Stroke disorder
diseaseOn this page
Also known as cerebrovascular accidentcerebrovascular accident, (CVA)CVACVA, cerebrovascular accidentstrokestroke syndromesyndrome, strokeundetermined stroke
Summary
Stroke disorder (MONDO:0005098) is a disease with 75 cohort genes (327 GWAS associations across 133 studies) and 5,951 clinical trials. Top therapeutic interventions include aspirin, alteplase, and tenecteplase.
At a glance
- Cohort genes: 75
- GWAS associations: 327
- ClinVar variants: 9
- Clinical trials: 5,951
Clinical features
No curated clinical features (Orphanet) for this disease.
Identifiers
Disease identifiers
| Field | Value |
|---|---|
| Canonical name | stroke disorder |
| Mondo ID | MONDO:0005098 |
| EFO | EFO:0000712 |
| MeSH | D020521 |
| DOID | DOID:0051061 |
| NCIT | C3390 |
| SNOMED CT | 230690007 |
| UMLS | C0038454 |
| MedGen | 52522 |
| Anatomy (UBERON) | UBERON:0003499 |
| Is cancer (heuristic) | no |
Also known as: cerebrovascular accident · cerebrovascular accident, (CVA) · CVA · CVA, cerebrovascular accident · stroke · stroke syndrome · syndrome, stroke · undetermined stroke
Data availability: 9 ClinVar variants · 327 GWAS associations (133 studies) · 1 HPO phenotype · 3 cell lines.
Disease family
An umbrella term covering 4 Mondo subtypes.
Classification path: disease › human disease › disease by body system or component › nervous system disorder › central nervous system disorder › brain disorder › cerebrovascular disorder › stroke disorder
Related subtypes (23): cerebral arteritis, intracranial thrombosis, occlusion precerebral artery, vascular dementia, internal carotid artery stenosis, carotid artery disorder, brain ischemia, brain infarction, cerebral amyloid angiopathy, vascular brain injury, basal ganglia cerebrovascular disorder, intracranial arterial disease, intracranial vasospasm, subclavian steal syndrome, pseudotumor cerebri, cerebral sinovenous thrombosis, HTRA1-related autosomal dominant cerebral small vessel disease, familial porencephaly, microangiopathy and leukoencephalopathy, pontine, autosomal dominant, cathepsin a-related arteriopathy-strokes-leukoencephalopathy, precerebral artery stenosis, cerebral artery stenosis, APP-related brain and vascular amyloidosis
Subtypes (4): large artery stroke, spinal cord ischemia, ischemic stroke, hemorrhagic stroke
Genetics & variants
GWAS landscape
327 GWAS associations across 133 studies. Top hits map to 30 distinct genes (as reported by GWAS).
Top associations by p-value
| rsID | p-value | Gene | Risk allele | Odds ratio |
|---|---|---|---|---|
| rs56266464 | 1e-300 | ABCG5 | ? | |
| rs247617 | 1e-149 | HERPUD1 - CETP | ? | |
| rs6025 | 4e-137 | F5 | T | 2.93 |
| rs964184 | 2e-108 | ZPR1 | ? | |
| rs780094 | 4e-91 | GCKR | ? | |
| rs8082812 | 5e-67 | THEMIS3P - AKR1B1P6 | ? | |
| rs529565 | 7e-63 | ABO | C | 1.38 |
| rs1333049 | 1e-56 | CDKN2B-AS1 | ? | |
| rs629301 | 1e-49 | CELSR2 | ? | |
| rs765547 | 2e-44 | LPL - RPL30P9 | ? | |
| rs34872471 | 3e-40 | TCF7L2 | C | 0.17 |
| rs261332 | 2e-35 | ALDH1A2, LIPC-AS1, LIPC | ? | |
| rs1728918 | 1e-31 | PPM1G - NRBP1 | ? | |
| rs4444878 | 7e-28 | F11-AS1 | A | 1.23 |
| rs142827301 | 1e-27 | TCF7L2 | CTTCTTTCTTTCT | 0.16 |
| rs4007642 | 3e-27 | CDKN2B-AS1 | T | 0.13 |
| rs174547 | 7e-25 | FADS1, FADS2 | ? | |
| rs1799963 | 1e-24 | F2 | A | 1.95 |
| rs4420638 | 1e-22 | APOC1 | ? | |
| rs7632505 | 8e-22 | SEMA5B | ? | |
| rs562338 | 5e-21 | APOB - TDRD15 | ? | |
| rs7028268 | 3e-20 | CDKN2B-AS1 | A | 0.12 |
| rs7654093 | 2e-19 | FGG - LRAT | T | 1.22 |
| rs55730499 | 4e-19 | LPA | T | 0.19 |
| rs1333047 | 7e-19 | CDKN2B-AS1 | T | 0.06 |
| rs2980853 | 3e-18 | TRIB1 - TRIB1AL | ? | |
| rs671 | 5e-18 | ALDH2 | A | 0.11 |
| rs75325732 | 9e-18 | WDR70P1 - TM4SF4 | ? | |
| rs2074755 | 1e-17 | BAZ1B | ? | |
| rs34713115 | 1e-17 | CDKN2B-AS1 | CTT | 0.11 |
Top studies (by case count)
| Study | Lead author | Year | Cases | Controls | Title |
|---|---|---|---|---|---|
| GCST90042671 | Jiang L | 2021 | 61,995 | 335,148 | A generalized linear mixed model association tool for biobank-scale data. |
| GCST90078258 | Backman JD | 2021 | 60,161 | 359,437 | Exome sequencing and analysis of 454,787 UK Biobank participants. |
| GCST90042683 | Jiang L | 2021 | 60,152 | 358,865 | A generalized linear mixed model association tool for biobank-scale data. |
| GCST90078273 | Backman JD | 2021 | 58,930 | 364,757 | Exome sequencing and analysis of 454,787 UK Biobank participants. |
| GCST007248 | Malik R | 2018 | 45,570 | 775,530 | Genome-Wide Meta-analysis identifies three novel loci associated with stroke. |
| GCST009639 | Wang L | 2019 | 40,585 | 406,111 | Additional common loci associated with stroke and obesity identified using pleiotropic analytical approach. |
| GCST005838 | Malik R | 2018 | 40,585 | 406,111 | Multiancestry genome-wide association study of 520,000 subjects identifies 32 loci associated with stroke and stroke subtypes. |
| GCST006906 | Malik R | 2018 | 40,585 | 406,111 | Multiancestry genome-wide association study of 520,000 subjects identifies 32 loci associated with stroke and stroke subtypes. |
| GCST90081457 | Backman JD | 2021 | 18,075 | 272,229 | Exome sequencing and analysis of 454,787 UK Biobank participants. |
| GCST007613 | Zhu Z | 2019 | 12,550 | 46,368 | Genetic overlap of chronic obstructive pulmonary disease and cardiovascular disease-related traits: a large-scale genome-wide cross-trait analysis. |
Variant details and genetic-evidence tiers
Tier distribution (top 50 variants)
| Tier | Variants |
|---|---|
| Tier 1: coding | 3 |
| Tier 2: splice/UTR | 3 |
| Tier 3: regulatory | 2 |
| Tier 4: intronic/intergenic | 42 |
MAF distribution
| Bucket | Variants |
|---|---|
| common (>=0.05) | 47 |
| low_freq (0.01-0.05) | 2 |
| rare (<0.01) | 1 |
| unknown | 0 |
Functional consequences
| Consequence | Count |
|---|---|
| intron_variant | 30 |
| intergenic_variant | 10 |
| missense_variant | 3 |
| 3_prime_UTR_variant | 3 |
| non_coding_transcript_exon_variant | 2 |
| regulatory_region_variant | 2 |
Top variants
| rsID | Chr | Pos | Alleles | MAF | Consequence | Gene | p-value | Tier |
|---|---|---|---|---|---|---|---|---|
| rs56266464 | 2 | 43827852 | G>A,C | 0.05 | intron_variant | ABCG5 | 1e-300 | Tier 4: intronic/intergenic |
| rs247617 | 16 | 56956804 | C>A | 0.05 | intergenic_variant | HERPUD1 - CETP | 1e-149 | Tier 4: intronic/intergenic |
| rs6025 | 1 | 169549811 | C>A,G,T | 0.025 | missense_variant | F5 | 4e-137 | Tier 1: coding |
| rs964184 | 11 | 116778201 | G>C | 0.05 | 3_prime_UTR_variant | ZPR1 | 2e-108 | Tier 2: splice/UTR |
| rs780094 | 2 | 27518370 | T>A,C,G | 0.05 | intron_variant | GCKR | 4e-91 | Tier 4: intronic/intergenic |
| rs8082812 | 18 | 8522684 | C>A | 0.05 | intergenic_variant | THEMIS3P - AKR1B1P6 | 5e-67 | Tier 4: intronic/intergenic |
| rs529565 | 9 | 133274084 | C>A,G,T | 0.341 | intron_variant | ABO | 7e-63 | Tier 4: intronic/intergenic |
| rs1333049 | 9 | 22125504 | G>A,C | 0.05 | intergenic_variant | CDKN2B-AS1 | 1e-56 | Tier 4: intronic/intergenic |
| rs629301 | 1 | 109275684 | G>A,C,T | 0.05 | 3_prime_UTR_variant | CELSR2 | 1e-49 | Tier 2: splice/UTR |
| rs765547 | 8 | 20008763 | G>A,C,T | 0.05 | intergenic_variant | LPL - RPL30P9 | 2e-44 | Tier 4: intronic/intergenic |
