiple anomalies, Takayasu arteritis, severe early-onset obesity-insulin resistance syndrome due to SH2B1 deficiency, spondylocostal dysostosis-hypospadias-intellectual disability syndrome, hypotrichosis-deafness syndrome, thalidomide embryopathy, trisomy X, trisomy 13, trisomy 18, umbilical cord ulceration-intestinal atresia syndrome, microcephaly-brachydactyly-kyphoscoliosis syndrome, Waardenburg syndrome, Weill-Marchesani syndrome, infantile spasms, Wolfram syndrome, epidermal nevus syndrome, digital anomalies-intellectual disability-short stature syndrome, intellectual disability-obesity-brain malformations-facial dysmorphism syndrome, Erdheim-Chester disease, CADDS, finger hyperphalangy - toe anomalies - severe pectus excavatum syndrome, ataxia - telangiectasia variant, growth retardation-mild developmental delay-chronic hepatitis syndrome, primary microcephaly-mild intellectual disability-young-onset diabetes syndrome, ferro-cerebro-cutaneous syndrome, dystonia-aphonia syndrome, microcephaly-complex motor and sensory axonal neuropathy syndrome, X-linked microcephaly-growth retardation-prognathism-cryptorchidism syndrome, severe intellectual disability-hypotonia-strabismus-coarse face-planovalgus syndrome, intrauterine growth restriction-short stature-early adult-onset diabetes syndrome, pseudoxanthoma elasticum-like skin manifestations with retinitis pigmentosa, familial chylomicronemia syndrome, caudal regression-sirenomelia spectrum, visceral heterotaxy, Holmes-Adie syndrome, microcephalic primordial dwarfism due to RTTN deficiency, Joubert syndrome, congenital generalized hypercontractile muscle stiffness syndrome, Kallmann syndrome, Caroli syndrome, X-linked female restricted facial dysmorphism-short stature-choanal atresia-intellectual disability, microlissencephaly-micromelia syndrome, branchiootic syndrome, Plummer-Vinson syndrome, Cushing syndrome, McCune-Albright syndrome, Meckel syndrome, SUNCT syndrome, mucopolysaccharidosis type 3, mucopolysaccharidosis type 4, congenital myasthenic syndrome, Loeys-Dietz syndrome, Alport syndrome, schisis association, Tolosa-Hunt syndrome, iridocorneal endothelial syndrome, Noonan syndrome, short fifth metacarpals-insulin resistance syndrome, progressive supranuclear palsy, benign exophthalmos syndrome, Sandifer syndrome, global developmental delay-osteopenia-ectodermal defect syndrome, tubular renal disease-cardiomyopathy syndrome, angioosteohypotrophic syndrome, 6q terminal deletion syndrome, Axenfeld-Rieger syndrome, peroxisome biogenesis disorder, ectodermal dysplasia syndrome, Seckel syndrome, Sotos syndrome, Stickler syndrome, pelvis syndrome, Susac syndrome, ischio-vertebral syndrome, BRESEK syndrome, Turner syndrome, Usher syndrome, obesity-colitis-hypothyroidism-cardiac hypertrophy-developmental delay syndrome, CREST syndrome, Sheehan syndrome, polymyalgia rheumatica, autoinflammatory syndrome, neuroleptic malignant syndrome, pituitary stalk interruption syndrome, monosomy 13q34, ring chromosome 13, 48,XXXY syndrome, 49,XXXXY syndrome, hereditary continuous muscle fiber activity, Eisenmenger syndrome, Robinow syndrome, Ehlers-Danlos syndrome, hypoplastic right heart syndrome, shone complex, 48,XYYY syndrome, subcortical band heterotopia, complex regional pain syndrome type 2, faciodigitogenital syndrome, neoplastic syndrome, paraneoplastic syndrome, post-infectious syndrome, Achard-Thiers syndrome, acral dysostosis dyserythropoiesis syndrome, agnathia-microstomia-synotia, Aksu von Stockhausen syndrome, Aloi Tomasini Isaia syndrome, temporomandibular joint dysfunction syndrome, Apert-like polydactyly syndrome, arakawa syndrome 2, arena syndrome, Arnold stickler bourne syndrome, baetz-greenwalt syndrome, bagatelle Cassidy syndrome, baker Vinters syndrome, bobble-head doll syndrome, Boerhaave syndrome, Cantu Sanchez-Corona Fragoso syndrome, Cantu Sanchez-Corona Hernandez syndrome, carbon baby syndrome, Carnevale hernandez castillo syndrome, Cartwright Nelson Fryns syndrome, Charles bonnet syndrome, Parinaud syndrome, corticobasal degeneration disorder, hair defect with photosensitivity and intellectual disability syndrome, AIDS dysmorphic syndrome, congenital acardia, acute lymphoblastic leukemia congenital sporadic aniridia, aglossia and situs inversus, agyria pachygyria polymicrogyria, agyria-pachygyria type 1, Ahumada Del Castillo syndrome, alopecia congenita keratosis palmoplantaris, alpha-mannosidosis type 1, aluminosis, Mauriac syndrome, ankle defects short stature, ankyloblepharon filiforme imperforate anus, annular constricting bands, anophthalmia cleft palate micrognathia, anophthalmia esophageal atresia cryptorchidism, anotia facial palsy cardiac defect, aortic dissection lentiginosis, childhood aortic valve stenosis, arthrogryposis IUGR thoracic dystrophy, arthrogryposis multiplex congenita CNS calcification, arthrogryposis spinal muscular atrophy, asternia, atlanto-axial fusion, atrophoderma of Pierini and Pasini, Barnicoat Baraitser syndrome, Basedow’s coma, BD syndrome, Beardwell syndrome, bhaskar jagannathan syndrome, bidirectional tachycardia, bilirubin induced brain injury in the newborn, blepharo naso facial syndrome van Maldergem type, bone dysplasia corpus callosum agenesis, brachydactyly absence of distal phalanges, brachydactyly anonychia, brachydactyly small stature face anomalies, brachydactyly tibial hypoplasia, brittle bone syndrome lethal type, bronchiectasis oligospermia, Brunsting-Perry syndrome, bruyn scheltens syndrome, burn goodship syndrome, camptodactyly joint contractures and facial skeletal dysplasia, camptodactyly vertebral fusion, Cantu Sanchez-Corona Garcia-Cruz syndrome, cardiac hydatid cysts with intracavitary expansion, cardioencephalomyopathy, cardiofacial syndrome short limbs, cardiomelic syndrome stratton Koehler type, cardiomyopathy and deafness due to tRNA lysine gene mutation, cardiomyopathy diabetes deafness, cardiomyopathy hypogonadism collagenoma syndrome, cardiomyopathy hypogonadism metabolic anomalies, cardiomyopathy spherocytosis, carpo tarsal osteolysis recessive, autosomal dominant cataract, cataract skeletal anomalies, cennamo gangemi syndrome, cerebellar agenesis, cerebello-olivary atrophy, cerebral calcification cerebellar hypoplasia, cerebral calcifications opalescent teeth phosphaturia, oculo digital syndrome, chondrodysplasia, choreoacanthocytosis amyotrophic, chorioretinopathy dominant form microcephaly, Christian Demyer Franken syndrome, Christian