Stomach polyp

Summary

Stomach polyp (MONDO:0008277) is a disease with 1 cohort gene (25 GWAS associations across 5 studies) and 9 clinical trials. Top therapeutic interventions include epinephrine and racepinephrine.

At a glance

• Cohort genes: 1
• GWAS associations: 25
• ClinVar variants: 1
• Clinical trials: 9

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	stomach polyp
Mondo ID	MONDO:0008277
MeSH	C562464
ICD-11	731629989
NCIT	C3954
SNOMED CT	87252009
UMLS	C0236048
MedGen	68629
Is cancer (heuristic)	no

Also known as: gastric polyp · gastric polyposa · polyps of stomach · polyps of the stomach

Data availability: 1 ClinVar variant · 25 GWAS associations (5 studies).

Disease family

An umbrella term covering 1 Mondo subtype.

Classification path: disease › human disease › disease by body system or component › digestive system disorder › stomach disorder › stomach polyp

Related subtypes (18): gastric ulcer, functional gastric disease, Dieulafoy lesion, pylorospasm, cascade stomach, pyloric stenosis, gastric dilatation, stomach diverticulosis, gastritis, gastroesophageal reflux disease, hiatus hernia, non-hypoproteinemic hypertrophic gastropathy, gastric neoplasm, angiodysplasia of stomach, achlorhydria, gastric intestinal metaplasia, gastric duplication, pyloric duplication

Subtypes (1): gastric adenoma

Genetics & variants

GWAS landscape

25 GWAS associations across 5 studies. Top hits map to 19 distinct genes (as reported by GWAS).

Top associations by p-value

rsID	p-value	Gene	Risk allele	Odds ratio
rs6121558	7e-31	RPS21, RPS21-DT	?	0.86
rs2990223	9e-21	GBA1LP, GBA1LP	G	0.17
rs111765775	4e-20	GREM1 - FMN1	?	1.15
rs138517736	5e-17	ERBB4	AAAGG	0.19
rs11264341	6e-17	TRIM46	?	1.17
rs113602546	5e-16	ERBB4	?	1.27
rs143117247	1e-14	ARHGAP11A-SCG5, SCG5	?	1.4
rs16888589	2e-13	LINC00536 - EIF3H	?	1.15
rs7767441	3e-12	BMP5	?	0.93
rs6760554	7e-12	ERBB4	?	0.88
rs687093	1e-10	PITX1-AS1	?	0.93
rs11213820	3e-10	POU2AF2 - COLCA1	?	1.07
rs35352860	4e-10	SMAD7	?	0.93
rs2123067	7e-10	FMN1	?	1.07
rs62446187	3e-09	EPS15P1 - MRPL42P4	?	1.07
rs372173246	4e-09	JRK, PSCA	C	0.23
rs4714707	1e-08	LINC02537 - LINC01512	C	0.25
rs2596827	1e-08	TSEN2	G	0.1
rs2613964	1e-08	NEPRO-AS1	?	0.94
rs34647020	1e-08	SIPA1L1	?	0.88
rs3094691	2e-08	LINC02571 - HLA-B	?	1.11
rs7958490	3e-08	KRR1 - RPL10P13	?	1.11
rs2844592	4e-08	LINC02571 - HLA-B	G	0.1
rs34555357	4e-08	POLD3, LIPT2-AS1	?	0.9

Top studies (by case count)

Study	Lead author	Year	Cases	Controls	Title
GCST90432135	Jiang Y	2023	116,382	213,325	A cross-disorder study to identify causal relationships, shared genetic variants, and genes across 21 digestive disorders.
GCST90080210	Backman JD	2021	6,198	381,584	Exome sequencing and analysis of 454,787 UK Biobank participants.
GCST90084196	Backman JD	2021	6,198	381,584	Exome sequencing and analysis of 454,787 UK Biobank participants.
GCST90018850	Sakaue S	2021	6,155	341,871	A cross-population atlas of genetic associations for 220 human phenotypes.
GCST90018630	Sakaue S	2021	1,337	158,249	A cross-population atlas of genetic associations for 220 human phenotypes.