| rs34872471 | 10 | 112994312 | T>C | 0.291 | intron_variant | TCF7L2 | 3e-40 | Tier 4: intronic/intergenic |
| rs261332 | 15 | 58435126 | A>G | 0.05 | non_coding_transcript_exon_variant | ALDH1A2, LIPC-AS1, LIPC | 2e-35 | Tier 4: intronic/intergenic |
| rs1728918 | 2 | 27412596 | A>C,G,T | 0.05 | intron_variant | PPM1G - NRBP1 | 1e-31 | Tier 4: intronic/intergenic |
| rs4444878 | 4 | 186292729 | C>A,G,T | 0.401 | intron_variant | F11-AS1 | 7e-28 | Tier 4: intronic/intergenic |
| rs142827301 | 10 | 113036666 | 0.207 | intron_variant | TCF7L2 | 1e-27 | Tier 4: intronic/intergenic | |
| rs4007642 | 9 | 22093300 | A>C,T | 0.484 | intron_variant | CDKN2B-AS1 | 3e-27 | Tier 4: intronic/intergenic |
| rs174547 | 11 | 61803311 | T>C | 0.05 | intron_variant | FADS1, FADS2 | 7e-25 | Tier 4: intronic/intergenic |
| rs1799963 | 11 | 46739505 | G>A | 0.015 | 3_prime_UTR_variant | F2 | 1e-24 | Tier 2: splice/UTR |
| rs4420638 | 19 | 44919689 | A>G | 0.05 | intergenic_variant | APOC1 | 1e-22 | Tier 4: intronic/intergenic |
| rs7632505 | 3 | 123019460 | A>G | 0.05 | intron_variant | SEMA5B | 8e-22 | Tier 4: intronic/intergenic |
| rs562338 | 2 | 21065449 | A>C,G,T | 0.05 | intron_variant | APOB - TDRD15 | 5e-21 | Tier 4: intronic/intergenic |
| rs7028268 | 9 | 22048415 | G>A,C | 0.371 | intron_variant | CDKN2B-AS1 | 3e-20 | Tier 4: intronic/intergenic |
| rs7654093 | 4 | 154623920 | A>T | 0.232 | intergenic_variant | FGG - LRAT | 2e-19 | Tier 4: intronic/intergenic |
| rs55730499 | 6 | 160584578 | C>T | 0.082 | intron_variant | LPA | 4e-19 | Tier 4: intronic/intergenic |
| rs1333047 | 9 | 22124505 | A>C,G,T | 0.481 | intergenic_variant | CDKN2B-AS1 | 7e-19 | Tier 4: intronic/intergenic |
| rs2980853 | 8 | 125466108 | A>C | 0.05 | intergenic_variant | TRIB1 - TRIB1AL | 3e-18 | Tier 4: intronic/intergenic |
| rs671 | 12 | 111803962 | G>A | 0.238 | missense_variant | ALDH2 | 5e-18 | Tier 1: coding |
| rs75325732 | 3 | 149472926 | A>G | 0.05 | regulatory_region_variant | WDR70P1 - TM4SF4 | 9e-18 | Tier 3: regulatory |
| rs2074755 | 7 | 73462836 | T>A,C,G | 0.05 | intron_variant | BAZ1B | 1e-17 | Tier 4: intronic/intergenic |
| rs34713115 | 9 | 22049484 | C>CTT,CTTTCTGCACACTGCATAAAGAGTCCTAAAAGACTCTT | 0.431 | intron_variant | CDKN2B-AS1 | 1e-17 | Tier 4: intronic/intergenic |
ClinVar germline variants
9 retrieved; paginated sample, class counts are floors:
4 pathogenic, 2 likely pathogenic, 2 uncertain significance, 1 likely benign
| ClinVar | Variant (HGVS) | Gene | Classification | Review |
|---|---|---|---|---|
| 9589 | NC_012920.1(MT-TL1):m.3243A>G | MT-TL1 | Pathogenic | reviewed by expert panel |
| 585600 | NM_000435.3(NOTCH3):c.227G>A (p.Cys76Tyr) | NOTCH3 | Pathogenic | criteria provided, single submitter |
| 9219 | NM_000435.3(NOTCH3):c.505C>T (p.Arg169Cys) | NOTCH3 | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 13653 | NM_006218.4(PIK3CA):c.3140A>T (p.His1047Leu) | PIK3CA | Pathogenic | criteria provided, multiple submitters, no conflicts |
| 812744 | NM_000435.3(NOTCH3):c.1136G>C (p.Cys379Ser) | NOTCH3 | Likely pathogenic | criteria provided, single submitter |
| 1804036 | NM_001256071.3(RNF213):c.114C>G (p.Asn38Lys) | RNF213 | Likely pathogenic | criteria provided, single submitter |
| 374128 | NM_016203.4(PRKAG2):c.590C>G (p.Pro197Arg) | PRKAG2 | Uncertain significance | criteria provided, multiple submitters, no conflicts |
| 523426 | NM_001256071.3(RNF213):c.11659A>G (p.Lys3887Glu) | RNF213 | Uncertain significance | criteria provided, single submitter |
| 805948 | NC_012920.1(MT-ND4):m.12015T>C | MT-ND4 | Likely benign | criteria provided, single submitter |
Genes & proteins
Mendelian disease overlap and somatic drivers
GenCC: 0 · Orphanet: 64 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0
Orphanet rare-disease linkage (cohort genes)
| Gene | Orphanet ID | Rare disease |
|---|---|---|
| RUNX1 | Orphanet:102724 | Acute myeloid leukemia with t(8;21)(q22;q22) translocation |
| RUNX1 | Orphanet:521 | Chronic myeloid leukemia |
| RUNX1 | Orphanet:71290 | Familial platelet disorder with associated myeloid malignancy |
| RUNX1 | Orphanet:98850 | Aggressive systemic mastocytosis |
| SEMA3A | Orphanet:130 | Brugada syndrome |
| SEMA3A | Orphanet:478 | Kallmann syndrome |
| SLC7A7 | Orphanet:470 | Lysinuric protein intolerance |
| SMARCA4 | Orphanet:1465 | Coffin-Siris syndrome |
| SMARCA4 | Orphanet:231108 | Rhabdoid tumor predisposition syndrome |
| SMARCA4 | Orphanet:370396 | Small cell carcinoma of the ovary |
| SMARCA4 | Orphanet:466962 | SMARCA4-deficient sarcoma of thorax |
| SPARC | Orphanet:216820 | Osteogenesis imperfecta type 4 |
| SPI1 | Orphanet:33110 | Autosomal non-syndromic agammaglobulinemia |
| SPINK2 | Orphanet:399805 | Male infertility with azoospermia or oligozoospermia due to single gene mutation |
| HNF1A | Orphanet:319303 | Chromophobe renal cell carcinoma |
| HNF1A | Orphanet:324575 | Hyperinsulinism due to HNF1A deficiency |
| HNF1A | Orphanet:404511 | Clear cell papillary renal cell carcinoma |
| HNF1A | Orphanet:552 | MODY |
| TGFBI | Orphanet:98956 | Epithelial basement membrane dystrophy |
| TGFBI | Orphanet:98960 | Thiel-Behnke corneal dystrophy |
| TGFBI | Orphanet:98961 | Reis-Bücklers corneal dystrophy |
| TGFBI | Orphanet:98962 | Granular corneal dystrophy type I |
| TGFBI | Orphanet:98963 | Granular corneal dystrophy type II |
| TGFBI | Orphanet:98964 | Lattice corneal dystrophy type I |
| UQCRFS1 | Orphanet:1460 | Isolated complex III deficiency |
| XK | Orphanet:59306 | McLeod neuroacanthocytosis syndrome |
| RNF213 | Orphanet:2573 | Moyamoya disease |
| WNK1 | Orphanet:88940 | Pseudohypoaldosteronism type 2C |
| WNK1 | Orphanet:970 | Hereditary sensory and autonomic neuropathy type 2 |
| NIN | Orphanet:319675 | Microcephalic primordial dwarfism, Dauber type |
| NIN | Orphanet:808 | Seckel syndrome |
| IL36RN | Orphanet:163927 | Pustulosis palmaris et plantaris |
| IL36RN | Orphanet:163931 | Acrodermatitis continua of Hallopeau |
| IL36RN | Orphanet:247353 | Generalized pustular psoriasis |
| IL36RN | Orphanet:404546 | DITRA |
| SFXN4 | Orphanet:391348 | Growth and developmental delay-hypotonia-vision impairment-lactic acidosis syndrome |
| PARK7 | Orphanet:2828 | Young-onset Parkinson disease |
| PARK7 | Orphanet:90020 | Parkinson-dementia complex of Guam |
| CPAP | Orphanet:2512 | Autosomal recessive primary microcephaly |
| CPAP | Orphanet:808 | Seckel syndrome |
| CHD3 | Orphanet:599082 | CHD3-related developmental delay-speech delay-intellectual disability-abnormalities of vision-facial dysmorphism syndrome |
| SLC39A13 | Orphanet:157965 | SLC39A13-related spondylodysplastic Ehlers-Danlos syndrome |
| PHACTR1 | Orphanet:697160 | Infantile epileptic spasms syndrome |
| ADAMTS2 | Orphanet:1901 | Dermatosparaxis Ehlers-Danlos syndrome |
| COL4A1 | Orphanet:36383 | COL4A1/2-related familial vascular leukoencephalopathy |
| COL4A1 | Orphanet:477749 | Pontine autosomal dominant microangiopathy with leukoencephalopathy |
| COL4A1 | Orphanet:481986 | Familial schizencephaly |
| COL4A1 | Orphanet:73229 | HANAC syndrome |
| COL4A1 | Orphanet:75326 | Familial isolated retinal arteriolar tortuosity |
| COL4A1 | Orphanet:899 | Walker-Warburg syndrome |
Cohort genes → proteins
75 cohort genes, 74 distinct canonical proteins.