Johnson angenieta syndrome, chromosome 3 duplication syndrome, chronic demyelinizing neuropathy with IgM monoclonal, ciliary dyskinesia-bronchiectasis, circumscribed cutaneous aplasia of the vertex, circumscribed disseminated keratosis Jadassohn lew type, cleft lip and palate malrotation cardiopathy, cleft lip and/or palate with mucous cysts of lower, cleft lip palate dysmorphism kumar type, cleft lip palate intellectual disability corneal opacity, cleft lip palate oligodontia syndactyly pili torti, cleft lip palate pituitary deficiency, cleft lip palate-tetraphocomelia, cleft lower lip cleft lateral canthi chorioretinal, cleft palate cardiac defect ectrodactyly, cleft palate colobomata radial synostosis deafness, cleft palate heart disease polydactyly absent tibia, cleft tongue, coarse face hypotonia constipation, Cohen Lockood Wyborney syndrome, type 2 collagenopathy, Collins-Sakati syndrome, coloboma porencephaly hydronephrosis, colobomata unilobar lung heart defect, colonic malakoplakia, Colver Steer Godman syndrome, Combarros Calleja Leno syndrome, complement receptor deficiency, congenital absence of the sternocleidomastoid muscle, congenital amputation, congenital aneurysms of the great vessels, congenital articular rigidity, congenital benign spinal muscular atrophy dominant, congenital cardiovascular shunt, congenital contractures, congenital craniosynostosis maternal hyperthyroiditis, congenital cystic eye, congenital heart disease ptosis hypodontia craniostosis, congenital heart disease radio ulnar synostosis intellectual disability, congenital mumps, congenital stenosis of cervical medullary canal, Dennis-Fairhurst-Moore syndrome, congenital unilateral pulmonary hypoplasia, congenital vagal hyperreflexivity, Cormier Rustin Munnich syndrome, corneal crystals myopathy neuropathy, corneal dystrophy ichthyosis microcephaly intellectual disability, corneal dystrophy pigmentary anomaly malabsorption, corpus callosum agenesis of blepharophimosis robin type, corpus callosum dysgenesis X-linked recessive, corpus callosum dysgenesis cleft spasm, corpus callosum dysgenesis hypopituitarism, cortada Koussef Matsumoto syndrome, Cortes Lacassie syndrome, craniofacial and skeletal defects, craniofacial dysostosis arthrogryposis progeroid appearance, craniofrontonasal syndrome Teebi type, craniostenosis with congenital heart disease intellectual disability, crawfurd syndrome, cutis gyratum acanthosis nigricans craniosynostosis, cutis laxa osteoporosis, Davenport-Donlan syndrome, Davis Lafer syndrome, de Hauwere Leroy adriaenssens syndrome, deafness conductive stapedial ear malformation facial palsy, deafness goiter stippled epiphyses, deafness hypospadias metacarpal and metatarsal syndrome, deafness mesenteric diverticula of small bowel neuropathy, deafness peripheral neuropathy arterial disease, deafness progressive cataract autosomal dominant, dermatocardioskeletal syndrome boronne type, dextrocardia with situs inversus, diabetes persistent mullerian ducts, diaphragmatic agenesis radial aplasia omphalocele, diaphragmatic hernia exomphalos corpus callosum agenesis, diaphragmatic hernia upper limb defects, die Smulders droog van dijk syndrome, diomedi bernardi placidi syndrome, diphallus rachischisis imperforate anus, distichiasis heart congenital anomalies, double discordia, double uterus-hemivagina-renal agenesis, Drachtman Weinblatt Sitarz syndrome, Duker-Weiss-Siber syndrome, duodenal atresia tetralogy of fallot, duplication of leg mirror foot, duplication of the thumb unilateral biphalangeal, dupont sellier chochillon syndrome, dwarfism bluish sclerae, dwarfism deafness retinitis pigmentosa, dwarfism lethal type advanced bone age, dwarfism thin bones multiple fractures, dysmorphism cleft palate loose skin, Eagle syndrome, ectrodactyly cardiopathy dysmorphism, Elliott ludman Teebi syndrome, enamel hypoplasia cataract hydrocephaly, encephalocele anencephaly, enchondromatosis dwarfism deafness, Engelhard Yatziv syndrome, enlarged vestibular aqueduct syndrome, epidermal nevus vitamin D resistant rickets, epimetaphyseal dysplasia cataract, epiphyseal dysplasia dysmorphism camptodactyly, esophageal atresia coloboma talipes, extrasystoles short stature hyperpigmentation microcephaly, facial clefting corpus callosum agenesis, facio digito genital syndrome recessive form, facio skeletal genital syndrome rippberger type, familial capillaro-venous leptomeningeal angiomatosis, Dursun syndrome, Faye-Petersen-Ward-Carey syndrome, feigenbaum Bergeron syndrome, Feingold trainer syndrome, fetal brain disruption sequence, fetal enterovirus syndrome, fetal parainfluenza virus type 3 syndrome, fetal phenothiazine syndrome, fibromatosis multiple non ossifying, fibula aplasia complex brachydactyly, fibular hypoplasia scapulo pelvic dysplasia absent, Fitz-Hugh-Curtis syndrome, focal alopecia congenital megalencephaly, focal or multifocal malformations in neuronal migration, foix chavany Marie syndrome, Fontaine farriaux blanckaert syndrome, Fraser Jequier Chen syndrome, Freiberg disease, Friedman Goodman syndrome, frontonasal malformation cloacal exstrophy, frontonasal dysplasia Klippel feil syndrome, frontonasal dysplasia phocomelic upper limbs, Fryns Fabry Remans syndrome, Fryns Smeets Thiry syndrome, Fuchs atrophia gyrata chorioideae et retinae, Fukuda-Miyanomae-Nakata syndrome, Fuqua Berkovitz syndrome, Garret-Tripp syndrome, gas bloat syndrome, Gaucher ichthyosis restrictive dermopathy, gershinibaruch Leibo syndrome, Ghose-Sachdev-Kumar syndrome, gigantism advanced bone age hoarse cry, glossopalatine ankylosis micrognathia ear anomalies, goldstein hutt syndrome, goniodysgenesis intellectual disability short stature, green sandford davison syndrome, grix Blankenship Peterson syndrome, Ho-Kaufman-McAlister syndrome, Jaffer-Beighton syndrome, Judge Misch wright syndrome, Kashani-Strom-Utley syndrome, Kasznica-Carlson-Coppedge syndrome, Katsantoni-Papadakou-Lagoyanni syndrome, Kocher-debre-Semelaigne syndrome, Koone-Rizzo-Elias syndrome, Kozlowski Brown Hardwick syndrome, Kozlowski Ouvrier syndrome, Kozlowski Rafinski Klicharska syndrome, Kozlowski Warren Fisher syndrome, Krauss Herman Holmes syndrome, Krieble Bixler syndrome, Kuster Majewski Hammerstein syndrome, Kuster syndrome, Laugier-Hunziker syndrome, Laurence-Prosser-Rocker syndrome, le Marec-Bracq-Picaud syndrome, levator syndrome, Marinesco-Sjogren-like syndrome, Milner-Khallouf-Gibson syndrome, radio-digito-facial