Variant details and genetic-evidence tiers

Tier distribution (top 50 variants)

Tier	Variants
Tier 1: coding	0
Tier 2: splice/UTR	0
Tier 3: regulatory	0
Tier 4: intronic/intergenic	24

MAF distribution

Bucket	Variants
common (>=0.05)	22
low_freq (0.01-0.05)	0
rare (<0.01)	0
unknown	2

Functional consequences

Consequence	Count
intron_variant	18
intergenic_variant	4
non_coding_transcript_exon_variant	2

Top variants

rsID	Chr	Pos	Alleles	MAF	Consequence	Gene	p-value	Tier
rs6121558	20	62386309	T>C	0.05	non_coding_transcript_exon_variant	RPS21, RPS21-DT	7e-31	Tier 4: intronic/intergenic
rs2990223	1	155215184	G>A,T	0.05	intron_variant	GBA1LP, GBA1LP	9e-21	Tier 4: intronic/intergenic
rs111765775	15	32763966	A>AATT	0.05	intergenic_variant	GREM1 - FMN1	4e-20	Tier 4: intronic/intergenic
rs138517736	2	212397493	A>AAGG,AAGGAAGG		intron_variant	ERBB4	5e-17	Tier 4: intronic/intergenic
rs11264341	1	155179017	C>A,G,T	0.05	intron_variant	TRIM46	6e-17	Tier 4: intronic/intergenic
rs113602546	2	212317834	GA>G,GAA,GAAA	0.05	intron_variant	ERBB4	5e-16	Tier 4: intronic/intergenic
rs143117247	15	32695517	A>G		intron_variant	ARHGAP11A-SCG5, SCG5	1e-14	Tier 4: intronic/intergenic
rs16888589	8	116623363	A>G	0.05	intergenic_variant	LINC00536 - EIF3H	2e-13	Tier 4: intronic/intergenic
rs7767441	6	55849232	A>C,G	0.05	intron_variant	BMP5	3e-12	Tier 4: intronic/intergenic
rs6760554	2	212390693	C>T	0.05	intron_variant	ERBB4	7e-12	Tier 4: intronic/intergenic
rs687093	5	135122983	A>T	0.05	intron_variant	PITX1-AS1	1e-10	Tier 4: intronic/intergenic
rs11213820	11	111289766	T>C	0.05	intergenic_variant	POU2AF2 - COLCA1	3e-10	Tier 4: intronic/intergenic
rs35352860	18	48927384	C>T	0.05	intron_variant	SMAD7	4e-10	Tier 4: intronic/intergenic
rs2123067	15	32800306	A>G	0.05	intron_variant	FMN1	7e-10	Tier 4: intronic/intergenic
rs62446187	7	46846894	G>A,T	0.05	intron_variant	EPS15P1 - MRPL42P4	3e-09	Tier 4: intronic/intergenic
rs372173246	8	142678701	CACCACCACCCAGCCACTGGCAGCAGAGCTTGGGCCTGCTCTAGAGGGTCCTAGCCACTGCT>C	0.473	intergenic_variant	JRK, PSCA	4e-09	Tier 4: intronic/intergenic
rs4714707	6	43878343	T>C	0.266	intron_variant	LINC02537 - LINC01512	1e-08	Tier 4: intronic/intergenic
rs2596827	3	12504673	T>G	0.05	intron_variant	TSEN2	1e-08	Tier 4: intronic/intergenic
rs2613964	3	113141933	A>C,G,T	0.05	intron_variant	NEPRO-AS1	1e-08	Tier 4: intronic/intergenic
rs34647020	14	71329421	GTTT>G,GT,GTT,GTTTT,GTTTTT,GTTTTTT	0.05	intron_variant	SIPA1L1	1e-08	Tier 4: intronic/intergenic
rs3094691	6	31306916	G>A,C	0.05	intron_variant	LINC02571 - HLA-B	2e-08	Tier 4: intronic/intergenic
rs7958490	12	75629612	C>A,T	0.05	intron_variant	KRR1 - RPL10P13	3e-08	Tier 4: intronic/intergenic
rs2844592	6	31301709	T>G	0.05	intron_variant	LINC02571 - HLA-B	4e-08	Tier 4: intronic/intergenic
rs34555357	11	74498474	T>C	0.05	non_coding_transcript_exon_variant	POLD3, LIPT2-AS1	4e-08	Tier 4: intronic/intergenic