Evidence partition
| Subset | Genes |
|---|---|
| gwas_only | 74 |
| multi_evidence | 1 |
Cohort genes (full)
| Symbol | HGNC | Ensembl | UniProt | Name | Evidence |
|---|---|---|---|---|---|
| RUNX1 | HGNC:10471 | ENSG00000159216 | Q01196 | Runt-related transcription factor 1 | gwas |
| SEMA3A | HGNC:10723 | ENSG00000075213 | Q14563 | Semaphorin-3A | gwas |
| SLC22A3 | HGNC:10967 | ENSG00000146477 | O75751 | Solute carrier family 22 member 3 | gwas |
| SLC7A7 | HGNC:11065 | ENSG00000155465 | Q9UM01 | Y+L amino acid transporter 1 | gwas |
| SMARCA4 | HGNC:11100 | ENSG00000127616 | P51532 | SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 4 | gwas |
| SORT1 | HGNC:11186 | ENSG00000134243 | Q99523 | Sortilin | gwas |
| SPARC | HGNC:11219 | ENSG00000113140 | P09486 | SPARC | gwas |
| SPI1 | HGNC:11241 | ENSG00000066336 | P17947 | Transcription factor PU.1 | gwas |
| SPINK2 | HGNC:11245 | ENSG00000128040 | P20155 | Serine protease inhibitor Kazal-type 2 | gwas |
| SUPT3H | HGNC:11466 | ENSG00000196284 | O75486 | Transcription initiation protein SPT3 homolog | gwas |
| HNF1A | HGNC:11621 | ENSG00000135100 | P20823 | Hepatocyte nuclear factor 1-alpha | gwas |
| TCF21 | HGNC:11632 | ENSG00000118526 | O43680 | Transcription factor 21 | gwas |
| TGFBI | HGNC:11771 | ENSG00000120708 | Q15582 | Transforming growth factor-beta-induced protein ig-h3 | gwas |
| UQCRFS1 | HGNC:12587 | ENSG00000169021 | P47985 | Cytochrome b-c1 complex subunit Rieske, mitochondrial | gwas |
| UVRAG | HGNC:12640 | ENSG00000198382 | Q9P2Y5 | UV radiation resistance-associated gene protein | gwas |
| XK | HGNC:12811 | ENSG00000047597 | P51811 | Endoplasmic reticulum membrane adapter protein XK | gwas |
| ZBTB14 | HGNC:12860 | ENSG00000198081 | O43829 | Zinc finger and BTB domain-containing protein 14 | gwas |
| ZNF160 | HGNC:12948 | ENSG00000170949 | Q9HCG1 | Zinc finger protein 160 | gwas |
| HDAC9 | HGNC:14065 | ENSG00000048052 | Q9UKV0 | Histone deacetylase 9 | gwas |
| WDR12 | HGNC:14098 | ENSG00000138442 | Q9GZL7 | Ribosome biogenesis protein WDR12 | gwas |
| ICA1L | HGNC:14442 | ENSG00000163596 | Q8NDH6 | Islet cell autoantigen 1-like protein | gwas |
| RNF213 | HGNC:14539 | ENSG00000173821 | Q63HN8 | E3 ubiquitin-protein ligase RNF213 | clinvar |
| WNK1 | HGNC:14540 | ENSG00000060237 | Q9H4A3 | Serine/threonine-protein kinase WNK1 | gwas |
| LRP10 | HGNC:14553 | ENSG00000197324 | Q7Z4F1 | Low-density lipoprotein receptor-related protein 10 | gwas |
| ADAMTS12 | HGNC:14605 | ENSG00000151388 | P58397 | A disintegrin and metalloproteinase with thrombospondin motifs 12 | gwas |
| NIN | HGNC:14906 | ENSG00000100503 | Q8N4C6 | Ninein | gwas |
| WFDC1 | HGNC:15466 | ENSG00000103175 | Q9HC57 | WAP four-disulfide core domain protein 1 | gwas |
| ALDH1A2 | HGNC:15472 | ENSG00000128918 | O94788 | Retinal dehydrogenase 2 | gwas |
| IL1F10 | HGNC:15552 | ENSG00000136697 | Q8WWZ1 | Interleukin-1 family member 10 | gwas |
| IL36RN | HGNC:15561 | ENSG00000136695 | Q9UBH0 | Interleukin-36 receptor antagonist protein | gwas |
| ULK4 | HGNC:15784 | ENSG00000168038 | Q96C45 | Serine/threonine-protein kinase ULK4 | gwas |
| RASD1 | HGNC:15828 | ENSG00000108551 | Q9Y272 | Dexamethasone-induced Ras-related protein 1 | gwas |
| ABCC13 | HGNC:16022 | ENSG00000243064 | ATP binding cassette subfamily C member 13 (pseudogene) | gwas | |
| SFXN4 | HGNC:16088 | ENSG00000183605 | Q6P4A7 | Sideroflexin-4 | gwas |
| PARK7 | HGNC:16369 | ENSG00000116288 | Q99497 | Parkinson disease protein 7 | gwas |
| DAPP1 | HGNC:16500 | ENSG00000070190 | Q9UN19 | Dual adapter for phosphotyrosine and 3-phosphotyrosine and 3-phosphoinositide | gwas |
| MRPL52 | HGNC:16655 | ENSG00000172590 | Q86TS9 | Large ribosomal subunit protein mL52 | gwas |
| CPAP | HGNC:17272 | ENSG00000151849 | Q9HC77 | Centrosomal P4.1-associated protein | gwas |
| TRIM29 | HGNC:17274 | ENSG00000137699 | Q14134 | Tripartite motif-containing protein 29 | gwas |
| SLC44A2 | HGNC:17292 | ENSG00000129353 | Q8IWA5 | Choline transporter-like protein 2 | gwas |
| CDC5L | HGNC:1743 | ENSG00000096401 | Q99459 | Cell division cycle 5-like protein | gwas |
| TSPAN5 | HGNC:17753 | ENSG00000168785 | P62079 | Tetraspanin-5 | gwas |
| ERRFI1 | HGNC:18185 | ENSG00000116285 | Q9UJM3 | ERBB receptor feedback inhibitor 1 | gwas |
| BTBD7 | HGNC:18269 | ENSG00000011114 | Q9P203 | BTB/POZ domain-containing protein 7 | gwas |
| KCNG3 | HGNC:18306 | ENSG00000171126 | Q8TAE7 | Voltage-gated potassium channel regulatory subunit KCNG3 | gwas |
| GTSCR1 | HGNC:18406 | ENSG00000263417 | Q86UQ5 | Gilles de la Tourette syndrome chromosomal region candidate gene 1 protein | gwas |
| CHD3 | HGNC:1918 | ENSG00000170004 | Q12873 | ATP-dependent chromatin remodeler CHD3 | gwas |
| RBM23 | HGNC:20155 | ENSG00000100461 | Q86U06 | Probable RNA-binding protein 23 | gwas |
| REM2 | HGNC:20248 | ENSG00000139890 | Q8IYK8 | GTP-binding protein REM 2 | gwas |
| CLDN17 | HGNC:2038 | ENSG00000156282 | P56750 | Claudin-17 | gwas |
Cohort function summary
Lead sentence per gene, UniProt-curated.