dysplasia, Seckel like syndrome majoor-krakauer type, neonatal aspiration syndrome, muscular fibrosis multifocal obstructed vessels, short stature contractures hypotonia, Alice in Wonderland syndrome, megacystis-microcolon-intestinal hypoperistalsis syndrome, Basilicata-Akhtar syndrome, Liberfarb syndrome, craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development syndrome, cardiac, facial, and digital anomalies with developmental delay, fibrosis, neurodegeneration, and cerebral angiomatosis, Duane anomaly-myopathy-scoliosis syndrome, congenital cataract-severe neonatal hepatopathy-global developmental delay syndrome, infantile hypotonia-oculomotor anomalies-hyperkinetic movements-developmental delay syndrome, acute radiation syndrome, monoclonal mast cell activation syndrome, oculocerebrodental syndrome, syndromic congenital sodium diarrhea, congenital brachyesophagus-intrathoracic stomach-vertebral anomalies syndrome, intellectual disability-cardiac anomalies-short stature-joint laxity syndrome, intrauterine growth restriction-congenital multiple café-au-lait macules-increased sister chromatid exchange syndrome, frontonasal dysplasia-bifid nose-upper limb anomalies syndrome, microcephaly-facial dysmorphism-ocular anomalies-multiple congenital anomalies syndrome, diaphragmatic hernia-short bowel-asplenia syndrome, warts-immunodeficiency-lymphedema-anogenital dysplasia syndrome, Cramp-fasciculation syndrome, choanal atresia-athelia-hypothyroidism-delayed puberty-short stature syndrome, blepharophimosis-intellectual disability syndrome/genitopatellar overlap syndrome, CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome, cerebellar hypoplasia-intellectual disability-congenital microcephaly-dystonia-anemia-growth retardation syndrome, KLHL7-related Bohring-Opitz-like syndrome, KLHL7-related cold-induced sweating-like syndrome, KAT6B-related multiple congenital anomalies syndrome, oculogastrointestinal-neurodevelopmental syndrome, spastic paraparesis-cataracts-speech delay syndrome, Ruzicka-Goerz-Anton syndrome, Sammartino-Decreccio syndrome, Samson-Gardner syndrome, Samson-Viljoen syndrome, Sanderson-Fraser syndrome, Sandhaus-Ben-Ami syndrome, prostatic malacoplakia associated with prostatic abscess, Saul-Wilkes-Stevenson syndrome, macrogyria, pseudobulbar palsy and intellectual disability, Schwartz-Cohen-addad-Lambert syndrome, Schlegelberger-Grote syndrome, Schrander-stumpel-Theunissen-Hulsmans syndrome, Saal-Bulas syndrome, Sackey-Sakati-Aur syndrome, Slti-Salem syndrome, Zerres Rietschel Majewski syndrome, Zazam Sheriff Phillips syndrome, Zadik-Barak-Levin syndrome, weinstein kliman scully syndrome, thickened earlobes with conductive deafness from incus-stapes abnormalities, ichthyosis linearis circumflexa, infantile striato thalamic degeneration, Landy-Donnai syndrome, merlob grunebaum reisner syndrome, Pavone Fiumara Rizzo syndrome, pfeiffer rockelein syndrome, Pfeiffer Tietze Welte syndrome, phosphoribosylpyrophosphate synthetase deficiency, piepkorn karp hickok syndrome, podder-tolmie syndrome, pointer syndrome, richieri-costa guion-almeida cohen syndrome, Rubinstein Taybi like syndrome, ruvalcaba churesigaew myhre syndrome, short limb dwarf lethal colavita kozlowski type, Mallory-Weiss syndrome, superior vena cava syndrome, piriformis syndrome, engraftment syndrome, Adams-Stokes syndrome, Leriche syndrome, multiple organ dysfunction syndrome, posterior leukoencephalopathy syndrome, cardio-renal syndrome, Rahman syndrome, X-linked keloid scarring-reduced joint mobility-increased optic cup-to-disc ratio syndrome, retinitis pigmentosa-hearing loss-premature aging-short stature-facial dysmorphism syndrome, congenital labioscrotal agenesis-cerebellar malformation-corneal dystrophy-facial dysmorphism syndrome, Lopes-Maciel-Rodan syndrome, Stankiewicz-Isidor syndrome, Skraban-Deardorff syndrome, joint laxity, short stature, and myopia, Sweeney-Cox syndrome, Alkuraya-Kucinskas syndrome, Jaberi-Elahi syndrome, neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, hearing impairment and infertile male syndrome, cardiocutaneous syndrome, neonatal diabetes, congenital sensorineural hearing loss and congenital cataracts, cardioectodermal syndrome, cannabinoid hyperemesis syndrome, retrograde cricopharyngeus dysfunction, Zinner syndrome, retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome, IFAP syndrome, DICER1-related tumor predisposition, Roberts-SC phocomelia syndrome, carcinoid syndrome, Bonnevie-Ullrich syndrome, NKX2-1 related choreoathetosis and congenital hypothyroidism with or without pulmonary dysfunction, RNU4ATAC spectrum disorder, syndromic congenital heart disease, hand-foot syndrome, central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease, gastrointestinal defects and immunodeficiency syndrome 1, achalasia-alacrima syndrome, black locks with albinism and deafness syndrome, Birt-Hogg-Dube syndrome, trigeminal trophic syndrome, developmental and/or epileptic encephalopathy with spike-wave activation in sleep, syndromic microspherophakia, painful legs and moving toes syndrome, congenital aphakia-iris hypoplasia-microphthalmia-microcornea syndrome, hereditary persistence of fetal hemoglobin-intellectual disability syndrome, developmental delay-immunodeficiency-leukoencephalopathy-hypohomocysteinemia syndrome, primary hypomagnesemia-generalized seizures-intellectual disability-obesity syndrome, post-cardiac arrest syndrome, early-onset obesity-hyperphagia-severe developmental delay syndrome, hereditary alpha tryptasemia syndrome, KINSSHIP syndrome, developmental delay, hypotrophy, and dysmorphic features without moebius syndrome, breast implant illness, cataracts, hearing impairment, nephrotic syndrome, and enterocolitis, craniosynostosis-facial dysmorphism-chiari-1 malformation-developmental and language delay syndrome, MYT1L-related developmental delay-intellectual disability-obesity syndrome, Houge-Janssens syndrome, xerosis and growth failure with immune and pulmonary dysfunction syndrome, Fliedner-Zweier syndrome, Lui-Jee-Baron syndrome, Long-Olsen-Distelmaier syndrome, Tan-Almurshedi syndrome, diabetes, deafness, developmental delay, and short stature syndrome, Alfadhel syndrome, Hoxha-Aliu syndrome, cleft palate-congenital heart defect-intellectual disability syndrome, congenital insensitivity to pain syndrome, Marsili type, Yuksel-Vogel-Bauer syndrome, polydactyly-macrocephaly syndrome, pyoderma gangrenosum-acne-hidradenitis