ClinVar germline variants

1 retrieved; paginated sample, class counts are floors:

1 pathogenic

ClinVar	Variant (HGVS)	Gene	Classification	Review
816	NM_000038.6(APC):c.3927_3931del (p.Glu1309fs)	APC	Pathogenic	reviewed by expert panel

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 0 · Orphanet: 5 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
APC	Orphanet:220460	Attenuated familial adenomatous polyposis
APC	Orphanet:261584	5q22 microdeletion syndrome
APC	Orphanet:314022	Gastric adenocarcinoma and proximal polyposis of the stomach
APC	Orphanet:3258	Cenani-Lenz syndrome
APC	Orphanet:873	Desmoid tumor

Cohort genes → proteins

1 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
APC	HGNC:583	ENSG00000134982	P25054	Adenomatous polyposis coli protein	clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
APC	Adenomatous polyposis coli protein	Tumor suppressor.

Protein-family classification

Druggable: 0 · Difficult: 0 · Unknown: 1 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Other/Unknown	1	1.8×	0.558

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
APC	Other/Unknown	no		Armadillo, APC_rpt, SAMP

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	1
unknown	0

Top tissues across cohort

Tissue	Cohort genes
medial globus pallidus	1
substantia nigra pars compacta	1
substantia nigra pars reticulata	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
APC	297	ubiquitous	marker	substantia nigra pars compacta, substantia nigra pars reticulata, medial globus pallidus

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
APC	2,903

Structural data

PDB: 1 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
APC	P25054	31

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 31. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
APC truncation mutants are not K63 polyubiquitinated	1	11420.0×	0.003	APC
Signaling by AXIN mutants	1	1038.2×	0.003	APC
Signaling by CTNNB1 phospho-site mutants	1	1038.2×	0.003	APC
Signaling by APC mutants	1	1038.2×	0.003	APC
Signaling by AMER1 mutants	1	1038.2×	0.003	APC
APC truncation mutants have impaired AXIN binding	1	815.7×	0.003	APC
AXIN missense mutants destabilize the destruction complex	1	815.7×	0.003	APC
Truncations of AMER1 destabilize the destruction complex	1	815.7×	0.003	APC
Signaling by GSK3beta mutants	1	761.3×	0.003	APC
CTNNB1 S33 mutants aren’t phosphorylated	1	761.3×	0.003	APC
CTNNB1 S37 mutants aren’t phosphorylated	1	761.3×	0.003	APC
CTNNB1 S45 mutants aren’t phosphorylated	1	761.3×	0.003	APC
CTNNB1 T41 mutants aren’t phosphorylated	1	761.3×	0.003	APC
Beta-catenin phosphorylation cascade	1	671.8×	0.003	APC
Signaling by WNT in cancer	1	601.0×	0.003	APC
Apoptotic cleavage of cellular proteins	1	475.8×	0.004	APC
Apoptotic execution phase	1	475.8×	0.004	APC
Disassembly of the destruction complex and recruitment of AXIN to the membrane	1	356.9×	0.005	APC
Ovarian tumor domain proteases	1	278.5×	0.006	APC
Deactivation of the beta-catenin transactivating complex	1	233.1×	0.007	APC
Degradation of beta-catenin by the destruction complex	1	173.0×	0.008	APC
Apoptosis	1	167.9×	0.008	APC
Programmed Cell Death	1	146.4×	0.009	APC
Deubiquitination	1	124.1×	0.010	APC
TCF dependent signaling in response to WNT	1	117.7×	0.011	APC
Signaling by WNT	1	112.0×	0.011	APC
Diseases of signal transduction by growth factor receptors and second messengers	1	56.8×	0.020	APC
Post-translational protein modification	1	19.2×	0.058	APC
Disease	1	13.1×	0.082	APC
Metabolism of proteins	1	12.4×	0.084	APC