| Symbol | Protein name | Function (lead sentence) |
|---|---|---|
| RUNX1 | Runt-related transcription factor 1 | Forms the heterodimeric complex core-binding factor (CBF) with CBFB. |
| SEMA3A | Semaphorin-3A | Involved in the development of the olfactory system and in neuronal control of puberty. |
| SLC22A3 | Solute carrier family 22 member 3 | Electrogenic voltage-dependent transporter that mediates the transport of a variety of organic cations such as endogenous bioactive amines, cationic drugs and xenobiotics. |
| SLC7A7 | Y+L amino acid transporter 1 | Heterodimer with SLC3A2, that functions as an antiporter which operates as an efflux route by exporting cationic amino acids from inside the cells in exchange with neutral amino acids plus sodium ions and may participate in nitric oxide sy… |
| SMARCA4 | SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 4 | ATPase involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). |
| SORT1 | Sortilin | Functions as a sorting receptor in the Golgi compartment and as a clearance receptor on the cell surface. |
| SPARC | SPARC | Appears to regulate cell growth through interactions with the extracellular matrix and cytokines. |
| SPI1 | Transcription factor PU.1 | Pioneer transcription factor, which controls hematopoietic cell fate by decompacting stem cell heterochromatin and allowing other transcription factors to enter otherwise inaccessible genomic sites. |
| SPINK2 | Serine protease inhibitor Kazal-type 2 | As a strong inhibitor of acrosin, it is required for normal spermiogenesis. |
| SUPT3H | Transcription initiation protein SPT3 homolog | Probable transcriptional activator. |
| HNF1A | Hepatocyte nuclear factor 1-alpha | Transcriptional activator that regulates the tissue specific expression of multiple genes, especially in pancreatic islet cells and in liver. |
| TCF21 | Transcription factor 21 | Involved in epithelial-mesenchymal interactions in kidney and lung morphogenesis that include epithelial differentiation and branching morphogenesis. |
| TGFBI | Transforming growth factor-beta-induced protein ig-h3 | Plays a role in cell adhesion. |
| UQCRFS1 | Cytochrome b-c1 complex subunit Rieske, mitochondrial | Component of the ubiquinol-cytochrome c oxidoreductase, a multisubunit transmembrane complex that is part of the mitochondrial electron transport chain which drives oxidative phosphorylation. |
| UVRAG | UV radiation resistance-associated gene protein | Versatile protein that is involved in regulation of different cellular pathways implicated in membrane trafficking. |
| XK | Endoplasmic reticulum membrane adapter protein XK | Recruits the lipid transfer protein VPS13A from lipid droplets to the endoplasmic reticulum (ER) membrane. |
| ZBTB14 | Zinc finger and BTB domain-containing protein 14 | Transcriptional activator of the dopamine transporter (DAT), binding its promoter at the consensus sequence 5’-CCTGCACAGTTCACGGA-3'. |
| ZNF160 | Zinc finger protein 160 | May be involved in transcriptional regulation. |
| HDAC9 | Histone deacetylase 9 | Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). |
| WDR12 | Ribosome biogenesis protein WDR12 | Component of the PeBoW complex, which is required for maturation of 28S and 5.8S ribosomal RNAs and formation of the 60S ribosome. |
| RNF213 | E3 ubiquitin-protein ligase RNF213 | Atypical E3 ubiquitin ligase that can catalyze ubiquitination of both proteins and lipids, and which is involved in various processes, such as lipid metabolism, angiogenesis and cell-autonomous immunity. |
| WNK1 | Serine/threonine-protein kinase WNK1 | Serine/threonine-protein kinase component of the WNK1-SPAK/OSR1 kinase cascade, which acts as a key regulator of blood pressure and regulatory volume increase by promoting ion influx. |
| LRP10 | Low-density lipoprotein receptor-related protein 10 | Probable receptor, which is involved in the internalization of lipophilic molecules and/or signal transduction. |
| ADAMTS12 | A disintegrin and metalloproteinase with thrombospondin motifs 12 | Metalloprotease that may play a role in the degradation of COMP. |
| NIN | Ninein | Centrosomal protein required in the positioning and anchorage of the microtubule minus-end in epithelial cells. |
| WFDC1 | WAP four-disulfide core domain protein 1 | Has growth inhibitory activity. |
| ALDH1A2 | Retinal dehydrogenase 2 | Catalyzes the NAD-dependent oxidation of aldehyde substrates, such as all-trans-retinal and all-trans-13,14-dihydroretinal, to their corresponding carboxylic acids, all-trans-retinoate and all-trans-13,14-dihydroretinoate, respectively. |
| IL1F10 | Interleukin-1 family member 10 | Cytokine with immunomodulatory activity. |
| IL36RN | Interleukin-36 receptor antagonist protein | Inhibits the activity of interleukin-36 (IL36A,IL36B and IL36G) by binding to receptor IL1RL2 and preventing its association with the coreceptor IL1RAP for signaling. |
| ULK4 | Serine/threonine-protein kinase ULK4 | May be involved in the remodeling of cytoskeletal components, such as alpha-tubulin, and in this way regulates neurite branching and elongation, as well as cell motility. |
| RASD1 | Dexamethasone-induced Ras-related protein 1 | Small GTPase. |
| SFXN4 | Sideroflexin-4 | Mitochondrial amino-acid transporter. |
| PARK7 | Parkinson disease protein 7 | Multifunctional protein with controversial molecular function which plays an important role in cell protection against oxidative stress and cell death acting as oxidative stress sensor and redox-sensitive chaperone and protease. |
| DAPP1 | Dual adapter for phosphotyrosine and 3-phosphotyrosine and 3-phosphoinositide | May act as a B-cell-associated adapter that regulates B-cell antigen receptor (BCR)-signaling downstream of PI3K. |
| CPAP | Centrosomal P4.1-associated protein | Plays an important role in cell division and centrosome function by participating in centriole duplication. |
| TRIM29 | Tripartite motif-containing protein 29 | Plays a crucial role in the regulation of macrophage activation in response to viral or bacterial infections within the respiratory tract. |
| SLC44A2 | Choline transporter-like protein 2 | Choline/H+ antiporter, mainly in mitochondria. |
| CDC5L | Cell division cycle 5-like protein | DNA-binding protein involved in cell cycle control. |
| TSPAN5 | Tetraspanin-5 | Part of TspanC8 subgroup, composed of 6 members that interact with the transmembrane metalloprotease ADAM10. |
| ERRFI1 | ERBB receptor feedback inhibitor 1 | Negative regulator of EGFR signaling in skin morphogenesis. |
| BTBD7 | BTB/POZ domain-containing protein 7 | Acts as a mediator of epithelial dynamics and organ branching by promoting cleft progression. |
| KCNG3 | Voltage-gated potassium channel regulatory subunit KCNG3 | Regulatory subunit of the voltage-gated potassium (Kv) channel which, when coassembled with KCNB1, modulates the kinetics parameters of the heterotetrameric channel namely the inactivation and deactivation rate. |
| CHD3 | ATP-dependent chromatin remodeler CHD3 | ATP-dependent chromatin-remodeling factor that binds and distorts nucleosomal DNA. |
| RBM23 | Probable RNA-binding protein 23 | RNA-binding protein that acts both as a transcription coactivator and pre-mRNA splicing factor. |
| REM2 | GTP-binding protein REM 2 | Binds GTP saturably and exhibits a low intrinsic rate of GTP hydrolysis. |
| CLDN17 | Claudin-17 | Channel-forming tight junction protein with selectivity for anions, including chloride and hydrogencarbonate, and for solutes smaller than 9 Angstrom in diameter. |
| ADGRL4 | Adhesion G protein-coupled receptor L4 | Endothelial orphan receptor that acts as a key regulator of angiogenesis. |
| SLC39A13 | Zinc transporter ZIP13 | Functions as a zinc transporter transporting Zn(2+) from the Golgi apparatus to the cytosol and thus influences the zinc level at least in areas of the cytosol. |
| FOXQ1 | Forkhead box protein Q1 | Plays a role in hair follicle differentiation. |
| PHACTR1 | Phosphatase and actin regulator 1 | Binds actin monomers (G actin) and plays a role in multiple processes including the regulation of actin cytoskeleton dynamics, actin stress fibers formation, cell motility and survival, formation of tubules by endothelial cells, and regula… |
Protein-family classification
Druggable: 17 · Difficult: 19 · Unknown: 39 · Druggable fraction: 0.23
Family distribution
Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.