suppurativa-ankylosing spondylitis syndrome, psoriatic arthritis-pyoderma gangrenosum-acne-hidradenitis suppurativa syndrome, megalencephaly-polydactyly syndrome, Leigh syndrome, mitochondrial, auroneurodental syndrome, orofacial clefting-cardiac anomalies-facial dysmorphism syndrome, Grisel syndrome, arterial tortuosity-bone fragility syndrome, dialysis disequilibrium syndrome, brain abnormalities-severe developmental delay-facial dysmorphism-intellectual disability syndrome due to MEF2C mutation, Kariminejad neurodevelopmental syndrome, myelofibrosis, congenital, with anemia, neutropenia, developmental delay, and ocular abnormalities, brain malformation renal syndrome, myopathy with myalgia, increased serum creatine kinase, and with or without episodic rhabdomyolysis 2, Karayol-Borroto-Haghshenas neurodevelopmental syndrome, neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, Morimoto-Ryu-Malicdan neuromuscular syndrome, neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, neurodevelopmental disorder with variable familial hypercholanemia, Pan-Chung-Bellen syndrome, telangiectasia, impaired intellectual development, microcephaly, metaphyseal dysplasia, eye abnormalities, and short stature, Muggenthaler-Chowdhury-Chioza syndrome, Tayoun-Maawali syndrome, ragopathy, cardiovascular-kidney-metabolic syndrome, craniofaciocardiohepatic syndrome, FICUS syndrome, Li-Takada-Miyake syndrome, Guillouet-Gordon syndrome, ICHAD syndrome, cataract, alopecia, oral mucosal disorder, and psoriasis-like syndrome, RAC2-related combined immunodeficiency-bronchiectasis-cancer-predisposing syndrome, oculovertebral syndrome, Alsahan-Harris syndrome, Ververi-Brady syndrome, Dursun-Ozgul neurodevelopmental syndrome, immune dysregulation, neurodevelopmental defects, and colitis, Harel-Tora neurodevelopmental syndrome, Valence-Farazi cerebellar ataxia syndrome, dyschromatosis, ichthyosis, deafness, and atopic disease, Ramond-Elliott neurodevelopmental syndrome, STAD syndrome, craniosynostosis-scoliosis syndrome, loin pain hematuria syndrome, IRF6-related condition, linkeropathy, NDUFB11-related disorders, CRYAB-related myofibrillar myopathy-cataract-cardiomyopathy spectrum disorder, TSEN2-related neurodevelopmental disorder with or without thrombotic microangiopathy, antiphospholipid syndrome
Genetics & variants
GWAS landscape
74 GWAS associations across 15 studies. Top hits map to 30 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|
| HLA-B*59:01 | 5e-22 | | ? | 4122.11 |
| rs6457109 | 3e-16 | POLR1HASP, POLR1HASP | C | 4.52 |
| rs7760545 | 4e-16 | POLR1HASP, POLR1HASP | A | 4.37 |
| rs35835721 | 8e-15 | POLR1HASP, POLR1HASP | G | 3.09 |
| rs137899365 | 3e-14 | LTBP3 | C | 6.63 |
| rs60581484 | 2e-13 | HLA-F-AS1, HLA-F | A | 4.2 |
| rs1131151 | 4e-12 | HLA-C | T | 70.77 |
| rs2074494 | 5e-12 | HLA-C | T | 63 |
| rs4917014 | 8e-11 | SPMIP7 - IKZF1 | ? | 2 |
| rs1562468327 | 6e-10 | TAB2 - ZC3H12D | TCAGCCAGTGTGTCAGTCAGCCAGTGTTAGTCAGCCAGTGTGTCAGTCAGCCAGTGTCAGCCACCCAGTGTCAGTCAGCCAGTGTGTCAGCCACTGTCAGCCAATGTCAGCCAGTGTGTCAGC | 9.7 |
| rs199755581 | 7e-10 | NIPAL2 | CA | 9.7 |
| rs11509487 | 1e-09 | MICB | T | 16.32 |
| rs9469003 | 2e-09 | MICA - LINC01149 | C | 1.73 |
| rs4471527 | 2e-09 | LINC02370 - LINC02414 | T | 5.7 |
| chr21:9790175 | 4e-09 | | CCTCTCTCCAGGCTCACACATTGAAGAGAA | 7.4 |
| rs28381346 | 5e-09 | MSH5, CLIC1, MSH5-SAPCD1 | A | 25.02 |
| rs6500265 | 6e-09 | ZNF423 - RPL34P29 | T | 2.65 |
| chr10:132158722 | 7e-09 | | ? | 2.28 |
| rs114908185 | 7e-09 | MUC22 | A | 31.12 |
| rs1297852527 | 9e-09 | SLC9B1P3 | G | 5.4 |
| rs17137412 | 1e-08 | UMAD1 | ? | 4 |
| rs1371146120 | 1e-08 | | A | 3.69 |
| rs77491650 | 1e-08 | DDX12P | C | 0.3 |
| chr4:820728 | 1e-08 | | G | 0.3 |
| rs77542827 | 1e-08 | FRG1JP, FRG1JP | T | 17.9 |
| rs3130501 | 2e-08 | POU5F1 | G | 1.74 |
| rs2734583 | 2e-08 | ATP6V1G2-DDX39B, DDX39B | ? | 66.8 |
| rs16957893 | 2e-08 | HCN4 - REC114 | C | 5.61 |
| rs548089948 | 2e-08 | XRCC6P3 | G | 45.06 |
| rs763863569 | 2e-08 | PTMAP10 - IMPDH1P3 | AT | 6.47 |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|
| GCST001181 | Genin E | 2011 | 424 | 1,881 | Genome-wide association study of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in Europe. |
| GCST90018927 | Sakaue S | 2021 | 312 | 483,011 | A cross-population atlas of genetic associations for 220 human phenotypes. |
| GCST90093113 | Kawai Y | 2021 | 133 | 0 | Mapping of susceptible variants for cold medicine-related Stevens-Johnson syndrome by whole-genome resequencing. |
| GCST004072 | Ueta M | 2017 | 117 | 0 | Genome-wide association study using the ethnicity-specific Japonica array: identification of new susceptibility loci for cold medicine-related Stevens-Johnson syndrome with severe ocular complications. |
| GCST002779 | Ueta M | 2015 | 117 | 0 | IKZF1, a new susceptibility gene for cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis with severe mucosal involvement. |
| GCST90103802 | Mullan KA | 2022 | 113 | 0 | Potential role of regulatory DNA variants in modifying the risk of severe cutaneous reactions induced by aromatic anti-seizure medications. |
| GCST90018707 | Sakaue S | 2021 | 93 | 171,753 | A cross-population atlas of genetic associations for 220 human phenotypes. |
| GCST90103803 | Mullan KA | 2022 | 85 | 0 | Potential role of regulatory DNA variants in modifying the risk of severe cutaneous reactions induced by aromatic anti-seizure medications. |
| GCST000942 | Shen Y | 2011 | 72 | 4,251 | Genome-wide association study of serious blistering skin rash caused by drugs. |
| GCST000832 | Ueta M | 2010 | 60 | 0 | Association between prostaglandin E receptor 3 polymorphisms and Stevens-Johnson syndrome identified by means of a genome-wide association study. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|
| Tier 1: coding | 1 |
| Tier 2: splice/UTR | 1 |
| Tier 3: regulatory | 1 |
| Tier 4: intronic/intergenic | 47 |
MAF distribution
| Bucket | Variants |
|---|
| common (>=0.05) | 33 |
| low_freq (0.01-0.05) | 9 |
| rare (<0.01) | 4 |
| unknown | 4 |
Functional consequences
| Consequence | Count |
|---|
| intron_variant | 27 |
| intergenic_variant | 10 |
| unknown | 6 |
| non_coding_transcript_exon_variant | 2 |
| synonymous_variant | 2 |
| 3_prime_UTR_variant | 1 |
| missense_variant | 1 |
| regulatory_region_variant | 1 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|
| HLA-B*59:01 | | | | | | | 5e-22 | Tier 4: intronic/intergenic |