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
regulation of microtubule-based movement	1	2808.7×	0.003	APC
negative regulation of cell cycle G1/S phase transition	1	2407.4×	0.003	APC
positive regulation of protein localization to centrosome	1	2407.4×	0.003	APC
negative regulation of cyclin-dependent protein serine/threonine kinase activity	1	2106.5×	0.003	APC
regulation of microtubule-based process	1	1872.4×	0.003	APC
regulation of attachment of spindle microtubules to kinetochore	1	1685.2×	0.003	APC
heart valve development	1	1532.0×	0.003	APC
positive regulation of pseudopodium assembly	1	1296.3×	0.003	APC
endocardial cushion morphogenesis	1	842.6×	0.004	APC
mitotic spindle assembly checkpoint signaling	1	561.7×	0.005	APC
cell fate specification	1	526.6×	0.005	APC
negative regulation of microtubule depolymerization	1	495.6×	0.005	APC
pattern specification process	1	468.1×	0.005	APC
negative regulation of G1/S transition of mitotic cell cycle	1	358.6×	0.006	APC
bicellular tight junction assembly	1	330.4×	0.006	APC
mitotic cytokinesis	1	259.3×	0.007	APC
insulin receptor signaling pathway	1	221.7×	0.008	APC
positive regulation of protein catabolic process	1	203.0×	0.008	APC
positive regulation of cold-induced thermogenesis	1	163.6×	0.010	APC
negative regulation of canonical Wnt signaling pathway	1	117.8×	0.013	APC
protein-containing complex assembly	1	113.9×	0.013	APC
Wnt signaling pathway	1	99.7×	0.014	APC
positive regulation of cell migration	1	61.7×	0.020	APC
cell migration	1	61.5×	0.020	APC
positive regulation of apoptotic process	1	56.7×	0.021	APC
DNA damage response	1	53.5×	0.021	APC
proteasome-mediated ubiquitin-dependent protein catabolic process	1	52.2×	0.021	APC
nervous system development	1	45.9×	0.023	APC
negative regulation of cell population proliferation	1	42.1×	0.025	APC
cell adhesion	1	37.5×	0.027	APC

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1

Druggability breadth: 1 of 1 evidence-associated genes (100%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
APC	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
APC	24	Binding:24

Pharmacogenomics

Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	1	APC

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
APC	24	—

Clinical trials & evidence

Clinical trials

Clinical trials: 9.

Phase distribution (across all retrieved trials)

Phase	Trials
Not specified	7
PHASE4	2

Top trials by phase / activity

NCT	Phase	Status	Title
NCT03065868	PHASE4	COMPLETED	Effect of H. Pylori Eradication on the Fate of H. Pylori-associated Gastric Polyp
NCT05688020	PHASE4	UNKNOWN	Tranexamic Acid During Upper GI Endoscopic Resection Procedures
NCT06081647	Not specified	RECRUITING	The Efficacy and Safety of the COMBO Endoscopy Oropharyngeal Airway in Gastrointestinal Endoscopy Procedure
NCT07314554	Not specified	NOT_YET_RECRUITING	Recurrence After Gastric and Intestinal Polyp Resection
NCT01946633	Not specified	UNKNOWN	Remote-controlled Capsule Endoscopy: a Feasibility Study
NCT03065257	Not specified	UNKNOWN	Endoscopic Resection Multicenter Registry
NCT04843397	Not specified	UNKNOWN	Diagnostic Performance Indicators in Upper GI Endoscopy:PROSPERO Study
NCT05030870	Not specified	COMPLETED	Capnographic Monitoring in Gastrointestinal Endoscopy for Elderly Patients
NCT05405530	Not specified	COMPLETED	Nasal Mask Kit in Gastrointestinal Endoscopy

Drugs tested across these trials (top 30)

Molecule	Max phase	Trials referencing
EPINEPHRINE	4	1
RACEPINEPHRINE	2	1