| Family | Genes | Fold | FDR |
|---|---|---|---|
| Transcription factor | 14 | 1.5× | 0.647 |
| Protease | 4 | 1.9× | 0.745 |
| Transporter | 2 | 2.1× | 0.836 |
| Ion channel | 1 | 1.5× | 0.852 |
| Scaffold/PPI | 5 | 1.1× | 0.852 |
| Kinase | 3 | 1.1× | 0.852 |
| Other/Unknown | 39 | 0.9× | 0.960 |
| Enzyme (other) | 5 | 0.8× | 0.960 |
| Antibody/Immunoglobulin | 1 | 0.4× | 0.960 |
| GPCR | 1 | 0.3× | 0.960 |
Per-gene assignment
| Symbol | Family | Druggable? | EC | InterPro (top 3) |
|---|---|---|---|---|
| RUNX1 | Transcription factor | no | AML1_Runt, p53-like_TF_DNA-bd_sf, p53/RUNT-type_TF_DNA-bd_sf | |
| SEMA3A | Antibody/Immunoglobulin | yes | Semap_dom, Ig_sub, Ig-like_dom | |
| SLC22A3 | Transporter | yes | Orgcat_transp/SVOP, Sugar_transporter_CS, MFS | |
| SLC7A7 | Transporter | yes | AA/rel_permease1, AminoAcid_Transporter | |
| SMARCA4 | Other/Unknown | no | SNF2_N, Bromodomain, Helicase_C-like | |
| SORT1 | Scaffold/PPI | no | VPS10, WD40/YVTN_repeat-like_dom_sf, Sortilin_C | |
| SPARC | Other/Unknown | no | Osteonectin_CS, Kazal_dom, Fol_N | |
| SPI1 | Other/Unknown | no | Ets_dom, WH-like_DNA-bd_sf, WH_DNA-bd_sf | |
| SPINK2 | Other/Unknown | no | Kazal_dom, Kazal_dom_sf, SPINK2 | |
| SUPT3H | Other/Unknown | no | TFIID_TAF13, Histone-fold | |
| HNF1A | Transcription factor | no | HD, HNF1b_C, HNF1a_C | |
| TCF21 | Transcription factor | no | bHLH_dom, HLH_DNA-bd_sf, E-box_TF_Regulators | |
| TGFBI | Other/Unknown | no | FAS1_domain, EMI_domain, TGFBI/POSTN | |
| UQCRFS1 | Other/Unknown | no | Rieske_TM, Rieske_Fe-S_prot_C, Ubiquinol_cyt_c_Rdtase_Fe-S-su | |
| UVRAG | Enzyme (other) | yes | 2.7.1.137 | C2_dom, UV_resistance/autophagy_Atg14, C2_domain_sf |
| XK | Other/Unknown | no | XK-rel, XK-related_adapter | |
| ZBTB14 | Transcription factor | no | BTB/POZ_dom, SKP1/BTB/POZ_sf, Znf_C2H2_type | |
| ZNF160 | Transcription factor | no | KRAB, Znf_C2H2_type, KRAB_dom_sf | |
| HDAC9 | Enzyme (other) | yes | 3.5.1.98 | HDACs, Ureohydrolase_dom_sf, His_deacetylse_dom |
| WDR12 | Scaffold/PPI | no | WD40_rpt, NLE, WD40/YVTN_repeat-like_dom_sf | |
| ICA1L | Scaffold/PPI | no | Islet_autoAg_Ica1_C, AH_dom, Islet_autoAg_Ica1/Ica1-like | |
| RNF213 | Transcription factor | no | Znf_RING, AAA+_ATPase, Znf_RING/FYVE/PHD | |
| WNK1 | Kinase | yes | Prot_kinase_dom, Ser/Thr_kinase_AS, Kinase-like_dom_sf | |
| LRP10 | Other/Unknown | no | CUB_dom, LDrepeatLR_classA_rpt, LDLR_class-A_CS | |
| ADAMTS12 | Protease | yes | TSP1_rpt, Peptidase_M12B, Peptidase_M12B_N | |
| NIN | Other/Unknown | no | EF_hand_dom, EF-hand-dom_pair | |
| WFDC1 | Other/Unknown | no | WAP_dom, Elafin-like_sf, WFDC1 | |
| ALDH1A2 | Enzyme (other) | yes | 1.2.1.36 | Aldehyde_DH_dom, Ald_DH_CS_CYS, Ald_DH/histidinol_DH |
| IL1F10 | Other/Unknown | no | IL-1_fam, IL-1RA/IL-36, IL1/FGF | |
| IL36RN | Other/Unknown | no | IL-1_fam, IL-1RA/IL-36, IL1/FGF | |
| ULK4 | Kinase | yes | Prot_kinase_dom, Kinase-like_dom_sf, ARM-like | |
| RASD1 | Other/Unknown | no | Small_GTPase, Small_GTP-bd, P-loop_NTPase | |
| ABCC13 | Other/Unknown | no | ||
| SFXN4 | Other/Unknown | no | Mtc | |
| PARK7 | Enzyme (other) | yes | 3.5.1.124 | DJ-1/PfpI, DJ-1, Class_I_gatase-like |
| DAPP1 | Scaffold/PPI | no | SH2, PH_domain, PH-like_dom_sf | |
| MRPL52 | Other/Unknown | no | Ribosomal_mL52 | |
| CPAP | Other/Unknown | no | CENPJ_C_dom, TCP10L/CENPJ, Tcp10_C_sf | |
| TRIM29 | Transcription factor | no | Znf_B-box, E3_ubiq-ligase_TRIM/RNF, TRIM8/14/16/25/29/45/65_CC | |
| SLC44A2 | Other/Unknown | no | Choline_transptr-like | |
| CDC5L | Transcription factor | no | SANT/Myb, Homeodomain-like_sf, Myb_dom | |
| TSPAN5 | Other/Unknown | no | Tetraspanin_animals, Tetraspanin_EC2_sf, Tetraspanin/Peripherin | |
| ERRFI1 | Kinase | yes | Cdc42-bd-like, EGFR_SigReg_Kinase | |
| BTBD7 | Other/Unknown | no | BTB/POZ_dom, SKP1/BTB/POZ_sf, BACK | |
| KCNG3 | Ion channel | yes | BTB/POZ_dom, T1-type_BTB, K_chnl_volt-dep_Kv | |
| GTSCR1 | Other/Unknown | no | ||
| CHD3 | Transcription factor | no | SNF2_N, Chromo/chromo_shadow_dom, Helicase_C-like | |
| RBM23 | Other/Unknown | no | RRM_dom, RBM39_SF, Nucleotide-bd_a/b_plait_sf | |
| REM2 | Enzyme (other) | yes | 3.4.23.15 | Small_GTPase, Sigma_54_int_dom_ATP-bd_1, P-loop_NTPase |
| CLDN17 | Other/Unknown | no | PMP22/EMP/MP20/Claudin, Claudin, Claudin_CS |
Expression context
Cohort genes with no expression data: 0.
64 cohort genes are a single-cell marker in ≥1 SCXA experiment.