| rs6457109 | 6 | 29965484 | T>C | 0.252 | intron_variant | POLR1HASP, POLR1HASP | 3e-16 | Tier 4: intronic/intergenic |
| rs7760545 | 6 | 29865695 | C>A,G | 0.259 | intron_variant | POLR1HASP, POLR1HASP | 4e-16 | Tier 4: intronic/intergenic |
| rs35835721 | 6 | 29974609 | T>C,G | 0.462 | intron_variant | POLR1HASP, POLR1HASP | 8e-15 | Tier 4: intronic/intergenic |
| rs137899365 | 11 | 65558514 | C>CTGGGGGG | 0.147 | intron_variant | LTBP3 | 3e-14 | Tier 4: intronic/intergenic |
| rs60581484 | 6 | 29729537 | T>A | 0.218 | 3_prime_UTR_variant | HLA-F-AS1, HLA-F | 2e-13 | Tier 2: splice/UTR |
| rs1131151 | 6 | 31271853 | C>A,T | 0.006 | missense_variant | HLA-C | 4e-12 | Tier 1: coding |
| rs2074494 | 6 | 31271956 | C>G,T | 0.007 | non_coding_transcript_exon_variant | HLA-C | 5e-12 | Tier 4: intronic/intergenic |
| rs4917014 | 7 | 50266267 | T>C,G | 0.05 | intergenic_variant | SPMIP7 - IKZF1 | 8e-11 | Tier 4: intronic/intergenic |
| rs1562468327 | 6 | 149444136 | TCAGCCAGTGTGTCAGTCAGCCAGTGTTAGTCAGCCAGTGTGTCAGTCAGCCAGTGTCAGCCACCCAGTGTCAGTCAGCCAGTGTGTCAGCCACTGTCAGCCAATGTCAGCCAGTGTGTCAGC>T | 0.1 | regulatory_region_variant | TAB2 - ZC3H12D | 6e-10 | Tier 3: regulatory |
| rs199755581 | 8 | 98263824 | CA>C | 0.1 | intron_variant | NIPAL2 | 7e-10 | Tier 4: intronic/intergenic |
| rs11509487 | 6 | 31507308 | C>CTGGGGTGA | 0.071 | intron_variant | MICB | 1e-09 | Tier 4: intronic/intergenic |
| rs9469003 | 6 | 31440051 | T>C | 0.15 | intron_variant | MICA - LINC01149 | 2e-09 | Tier 4: intronic/intergenic |
| rs4471527 | 12 | 131623246 | T>A,C | 0.08 | intergenic_variant | LINC02370 - LINC02414 | 2e-09 | Tier 4: intronic/intergenic |
| chr21:9790175 | | | | 0.16 | | | 4e-09 | Tier 4: intronic/intergenic |
| rs28381346 | 6 | 31740377 | C>T | 0.029 | intron_variant | MSH5, CLIC1, MSH5-SAPCD1 | 5e-09 | Tier 4: intronic/intergenic |
| rs6500265 | 16 | 49912759 | C>G,T | 0.278 | intergenic_variant | ZNF423 - RPL34P29 | 6e-09 | Tier 4: intronic/intergenic |
| chr10:132158722 | | | | 0.5 | | | 7e-09 | Tier 4: intronic/intergenic |
| rs114908185 | 6 | 31029214 | A>G | 0.041 | synonymous_variant | MUC22 | 7e-09 | Tier 4: intronic/intergenic |
| rs1297852527 | 10 | 38643144 | A>C,G | 0.08 | intron_variant | SLC9B1P3 | 9e-09 | Tier 4: intronic/intergenic |
| rs17137412 | 7 | 7761056 | T>G | 0.05 | intron_variant | UMAD1 | 1e-08 | Tier 4: intronic/intergenic |
| rs1371146120 | | | | 0.147 | | | 1e-08 | Tier 4: intronic/intergenic |
| rs77491650 | 12 | 9426934 | G>C,T | 0.49 | intron_variant | DDX12P | 1e-08 | Tier 4: intronic/intergenic |
| chr4:820728 | | | | 0.49 | | | 1e-08 | Tier 4: intronic/intergenic |
| rs77542827 | 9 | 63832271 | G>C,T | 0.03 | intron_variant | FRG1JP, FRG1JP | 1e-08 | Tier 4: intronic/intergenic |
| rs3130501 | 6 | 31168676 | A>G,T | 0.26 | intron_variant | POU5F1 | 2e-08 | Tier 4: intronic/intergenic |
| rs2734583 | 6 | 31537703 | A>C,G,T | 0.005 | intron_variant | ATP6V1G2-DDX39B, DDX39B | 2e-08 | Tier 4: intronic/intergenic |
| rs16957893 | 15 | 73437142 | G>C | 0.08 | intergenic_variant | HCN4 - REC114 | 2e-08 | Tier 4: intronic/intergenic |
| rs548089948 | 1 | 220314423 | A>G | | non_coding_transcript_exon_variant | XRCC6P3 | 2e-08 | Tier 4: intronic/intergenic |
| rs763863569 | 7 | 138431958 | A>AT | | intron_variant | PTMAP10 - IMPDH1P3 | 2e-08 | Tier 4: intronic/intergenic |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 11 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 1
Dual-evidence genes (GWAS + Mendelian — highest-confidence targets)
| Gene | HGNC | Evidence routes |
|---|
| IKZF1 | IKZF1 | GWAS, Orphanet |
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|
| IKZF1 | Orphanet:317473 | Common variable immunodeficiency phenotype due to IKAROS functional haploinsufficiency |
| IKZF1 | Orphanet:36426 | Stevens-Johnson syndrome |
| IKZF1 | Orphanet:585909 | B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2) |
| IKZF1 | Orphanet:695172 | Combined immunodeficiency due to dimerization defective IKAROS mutation |
| IKZF1 | Orphanet:697414 | Early-onset combined immunodeficiency with low Ig due to dominant negative IKAROS mutation |
| ZNF423 | Orphanet:2318 | Joubert syndrome with oculorenal defect |
| ZNF423 | Orphanet:93591 | Infantile nephronophthisis |
| HLA-C | Orphanet:585909 | B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2) |
| MAFB | Orphanet:233 | Duane retraction syndrome |
| MAFB | Orphanet:2774 | Multicentric carpo-tarsal osteolysis with or without nephropathy |
| MAFB | Orphanet:529574 | Duane retraction syndrome with congenital deafness |
Cohort genes → proteins
22 cohort genes, 17 distinct canonical proteins.
Evidence partition
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|
| RPA3 | HGNC:10291 | ENSG00000106399 | P35244 | Replication protein A 14 kDa subunit | gwas |
| TCF19 | HGNC:11629 | ENSG00000137310 | Q9Y242 | Transcription factor 19 | gwas |
| IKZF1 | HGNC:13176 | ENSG00000185811 | Q13422 | DNA-binding protein Ikaros | gwas |
| DDX39B | HGNC:13917 | ENSG00000198563 | Q13838 | Spliceosome RNA helicase DDX39B | gwas |
| CCHCR1 | HGNC:13930 | ENSG00000204536 | Q8TD31 | Coiled-coil alpha-helical rod protein 1 | gwas |
| ZNF423 | HGNC:16762 | ENSG00000102935 | Q2M1K9 | Zinc finger protein 423 | gwas |
| PSORS1C1 | HGNC:17202 | ENSG00000204540 | Q9UIG5 | Psoriasis susceptibility 1 candidate gene 1 protein | gwas |
| PSORS1C3 | HGNC:17203 | ENSG00000204528 | | psoriasis susceptibility 1 candidate 3 | gwas |
| NPTN | HGNC:17867 | ENSG00000156642 | Q9Y639 | Neuroplastin | gwas |
| CD276 | HGNC:19137 | ENSG00000103855 | Q5ZPR3 | CD276 antigen | gwas |
| ADAM22 | HGNC:201 | ENSG00000008277 | Q9P0K1 | Disintegrin and metalloproteinase domain-containing protein 22 | gwas |
| SLC22A23 | HGNC:21106 | ENSG00000137266 | A1A5C7 | Solute carrier family 22 member 23 | gwas |
| MUC21 | HGNC:21661 | ENSG00000204544 | Q5SSG8 | Mucin-21 | gwas |
| CYCSP5 | HGNC:24416 | ENSG00000227735 | | CYCS pseudogene 5 | gwas |
| REC114 | HGNC:25065 | ENSG00000183324 | Q7Z4M0 | Meiotic recombination protein REC114 | gwas |
| CNEP1R1 | HGNC:26759 | ENSG00000205423 | Q8N9A8 | Nuclear envelope phosphatase-regulatory subunit 1 | gwas |
| POLR2LP1 | HGNC:31340 | ENSG00000238211 | | RNA polymerase II subunit L pseudogene 1 | gwas |
| HLA-C | HGNC:4933 | ENSG00000204525 | P10321 | HLA class I histocompatibility antigen, C alpha chain | gwas |
| MAFB | HGNC:6408 | ENSG00000204103 | Q9Y5Q3 | Transcription factor MafB | gwas |