Breadth distribution (Bgee present_calls)
| Bucket | Genes |
|---|---|
| narrow (1-5 tissues) | 0 |
| moderate (6-20) | 0 |
| broad (>20) | 75 |
| unknown | 0 |
Top tissues across cohort
| Tissue | Cohort genes |
|---|---|
| sperm | 8 |
| cortical plate | 7 |
| secondary oocyte | 6 |
| primordial germ cell in gonad | 6 |
| stromal cell of endometrium | 5 |
| mucosa of transverse colon | 5 |
| ganglionic eminence | 4 |
| granulocyte | 4 |
| male germ line stem cell (sensu Vertebrata) in testis | 4 |
| amniotic fluid | 4 |
| adrenal tissue | 4 |
| calcaneal tendon | 4 |
| endothelial cell | 4 |
| buccal mucosa cell | 4 |
| apex of heart | 4 |
| monocyte | 3 |
| right lobe of liver | 3 |
| right lung | 3 |
| pericardium | 3 |
| corpus callosum | 3 |
Per-gene tissue summary (top 30)
| Symbol | Bgee breadth | FANTOM5 breadth | SCXA | Top tissues |
|---|---|---|---|---|
| RUNX1 | 253 | ubiquitous | marker | olfactory segment of nasal mucosa, epithelium of bronchus, mucosa of paranasal sinus |
| SEMA3A | 194 | ubiquitous | marker | stromal cell of endometrium, cortical plate, colonic epithelium |
| SLC22A3 | 189 | broad | marker | thoracic aorta, ascending aorta, descending thoracic aorta |
| SLC7A7 | 215 | ubiquitous | marker | secondary oocyte, monocyte, mononuclear cell |
| SMARCA4 | 295 | ubiquitous | marker | ganglionic eminence, cortical plate, cervix squamous epithelium |
| SORT1 | 291 | ubiquitous | marker | inferior vagus X ganglion, corpus epididymis, subthalamic nucleus |
| SPARC | 306 | ubiquitous | marker | tibia, stromal cell of endometrium, periodontal ligament |
| SPI1 | 170 | broad | marker | granulocyte, monocyte, leukocyte |
| SPINK2 | 177 | broad | marker | corpus epididymis, cauda epididymis, seminal vesicle |
| SUPT3H | 206 | ubiquitous | yes | primordial germ cell in gonad, sperm, male germ line stem cell (sensu Vertebrata) in testis |
| HNF1A | 81 | tissue_specific | yes | right lobe of liver, mucosa of transverse colon, liver |
| TCF21 | 175 | broad | marker | primordial germ cell in gonad, right lung, upper lobe of left lung |
| TGFBI | 278 | ubiquitous | marker | amniotic fluid, synovial joint, pericardium |
| UQCRFS1 | 134 | ubiquitous | marker | gastrocnemius, heart left ventricle, mucosa of transverse colon |
| UVRAG | 279 | ubiquitous | marker | adrenal tissue, corpus callosum, calcaneal tendon |
| XK | 221 | broad | marker | trabecular bone tissue, jejunal mucosa, colonic mucosa |
| ZBTB14 | 240 | ubiquitous | yes | calcaneal tendon, tendon, lymph node |
| ZNF160 | 294 | ubiquitous | marker | renal medulla, endothelial cell, pylorus |
| HDAC9 | 277 | ubiquitous | marker | oocyte, monocyte, secondary oocyte |
| WDR12 | 288 | ubiquitous | marker | ventricular zone, ganglionic eminence, cortical plate |
| ICA1L | 244 | ubiquitous | marker | bronchial epithelial cell, bronchus, Brodmann (1909) area 23 |
| RNF213 | 252 | ubiquitous | marker | granulocyte, metanephros cortex, pancreatic ductal cell |
| WNK1 | 297 | ubiquitous | marker | medial globus pallidus, globus pallidus, inferior vagus X ganglion |
| LRP10 | 284 | ubiquitous | marker | stromal cell of endometrium, decidua, right coronary artery |
| ADAMTS12 | 170 | broad | marker | adrenal tissue, male germ line stem cell (sensu Vertebrata) in testis, stromal cell of endometrium |
| NIN | 253 | ubiquitous | marker | oviduct epithelium, buccal mucosa cell, cardiac muscle of right atrium |
| WFDC1 | 241 | broad | marker | saphenous vein, right coronary artery, seminal vesicle |
| ALDH1A2 | 226 | broad | marker | germinal epithelium of ovary, decidua, sperm |
| IL1F10 | 32 | yes | skin of leg, zone of skin, skin of abdomen | |
| IL36RN | 106 | tissue_specific | yes | amniotic fluid, upper arm skin, gingiva |
Protein interactions among cohort
Intra-cohort edges: 23.
Hub genes (top 10 by interactor count)
| Symbol | Interactor count |
|---|---|
| SMARCA4 | 8,138 |
| CDC5L | 5,930 |
| PARK7 | 5,722 |
| CHD3 | 5,202 |
| RUNX1 | 4,994 |
| ALDH1A2 | 4,289 |
| UQCRFS1 | 4,001 |
| SPI1 | 3,823 |
| WDR12 | 3,702 |
| RASD1 | 3,278 |
Intra-cohort edges
| A | B | Sources |
|---|---|---|
| ADAMTS12 | ADAMTS7 | string_interaction |
| ADAMTS7 | PHACTR1 | string_interaction |
| ADAMTS7 | SORT1 | string_interaction |
| ALDH1A2 | TCF21 | string_interaction |
| COL4A1 | TGFBI | string_interaction |
| COX7A2L | UQCRFS1 | intact, string_interaction |
| CTTNBP2NL | SPINK2 | biogrid_interaction |
| HDAC9 | SMARCA4 | string_interaction |
| HDAC9 | WNK1 | intact |
| HNF1A | ZBTB14 | string_interaction |
| ICA1L | NBEAL1 | string_interaction |
| ICA1L | WDR12 | string_interaction |
| ICA1L | ZCCHC14 | string_interaction |
| MARS2 | UQCRFS1 | intact |
| MICAL2 | PHACTR1 | string_interaction |
| NBEAL1 | WDR12 | string_interaction |
| NKX2-5 | SMARCA4 | string_interaction |
| NKX2-5 | TCF21 | string_interaction |
| PHACTR1 | SORT1 | string_interaction |
| PHACTR1 | WDR12 | string_interaction |
| RUNX1 | SPI1 | biogrid_interaction, string_interaction |
| SLC44A2 | TSPAN15 | string_interaction |
| TSPAN15 | TSPAN5 | intact |
Structural data
PDB: 36 · AlphaFold-only: 38 · No structure: 1
Cohort genes with PDB structures (top 30)
| Symbol | UniProt | PDB entries |
|---|---|---|
| PARK7 | Q99497 | 88 |
| MRPL52 | Q86TS9 | 73 |
| CDC5L | Q99459 | 37 |
| SPI1 | P17947 | 35 |
| SMARCA4 | P51532 | 31 |
| SORT1 | Q99523 | 17 |
| TGFBI | Q15582 | 10 |
| ALDH1A2 | O94788 | 7 |
| ERRFI1 | Q9UJM3 | 7 |
| HNF1A | P20823 | 6 |
| CPAP | Q9HC77 | 6 |
| PHACTR1 | Q9C0D0 | 6 |
| RUNX1 | Q01196 | 5 |
| SLC7A7 | Q9UM01 | 5 |
| UQCRFS1 | P47985 | 5 |
| WNK1 | Q9H4A3 | 5 |
| MICAL2 | O94851 | 5 |
| SPARC | P09486 | 4 |
| SUPT3H | O75486 | 4 |
| RNF213 | Q63HN8 | 4 |
| COL4A1 | P02462 | 4 |
| NKX2-5 | P52952 | 4 |
| SLC22A3 | O75751 | 3 |
| UVRAG | Q9P2Y5 | 3 |
| WDR12 | Q9GZL7 | 3 |
| IL36RN | Q9UBH0 | 3 |
| TSPAN15 | O95858 | 3 |
| SPINK2 | P20155 | 2 |
| HDAC9 | Q9UKV0 | 2 |
| ULK4 | Q96C45 | 2 |
AlphaFold-only cohort genes (top 30 by pLDDT)
| Symbol | UniProt | pLDDT |
|---|---|---|
| FAR2 | Q96K12 | 94.15 |
| ADTRP | Q96IZ2 | 90.99 |
| KLHL32 | Q96NJ5 | 90.01 |
| MARS2 | Q96GW9 | 89.66 |
| TSPAN5 | P62079 | 89.48 |
| SFXN4 | Q6P4A7 | 85.33 |
| SEMA3A | Q14563 | 84.50 |
| SLC44A2 | Q8IWA5 | 83.62 |
| LPAL2 | Q16609 | 82.18 |
| XK | P51811 | 81.89 |
| RASD1 | Q9Y272 | 80.75 |
| KCNG3 | Q8TAE7 | 80.07 |
| COX7A2L | O14548 | 79.89 |
| CLDN17 | P56750 | 77.86 |
| SLC39A13 | Q96H72 | 76.33 |
| NBEAL1 | Q6ZS30 | 75.20 |
| NANOS3 | P60323 | 71.75 |
| ADAMTS2 | O95450 | 71.59 |
| RFTN2 | Q52LD8 | 69.19 |
| ZNF160 | Q9HCG1 | 68.98 |
| ICA1L | Q8NDH6 | 68.89 |
| WFDC1 | Q9HC57 | 68.08 |
| LRP10 | Q7Z4F1 | 67.84 |
| CTTNBP2NL | Q9P2B4 | 67.43 |
| TCF21 | O43680 | 66.67 |
| ADAMTS12 | P58397 | 64.56 |
| NIN | Q8N4C6 | 64.47 |
| ADAMTS7 | Q9UKP4 | 64.26 |
| CDKN2AIP | Q9NXV6 | 63.54 |
| CHD3 | Q12873 | 63.21 |
Function
Pathway analysis
Distinct Reactome pathways touched by cohort: 495. Enrichment computed across 139 evidence-associated genes (85 with Reactome annotation).
Pathways by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 85 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| Pathway | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| Defective F8 cleavage by thrombin | 2 | 89.6× | 0.067 | F2, F8 |
| Chylomicron clearance | 2 | 53.7× | 0.067 | LDLR, LIPC |
| Amplification and propagation of coagulation cascade | 3 | 22.4× | 0.067 | F2, F5, F8 |
| Regulation of clotting cascade | 4 | 11.0× | 0.067 | F2, F5, F8, PROCR |
| Initiation of coagulation cascade | 3 | 16.8× | 0.071 | F2, F5, F8 |
| Interleukin-36 pathway | 2 | 38.4× | 0.093 | IL1F10, IL36RN |
| R-HSA-140837 | 2 | 33.6× | 0.105 | F2, KNG1 |
| Defective B3GALTL causes PpS | 3 | 10.9× | 0.116 | ADAMTS12, ADAMTS2, ADAMTS7 |
| O-glycosylation of TSR domain-containing proteins | 3 | 10.6× | 0.116 | ADAMTS12, ADAMTS2, ADAMTS7 |
| Differentiation of naive CD4+ T cells to T helper 2 cells (Th2 cells) | 4 | 6.9× | 0.116 | SMARCA4, HDAC9, CHD3, GATA3 |
| Respiratory electron transport | 5 | 5.6× | 0.116 | UQCRFS1, SFXN4, COX7A2L, MT-ND4, COXFA4 |
| Platelet degranulation | 5 | 5.2× | 0.116 | SPARC, F5, F8, FGG, KNG1 |
| R-HSA-140877 | 2 | 22.4× | 0.131 | F2, KNG1 |
| Fibrin formation | 2 | 20.7× | 0.143 | F2, FGG |
| Gamma-carboxylation, transport, and amino-terminal cleavage of proteins | 1 | 134.3× | 0.160 | F2 |
| Defective factor VIII causes hemophilia A | 1 | 134.3× | 0.160 | F2 |
| Defective F8 accelerates dissociation of the A2 domain | 1 | 134.3× | 0.160 | F8 |
| Defective F8 binding to the cell membrane | 1 | 134.3× | 0.160 | F8 |
| Defective F8 secretion | 1 | 134.3× | 0.160 | F8 |
| SLC-mediated transport of organic cations | 2 | 17.9× | 0.160 | RUNX1, SLC22A3 |
| R-HSA-549132 | 2 | 17.9× | 0.160 | RUNX1, SLC22A3 |
| Plasma lipoprotein assembly, remodeling, and clearance | 3 | 8.1× | 0.160 | LDLR, LIPC, LPA |
| Diseases associated with O-glycosylation of proteins | 3 | 7.6× | 0.160 | ADAMTS12, ADAMTS2, ADAMTS7 |
| Metabolism of serotonin | 1 | 67.2× | 0.244 | ALDH2 |
| Transport of glycerol from adipocytes to the liver by Aquaporins | 1 | 67.2× | 0.244 | AQP7 |
| Defective amino acid transport by SLC7A7 causes lysinuric protein intolerance (LPI) | 1 | 67.2× | 0.244 | SLC7A7 |
| Defective F8 binding to von Willebrand factor | 1 | 67.2× | 0.244 | F8 |
| RUNX3 regulates RUNX1-mediated transcription | 1 | 44.8× | 0.244 | RUNX1 |
| R-HSA-9651496 | 1 | 44.8× | 0.244 | F2 |
| Defective factor IX causes thrombophilia | 1 | 44.8× | 0.244 | F8 |
GO biological processes by enrichment
Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 119 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.
| GO term | Cohort genes | Fold | FDR | Sample cohort genes |
|---|---|---|---|---|
| pro-T cell differentiation | 2 | 141.6× | 0.023 | SPI1, GATA3 |
| myeloid leukocyte differentiation | 2 | 94.4× | 0.023 | RUNX1, SPI1 |
| pulmonary myocardium development | 2 | 94.4× | 0.023 | NKX2-5, PITX2 |
| regulation of membrane protein ectodomain proteolysis | 2 | 94.4× | 0.023 | TSPAN5, TSPAN15 |
| negative regulation of platelet aggregation | 3 | 35.4× | 0.023 | SH2B3, UBASH3B, PRKG1 |
| negative regulation of blood coagulation | 3 | 30.4× | 0.023 | ADTRP, F2, KNG1 |
| blood coagulation | 6 | 8.8× | 0.023 | F2, F5, F8, AP3B1, KNG1, PROCR |
| ureter maturation | 2 | 70.8× | 0.041 | ALDH1A2, GATA3 |
| regulation of cardiac muscle cell proliferation | 2 | 56.6× | 0.054 | RUNX1, NKX2-5 |
| extracellular matrix organization | 6 | 6.2× | 0.054 | TGFBI, ADAMTS12, ADAMTS2, ADAMTS7, FOXF2, MMP14 |
| embryonic heart tube left/right pattern formation | 2 | 47.2× | 0.059 | NKX2-5, PITX2 |
| negative regulation of leukocyte cell-cell adhesion | 2 | 47.2× | 0.059 | WNK1, ADTRP |
| chondrocyte differentiation | 4 | 10.1× | 0.059 | RUNX1, TGFBI, ADAMTS12, ADAMTS7 |
| positive regulation of miRNA transcription | 4 | 9.8× | 0.059 | SMARCA4, SPI1, GATA3, NOTCH3 |
| type IV hypersensitivity | 1 | 141.6× | 0.080 | GATA3 |
| positive regulation of acute inflammatory response to antigenic stimulus | 1 | 141.6× | 0.080 | PARK7 |
| Purkinje myocyte differentiation | 1 | 141.6× | 0.080 | NKX2-5 |
| septum secundum development | 1 | 141.6× | 0.080 | NKX2-5 |
| determination of bilateral symmetry | 1 | 141.6× | 0.080 | ALDH1A2 |
| response to muscle inactivity | 1 | 141.6× | 0.080 | PIK3CA |
| nitroglycerin metabolic process | 1 | 141.6× | 0.080 | ALDH2 |
| subthalamic nucleus development | 1 | 141.6× | 0.080 | PITX2 |
| astral microtubule nucleation | 1 | 141.6× | 0.080 | CPAP |
| negative regulation of transporter activity | 1 | 141.6× | 0.080 | CTTNBP2NL |
| intermediate-density lipoprotein particle remodeling | 1 | 141.6× | 0.080 | LIPC |
| cellular response to glyoxal | 1 | 141.6× | 0.080 | PARK7 |
| protein kinase C deactivation | 1 | 141.6× | 0.080 | ULK4 |
| host-mediated perturbation of viral transcription | 1 | 141.6× | 0.080 | PSMC3 |
| glycolate biosynthetic process | 1 | 141.6× | 0.080 | PARK7 |
| detoxification of mercury ion | 1 | 141.6× | 0.080 | PARK7 |
Therapeutics
Drugs indicated for this disease
18 approved, 54 in late-stage (phase 3) trials. Disease-direct ChEMBL indications, not inferred from the associated-gene cohort below.