| MICC | HGNC:7092 | ENSG00000226577 | | MHC class I polypeptide-related sequence C (pseudogene) | gwas |
| POU5F1 | HGNC:9221 | ENSG00000204531 | Q01860 | POU domain, class 5, transcription factor 1 | gwas |
| PPIAP9 | HGNC:9272 | ENSG00000219797 | | peptidylprolyl isomerase A pseudogene 9 | gwas |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|
| RPA3 | Replication protein A 14 kDa subunit | As part of the heterotrimeric replication protein A complex (RPA/RP-A), binds and stabilizes single-stranded DNA intermediates that form during DNA replication or upon DNA stress. |
| TCF19 | Transcription factor 19 | Potential transcription factor that may play a role in the regulation of genes involved in cell cycle G1/S transition. |
| IKZF1 | DNA-binding protein Ikaros | Transcription regulator of hematopoietic cell differentiation. |
| DDX39B | Spliceosome RNA helicase DDX39B | Involved in nuclear export of spliced and unspliced mRNA. |
| CCHCR1 | Coiled-coil alpha-helical rod protein 1 | May be a regulator of keratinocyte proliferation or differentiation. |
| ZNF423 | Zinc finger protein 423 | Transcription factor that can both act as an activator or a repressor depending on the context. |
| NPTN | Neuroplastin | Probable homophilic and heterophilic cell adhesion molecule involved in long term potentiation at hippocampal excitatory synapses through activation of p38MAPK. |
| CD276 | CD276 antigen | May participate in the regulation of T-cell-mediated immune response. |
| ADAM22 | Disintegrin and metalloproteinase domain-containing protein 22 | Probable ligand for integrin in the brain. |
| REC114 | Meiotic recombination protein REC114 | Required for DNA double-strand breaks (DSBs) formation in unsynapsed regions during meiotic recombination. |
| CNEP1R1 | Nuclear envelope phosphatase-regulatory subunit 1 | Forms with the serine/threonine protein phosphatase CTDNEP1 an active complex which dephosphorylates and may activate LPIN1 and LPIN2. |
| HLA-C | HLA class I histocompatibility antigen, C alpha chain | Antigen-presenting major histocompatibility complex class I (MHCI) molecule with an important role in reproduction and antiviral immunity. |
| MAFB | Transcription factor MafB | Acts as a transcriptional activator or repressor. |
| POU5F1 | POU domain, class 5, transcription factor 1 | Transcription factor that binds to the octamer motif (5’-ATTTGCAT-3’). |
Protein-family classification
Druggable: 5 · Difficult: 5 · Unknown: 12 · Druggable fraction: 0.23
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|
| Antibody/Immunoglobulin | 3 | 4.0× | 0.190 |
| Transcription factor | 5 | 1.9× | 0.297 |
| Transporter | 1 | 3.5× | 0.413 |
| Protease | 1 | 1.7× | 0.571 |
| Other/Unknown | 12 | 1.0× | 0.634 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|
| RPA3 | Other/Unknown | no | | NA-bd_OB-fold, Rfa2 |
| TCF19 | Transcription factor | no | | FHA_dom, Znf_PHD, SMAD_FHA_dom_sf |
| IKZF1 | Transcription factor | no | | Znf_C2H2_type, Znf_C2H2_sf, Ikaros_C2H2-ZF |
| DDX39B | Other/Unknown | no | | Helicase_C-like, DEAD/DEAH_box_helicase_dom, Helicase_ATP-bd |
| CCHCR1 | Other/Unknown | no | | HCR |
| ZNF423 | Transcription factor | no | | Znf_C2H2_type, Znf_C2H2_sf |
| PSORS1C1 | Other/Unknown | no | | SEEK1 |
| PSORS1C3 | Other/Unknown | no | | |
| NPTN | Antibody/Immunoglobulin | yes | | Ig_sub2, Ig_sub, Ig-like_dom |
| CD276 | Antibody/Immunoglobulin | yes | | Ig_C1-set, Ig_sub2, Ig_sub |
| ADAM22 | Protease | yes | | EGF, Peptidase_M12B, Disintegrin_dom |
| SLC22A23 | Transporter | yes | | MFS_sugar_transport-like, Sugar_transporter_CS, MFS_dom |
| MUC21 | Other/Unknown | no | | Tandem-repeating_mucin, Mucin_dom |
| CYCSP5 | Other/Unknown | no | | |
| REC114 | Other/Unknown | no | | REC114L |
| CNEP1R1 | Other/Unknown | no | | NEP1-R1 |
| POLR2LP1 | Other/Unknown | no | | |
| HLA-C | Antibody/Immunoglobulin | yes | | MHC_I_a_a1/a2, Ig_C1-set, Ig-like_dom |
| MAFB | Transcription factor | no | | bZIP_Maf, bZIP, TF_DNA-bd_sf |
| MICC | Other/Unknown | no | | |
| POU5F1 | Transcription factor | no | | POU_dom, HD, Homeodomain-like_sf |
| PPIAP9 | Other/Unknown | no | | |
Expression context
Cohort genes with no expression data: 0.
13 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|
| narrow (1-5 tissues) | 1 |
| moderate (6-20) | 0 |
| broad (>20) | 21 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|
| primordial germ cell in gonad | 6 |
| ventricular zone | 4 |
| right testis | 3 |
| stromal cell of endometrium | 3 |
| left testis | 2 |
| testis | 2 |
| metanephros cortex | 2 |
| lateral nuclear group of thalamus | 2 |
| ganglionic eminence | 2 |
| blood | 2 |
| bronchial epithelial cell | 1 |
| bronchus | 1 |
| epithelium of bronchus | 1 |
| lymph node | 1 |
| leukocyte | 1 |
| monocyte | 1 |
| mononuclear cell | 1 |
| adenohypophysis | 1 |
| granulocyte | 1 |
| biceps brachii | 1 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|
| RPA3 | 287 | ubiquitous | marker | bronchial epithelial cell, epithelium of bronchus, bronchus |
| TCF19 | 133 | ubiquitous | yes | primordial germ cell in gonad, ventricular zone, lymph node |
| IKZF1 | 225 | broad | marker | leukocyte, monocyte, mononuclear cell |
| DDX39B | 263 | ubiquitous | marker | granulocyte, adenohypophysis, ventricular zone |
| CCHCR1 | 134 | ubiquitous | marker | left testis, right testis, testis |
| ZNF423 | 252 | broad | marker | skeletal muscle tissue of biceps brachii, biceps brachii, cartilage tissue |
| PSORS1C1 | 124 | ubiquitous | yes | left testis, right testis, testis |
| PSORS1C3 | 125 | tissue_specific | yes | primordial germ cell in gonad, gall bladder, metanephros cortex |
| NPTN | 295 | ubiquitous | marker | Brodmann (1909) area 23, lateral nuclear group of thalamus, cerebellar vermis |
| CD276 | 233 | ubiquitous | marker | stromal cell of endometrium, ganglionic eminence, ventricular zone |
| ADAM22 | 221 | ubiquitous | yes | lateral nuclear group of thalamus, middle temporal gyrus, pons |
| SLC22A23 | 247 | ubiquitous | marker | pancreatic ductal cell, ileal mucosa, ganglionic eminence |
| MUC21 | 103 | tissue_specific | marker | lower esophagus mucosa, esophagus mucosa, vagina |
| CYCSP5 | 97 | | yes | primordial germ cell in gonad, male germ line stem cell (sensu Vertebrata) in testis, corpus callosum |
| REC114 | 99 | tissue_specific | yes | oocyte, secondary oocyte, right testis |
| CNEP1R1 | 255 | ubiquitous | marker | left ventricle myocardium, upper arm skin, cardiac muscle of right atrium |
| POLR2LP1 | 83 | | yes | primordial germ cell in gonad, right coronary artery, colonic epithelium |
| HLA-C | 134 | ubiquitous | marker | blood, right lung, spleen |
| MAFB | 277 | ubiquitous | marker | renal glomerulus, skin of hip, gingiva |
| MICC | 2 | | yes | stromal cell of endometrium, ventricular zone, bone marrow cell |
| POU5F1 | 132 | tissue_specific | marker | primordial germ cell in gonad, right uterine tube, metanephros cortex |
| PPIAP9 | 130 | | yes | primordial germ cell in gonad, blood, stromal cell of endometrium |
Protein interactions among cohort
Intra-cohort edges: 3.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|
| DDX39B | 5,600 |
| RPA3 | 5,390 |
| IKZF1 | 4,096 |
| MAFB | 2,671 |
| CD276 | 2,292 |
| TCF19 | 1,774 |
| NPTN | 1,675 |
| ZNF423 | 1,526 |
| CCHCR1 | 1,383 |
| REC114 | 1,185 |
Intra-cohort edges
| A | B | Sources |
|---|
| CCHCR1 | PSORS1C1 | string_interaction |
| CCHCR1 | TCF19 | string_interaction |
| PSORS1C1 | TCF19 | string_interaction |
Structural data
PDB: 10 · AlphaFold-only: 7 · No structure: 5
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|
| DDX39B | Q13838 | 17 |
| POU5F1 | Q01860 | 16 |
| HLA-C | P10321 | 13 |
| RPA3 | P35244 | 10 |
| IKZF1 | Q13422 | 10 |
| ADAM22 | Q9P0K1 | 10 |
| CD276 | Q5ZPR3 | 3 |
| CNEP1R1 | Q8N9A8 | 2 |
| ZNF423 | Q2M1K9 | 1 |
| NPTN | Q9Y639 | 1 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|
| CCHCR1 | Q8TD31 | 79.52 |
| MUC21 | Q5SSG8 | 74.30 |
| REC114 | Q7Z4M0 | 73.71 |
| SLC22A23 | A1A5C7 | 73.39 |
| MAFB | Q9Y5Q3 | 63.87 |
| TCF19 | Q9Y242 | 63.17 |
| PSORS1C1 | Q9UIG5 | 55.10 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 79. Enrichment computed across 22 evidence-associated genes (12 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 12 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|
| POU5F1 (OCT4), SOX2, NANOG repress genes related to differentiation | 1 | 95.2× | 0.070 | POU5F1 |
| Endosomal/Vacuolar pathway | 1 | 86.5× | 0.070 | HLA-C |
| Formation of the anterior neural plate | 1 | 86.5× | 0.070 | POU5F1 |
| POU5F1 (OCT4), SOX2, NANOG activate genes related to proliferation | 1 | 73.2× | 0.070 | POU5F1 |
| Specification of primordial germ cells | 1 | 73.2× | 0.070 | POU5F1 |
| Mismatch repair (MMR) directed by MSH2:MSH6 (MutSalpha) | 1 | 68.0× | 0.070 | RPA3 |
| Mismatch repair (MMR) directed by MSH2:MSH3 (MutSbeta) | 1 | 68.0× | 0.070 | RPA3 |
| LGI-ADAM interactions | 1 | 68.0× | 0.070 | ADAM22 |
| Removal of the Flap Intermediate | 1 | 68.0× | 0.070 | RPA3 |
| Depolymerization of the Nuclear Lamina | 1 | 63.4× | 0.070 | CNEP1R1 |
| Translesion synthesis by REV1 | 1 | 59.5× | 0.070 | RPA3 |
| Defective GALNT3 causes HFTC | 1 | 59.5× | 0.070 | MUC21 |
| Defective GALNT12 causes CRCS1 | 1 | 59.5× | 0.070 | MUC21 |
| Defective C1GALT1C1 causes TNPS | 1 | 56.0× | 0.070 | MUC21 |
| Translesion synthesis by POLI | 1 | 56.0× | 0.070 | RPA3 |
| Germ layer formation at gastrulation | 1 | 56.0× | 0.070 | POU5F1 |
| Removal of the Flap Intermediate from the C-strand | 1 | 52.9× | 0.070 | RPA3 |
| Translesion synthesis by POLK | 1 | 52.9× | 0.070 | RPA3 |
| Specification of the neural plate border | 1 | 52.9× | 0.070 | POU5F1 |
| Translesion Synthesis by POLH | 1 | 50.1× | 0.070 | RPA3 |
| Transcriptional regulation of pluripotent stem cells | 1 | 45.3× | 0.070 | POU5F1 |
| PCNA-Dependent Long Patch Base Excision Repair | 1 | 43.3× | 0.070 | RPA3 |
| Termination of O-glycan biosynthesis | 1 | 41.4× | 0.070 | MUC21 |
| DAP12 interactions | 1 | 39.6× | 0.070 | HLA-C |
| RHOBTB2 GTPase cycle | 1 | 39.6× | 0.070 | DDX39B |
| Nuclear Envelope Breakdown | 1 | 38.1× | 0.070 | CNEP1R1 |
| Activation of HOX genes during differentiation | 1 | 36.6× | 0.070 | MAFB |
| Gap-filling DNA repair synthesis and ligation in GG-NER | 1 | 36.6× | 0.070 | RPA3 |
| NOTCH3 Intracellular Domain Regulates Transcription | 1 | 36.6× | 0.070 | IKZF1 |
| Dectin-2 family | 1 | 35.2× | 0.070 | MUC21 |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 16 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|
| rhombomere 6 development | 1 | 1053.2× | 0.033 | MAFB |
| cell fate commitment involved in formation of primary germ layer | 1 | 1053.2× | 0.033 | POU5F1 |
| regulation of receptor localization to synapse | 1 | 1053.2× | 0.033 | NPTN |
| endodermal-mesodermal cell signaling | 1 | 526.6× | 0.033 | POU5F1 |
| rhombomere 5 development | 1 | 526.6× | 0.033 | MAFB |
| abducens nerve formation | 1 | 526.6× | 0.033 | MAFB |
| brain segmentation | 1 | 351.1× | 0.043 | MAFB |
| regulation of asymmetric cell division | 1 | 263.3× | 0.044 | POU5F1 |
| cardiac cell fate determination | 1 | 263.3× | 0.044 | POU5F1 |
| regulation of myeloid cell differentiation | 1 | 210.7× | 0.046 | MAFB |
| endodermal cell fate specification | 1 | 175.5× | 0.046 | POU5F1 |
| lymphocyte differentiation | 1 | 175.5× | 0.046 | IKZF1 |
| cornified envelope assembly | 1 | 175.5× | 0.046 | MAFB |
| meiotic DNA double-strand break formation | 1 | 150.5× | 0.050 | REC114 |
| heart induction | 1 | 131.7× | 0.050 | POU5F1 |
| segment specification | 1 | 131.7× | 0.050 | MAFB |
| positive regulation of long-term neuronal synaptic plasticity | 1 | 117.0× | 0.053 | NPTN |
| negative regulation of erythrocyte differentiation | 1 | 95.8× | 0.056 | MAFB |
| positive regulation of fibroblast growth factor receptor signaling pathway | 1 | 95.8× | 0.056 | NPTN |
| antigen processing and presentation of endogenous peptide antigen via MHC class Ib | 1 | 81.0× | 0.056 | HLA-C |
| antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-independent | 1 | 81.0× | 0.056 | HLA-C |
| positive regulation of triglyceride biosynthetic process | 1 | 81.0× | 0.056 | CNEP1R1 |
| excitatory synapse assembly | 1 | 81.0× | 0.056 | NPTN |
| regulation of DNA-templated transcription | 3 | 5.9× | 0.057 | ZNF423, MAFB, POU5F1 |
| positive regulation of synaptic transmission | 1 | 70.2× | 0.059 | ADAM22 |
| dendrite self-avoidance | 1 | 65.8× | 0.060 | NPTN |
| regulation of gene expression | 2 | 10.4× | 0.060 | TCF19, POU5F1 |
| negative regulation of cell-cell adhesion | 1 | 62.0× | 0.060 | MUC21 |
| RNA export from nucleus | 1 | 58.5× | 0.061 | DDX39B |
| integrated stress response signaling | 1 | 43.9× | 0.076 | MAFB |
Therapeutics
Drugs indicated for this disease
3 approved, 3 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
Earlier-phase candidates (phase 2, investigational — efficacy not yet established): Infliximab.
Drug target analysis
Approved (phase 4): 2 · Phase ≥3: 2 · Phased (≥1): 2 · Undrugged: 20
Druggability breadth: 6 of 22 evidence-associated genes (27%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|
| IKZF1 | POMALIDOMIDE |
| POU5F1 | FAMOTIDINE |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|
| IKZF1 | 3 | 4 |
| POU5F1 | 1 | 4 |
| RPA3 | 0 | 0 |
| TCF19 | 0 | 0 |
| DDX39B | 0 | 0 |
| CCHCR1 | 0 | 0 |
| ZNF423 | 0 | 0 |
| PSORS1C1 | 0 | 0 |
| PSORS1C3 | 0 | 0 |
| NPTN | 0 | 0 |
Drugs targeting cohort genes (top 30)
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 0.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|
| IKZF1 | 106 | Binding:105, Functional:1 |
| POU5F1 | 36 | Binding:36 |
| RPA3 | 1 | Binding:1 |
| DDX39B | 1 | Binding:1 |
| HLA-C | 1 | Binding:1 |
Cohort genes with high screening signal
≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.
| Symbol | ChEMBL assays |
|---|
| IKZF1 | 106 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 21; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
4 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
| Compound | Max phase | Cohort target (bioactivity) |
|---|
| POMALIDOMIDE | 4 | IKZF1 |
| LENALIDOMIDE | 4 | IKZF1 |
| FAMOTIDINE | 4 | POU5F1 |
| IBERDOMIDE | 3 | IKZF1 |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|
| A | Approved (phase 4 drug) | 2 | IKZF1, POU5F1 |
| B | Phased (≥1) drug, not yet approved | 0 | |
| C | Druggable family + PDB, no drug | 4 | NPTN, CD276, ADAM22, HLA-C |
| D | Druggable family + AlphaFold only, no drug | 1 | SLC22A23 |
| E | Difficult family or no structure, no drug | 15 | RPA3, TCF19, DDX39B, CCHCR1, ZNF423, PSORS1C1, PSORS1C3, MUC21, CYCSP5, REC114 (+5 more) |
Undrugged target profiles
20 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|
| RPA3 | 1 | — |
| TCF19 | 0 | — |
| DDX39B | 1 | — |
| CCHCR1 | 0 | — |
| ZNF423 | 0 | — |
| PSORS1C1 | 0 | — |
| PSORS1C3 | 0 | — |
| NPTN | 0 | — |
| CD276 | 0 | — |
| ADAM22 | 0 | — |
| SLC22A23 | 0 | — |
| MUC21 | 0 | — |
| CYCSP5 | 0 | — |
| REC114 | 0 | — |
| CNEP1R1 | 0 | — |
| POLR2LP1 | 0 | — |
| HLA-C | 1 | — |
| MAFB | 0 | — |
| MICC | 0 | — |
| PPIAP9 | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 24.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|
| Not specified | 12 |
| PHASE1/PHASE2 | 5 |
| PHASE3 | 3 |
| PHASE4 | 2 |
| PHASE2 | 1 |
| PHASE1 | 1 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|
| NCT01488396 | PHASE4 | COMPLETED | Efficacy of 0.05% Cyclosporin Eye Drop in Stevens Johnson Syndrome Patient With Chronic Dry Eye |
| NCT02739295 | PHASE4 | COMPLETED | G-CSF in the Treatment of Toxic Epidermal Necrolysis |
| NCT00346450 | PHASE3 | COMPLETED | Autologous ex Vivo Conjunctival Epithelial Cell Expansion for Ocular Surface Transplantation |
| NCT01696500 | PHASE3 | COMPLETED | Phase III Clinical Trial of NPB-01 in Patients With Stevens-Johnson Syndrome/ Toxic Epidermal Necrolysis Unresponsive to Corticosteroids. |
| NCT02987257 | PHASE3 | COMPLETED | NATIENS: Optimal Management and Mechanisms of SJS/TEN |
| NCT07014059 | PHASE2 | NOT_YET_RECRUITING | Autologous Serum Obtained by a Closed-Circuit Collection Device |
| NCT01256489 | PHASE1/PHASE2 | WITHDRAWN | Infliximab to Improve Retention of the Boston Keratoprosthesis in Patients After Stevens Johnson Syndrome/ Toxic Epidermal Necrolysis (SJS/TENS) |
| NCT01582880 | PHASE1/PHASE2 | COMPLETED | Use of Cross-linked Donor Corneas as Carriers for the Boston Keratoprosthesis |
| NCT02037347 | PHASE1/PHASE2 | TERMINATED | Study to Evaluate the Use of Palifermin to Treat Toxic Epidermal Necrolysis |
| NCT02126020 | PHASE1/PHASE2 | WITHDRAWN | Topical Infliximab in Autoimmune Eyes With Keratoprosthesis |
| NCT05520086 | PHASE1/PHASE2 | UNKNOWN | Clinical Trial to Evaluate Safety and Efficacy of Cell Therapy in Patients With Cicatricial Conjuntivitis. |
| NCT06926478 | PHASE1 | NOT_YET_RECRUITING | Subconjunctival Humira for Boston Keratoprosthesis |
| NCT02149732 | Not specified | AVAILABLE | Clinical Trial on the Effect of Autologous Oral Mucosal Epithelial Sheet Transplantation |
| NCT03659227 | Not specified | RECRUITING | Drug Reactions Sampling (COLLECTIONTOXIDERMIES) |
| NCT00844038 | Not specified | COMPLETED | Stevens-Johnson Syndrome Antimicrobial |
| NCT01122303 | Not specified | UNKNOWN | Corneal Epitheliotropic Factors in Autologous Serum Eye Drops in Nonautoimmune and Stevens-Johnson Syndrome With Dry Eye |
| NCT02945176 | Not specified | COMPLETED | Safety and Performance Study of the ARGOS-IO System in Patients Undergoing Boston Keratoprosthesis Implantation |
| NCT03046914 | Not specified | UNKNOWN | HLA-B*5801 Screening to Prevent Allopurinol-induced Severe Cutaneous Adverse Reaction |
| NCT03585946 | Not specified | WITHDRAWN | Outcomes in Stevens Johnsons Syndrome and Toxic Epidermal Necrolysis |
| NCT04313725 | Not specified | TERMINATED | Evaluation of Tangible Boost for Patients With Stevens Johnson Syndrome, Sjogren’s Syndrome, and Graft Vs Host Disease |
| NCT05145959 | Not specified | UNKNOWN | Meibomian Gland Probing in the Sub-Acute Phase of Patients With Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis |
| NCT05284929 | Not specified | UNKNOWN | Human Leukocyte Antigen Class II (DRB1 and DQB1) Alleles and Haplotypes Frequencies in Patients With Pemphigus Vulgaris Among the Russian Population |
| NCT06263140 | Not specified | COMPLETED | Vitamin D Levels in Non-immediate Drug Hypersensitivity Case-control Study |
| NCT06474078 | Not specified | COMPLETED | Study To Evaluate The Efficacy Of Tofacitinib In Patients With SJS/TEN |
Drugs tested across these trials (top 30)
- Cohort genes: RPA3, TCF19, IKZF1, DDX39B, CCHCR1, ZNF423, PSORS1C1, PSORS1C3, NPTN, CD276, ADAM22, SLC22A23, MUC21, REC114, CNEP1R1, HLA-C, MAFB, POU5F1
- Drugs: Palifermin, Riboflavin, Sodium Chloride