| Drug | Development status |
|---|---|
| Alteplase | Approved (phase 4) |
| Apixaban | Approved (phase 4) |
| Aspirin | Approved (phase 4) |
| Atenolol | Approved (phase 4) |
| Candesartan Cilexetil | Approved (phase 4) |
| Celecoxib | Approved (phase 4) |
| Dipyridamole | Approved (phase 4) |
| Eplerenone | Approved (phase 4) |
| Evolocumab | Approved (phase 4) |
| Nadolol | Approved (phase 4) |
| Olmesartan Medoxomil | Approved (phase 4) |
| Ramipril | Approved (phase 4) |
| Rivaroxaban | Approved (phase 4) |
| Simvastatin | Approved (phase 4) |
| Telmisartan | Approved (phase 4) |
| Ticagrelor | Approved (phase 4) |
| Torsemide | Approved (phase 4) |
| Valsartan | Approved (phase 4) |
| Abciximab | Phase 3 (in late-stage trials) |
| Citalopram | Phase 3 (in late-stage trials) |
| Citicoline | Phase 3 (in late-stage trials) |
| Clevidipine | Phase 3 (in late-stage trials) |
| Clopidogrel | Phase 3 (in late-stage trials) |
| Cromolyn | Phase 3 (in late-stage trials) |
| Dabigatran | Phase 3 (in late-stage trials) |
| Dabigatran Etexilate | Phase 3 (in late-stage trials) |
| Dalfampridine | Phase 3 (in late-stage trials) |
| Dalteparin Sodium | Phase 3 (in late-stage trials) |
| Desmoteplase | Phase 3 (in late-stage trials) |
| Dexborneol | Phase 3 (in late-stage trials) |
| Donepezil | Phase 3 (in late-stage trials) |
| Edoxaban | Phase 3 (in late-stage trials) |
| Epinephrine | Phase 3 (in late-stage trials) |
| Estrogens, Conjugated | Phase 3 (in late-stage trials) |
| Etomidate | Phase 3 (in late-stage trials) |
| Fluoxetine | Phase 3 (in late-stage trials) |
| Fospropofol | Phase 3 (in late-stage trials) |
| Heparin | Phase 3 (in late-stage trials) |
| Hydroxyurea | Phase 3 (in late-stage trials) |
| Imatinib | Phase 3 (in late-stage trials) |
| Incobotulinumtoxina | Phase 3 (in late-stage trials) |
| Inosine | Phase 3 (in late-stage trials) |
| Levodopa | Phase 3 (in late-stage trials) |
| Lidocaine | Phase 3 (in late-stage trials) |
| Lipoic Acid, Alpha | Phase 3 (in late-stage trials) |
| Lithium Carbonate | Phase 3 (in late-stage trials) |
| Magnesium Sulfate Anhydrous | Phase 3 (in late-stage trials) |
| Melatonin | Phase 3 (in late-stage trials) |
| Methylprednisolone | Phase 3 (in late-stage trials) |
| Modafinil | Phase 3 (in late-stage trials) |
| Nerinetide | Phase 3 (in late-stage trials) |
| Niacin | Phase 3 (in late-stage trials) |
| Niacinamide | Phase 3 (in late-stage trials) |
| Nitroglycerin | Phase 3 (in late-stage trials) |
| Norepinephrine | Phase 3 (in late-stage trials) |
| Onabotulinumtoxina | Phase 3 (in late-stage trials) |
| Phenylephrine | Phase 3 (in late-stage trials) |
| Plasminogen | Phase 3 (in late-stage trials) |
| Prednisolone | Phase 3 (in late-stage trials) |
| Propofol | Phase 3 (in late-stage trials) |
| Remifentanil | Phase 3 (in late-stage trials) |
| Riboflavin | Phase 3 (in late-stage trials) |
| Rosuvastatin | Phase 3 (in late-stage trials) |
| Salicylic Acid | Phase 3 (in late-stage trials) |
| Sodium Chloride | Phase 3 (in late-stage trials) |
| Sovatelitide | Phase 3 (in late-stage trials) |
| Succinic Acid | Phase 3 (in late-stage trials) |
| Suxamethonium | Phase 3 (in late-stage trials) |
| Tenecteplase | Phase 3 (in late-stage trials) |
| Urapidil | Phase 3 (in late-stage trials) |
| Urokinase | Phase 3 (in late-stage trials) |
| Warfarin | Phase 3 (in late-stage trials) |
Earlier-phase candidates (phase 2, investigational — efficacy not yet established): Acetazolamide, Acetylcysteine, Amantadine, Armodafinil, Atorvastatin, Cilostazol, Cycloserine, Dapsone, Deferiprone, Dextroamphetamine, Drotrecogin Alfa (Activated), Edaravone, Enalapril, Enoxaparin Sodium, Epoetin Alfa, Eptifibatide, Escitalopram, Exenatide, Filgrastim, Fingolimod, Ghrelin, Glyburide, Guanfacine, Hydralazine, Insulin Human, Isosorbide Mononitrate, Labetalol, Levosimendan, Mannitol, Maraviroc, Minocycline, Nebivolol, Nicardipine, Nimodipine, Nitric Oxide, Ocriplasmin, Olmesartan, Oxygen, Pioglitazone, Platelets, Primidone, Propranolol, Reteplase, Ropinirole, Rotigotine, Sodium Acetate, Tadalafil, Tirofiban.
Drug target analysis
Approved (phase 4): 4 · Phase ≥3: 5 · Phased (≥1): 7 · Undrugged: 68
Druggability breadth: 47 of 139 evidence-associated genes (34%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).
Genes with an approved drug
The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.
| Symbol | Example approved molecule |
|---|---|
| RUNX1 | APOMORPHINE HYDROCHLORIDE |
| SLC22A3 | PROGESTERONE |
| HDAC9 | CELECOXIB |
| MARS2 | CHLORAMPHENICOL |
Top cohort targets by molecule count
| Symbol | Molecules | Max phase |
|---|---|---|
| HDAC9 | 28 | 4 |
| SLC22A3 | 20 | 4 |
| RUNX1 | 2 | 4 |
| SMARCA4 | 2 | 2 |
| SORT1 | 1 | 3 |
| PARK7 | 1 | 2 |
| MARS2 | 1 | 4 |
| SEMA3A | 0 | 0 |
| SLC7A7 | 0 | 0 |
| SPARC | 0 | 0 |
Drugs targeting cohort genes (top 30)
| Molecule | Max phase | Targets in cohort |
|---|---|---|
| APOMORPHINE HYDROCHLORIDE | 4 | RUNX1 |
| PROGESTERONE | 4 | SLC22A3 |
| COLCHICINE | 4 | SLC22A3 |
| IMIPRAMINE | 4 | SLC22A3 |
| CLONIDINE | 4 | SLC22A3 |
| ESTRADIOL | 4 | SLC22A3 |
| IBRUTINIB | 4 | SLC22A3 |
| PRAZOSIN | 4 | SLC22A3 |
| NILOTINIB | 4 | SLC22A3 |
| BITHIONOL | 4 | SLC22A3 |
| ONDANSETRON | 4 | SLC22A3 |
| IRINOTECAN | 4 | SLC22A3 |
| PENTAMIDINE | 4 | SLC22A3 |
| MITOXANTRONE | 4 | SLC22A3 |
| DESIPRAMINE | 4 | SLC22A3 |
| PHENOXYBENZAMINE | 4 | SLC22A3 |
| CHLORHEXIDINE | 4 | SLC22A3 |
| FAMOTIDINE | 4 | SLC22A3 |
| IMATINIB | 4 | SLC22A3 |
| CELECOXIB | 4 | HDAC9 |
| PHENYLBUTANOIC ACID | 4 | HDAC9 |
| SODIUM PHENYLBUTYRATE | 4 | HDAC9 |
| ROMIDEPSIN | 4 | HDAC9 |
| BELINOSTAT | 4 | HDAC9 |
| PANOBINOSTAT | 4 | HDAC9 |
| VORINOSTAT | 4 | HDAC9 |
| GIVINOSTAT | 4 | HDAC9 |
| CHLORAMPHENICOL | 4 | MARS2 |
| CORTICOSTERONE | 3 | SLC22A3 |
| REMINERTANT | 3 | SORT1 |
Bioactivity and enzyme data
Enzyme cohort genes (≥1 EC): 6.
Cohort genes with ChEMBL bioactivity (full, sorted by assay count)
| Symbol | Assays | Type breakdown |
|---|---|---|
| HDAC9 | 1,625 | Binding:1612, ADMET:8, Functional:4, Toxicity:1 |
| SMARCA4 | 230 | Binding:207, ADMET:12, Functional:11 |
| WNK1 | 165 | Binding:165 |
| PARK7 | 62 | Binding:62 |
| SLC22A3 | 33 | Binding:17, Functional:11, ADMET:5 |
| ALDH1A2 | 32 | Binding:32 |
| KCNG3 | 21 | Binding:20, Toxicity:1 |
| RUNX1 | 20 | Binding:17, Functional:3 |
| SORT1 | 17 | Binding:15, ADMET:2 |
| ADAMTS7 | 6 | Binding:6 |
| WDR12 | 5 | Binding:5 |
| UVRAG | 2 | Binding:2 |
| ZBTB14 | 2 | Binding:2 |
| ADGRL4 | 2 | Binding:2 |
| HNF1A | 1 | Binding:1 |
| TGFBI | 1 | Binding:1 |
| RNF213 | 1 | Binding:1 |
| ADAMTS12 | 1 | Binding:1 |
| CDC5L | 1 | Binding:1 |
| CHD3 | 1 | Binding:1 |
| MARS2 | 1 | ADMET:1 |
Cohort enzymes (BRENDA EC)
| Symbol | EC numbers | Names |
|---|---|---|
| UVRAG | 2.7.1.137 | phosphatidylinositol 3-kinase |
| HDAC9 | 3.5.1.98 | histone deacetylase |
| ALDH1A2 | 1.2.1.36 | retinal dehydrogenase |
| PARK7 | 3.5.1.124, 4.2.1.130 | protein deglycase, D-lactate dehydratase |
| REM2 | 3.4.23.15 | renin |
| ADAMTS2 | 3.4.24.14 | procollagen N-endopeptidase |
Cohort genes with high screening signal
≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.
| Symbol | ChEMBL assays |
|---|---|
| SMARCA4 | 230 |
| HDAC9 | 1,625 |
| WNK1 | 165 |
Pharmacogenomics
Cohort genes with a PharmGKB record: 75; with CPIC/DPWG dosing guidelines: 0.
No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).
Chemical tractability of cohort targets
29 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.
| Compound | Max phase | Cohort target (bioactivity) |
|---|---|---|
| APOMORPHINE HYDROCHLORIDE | 4 | RUNX1 |
| PROGESTERONE | 4 | SLC22A3 |
| IMIPRAMINE | 4 | SLC22A3 |
| CLONIDINE | 4 | SLC22A3 |
| ESTRADIOL | 4 | SLC22A3 |
| IBRUTINIB | 4 | SLC22A3 |
| PRAZOSIN | 4 | SLC22A3 |
| NILOTINIB | 4 | SLC22A3 |
| BITHIONOL | 4 | SLC22A3 |
| ONDANSETRON | 4 | SLC22A3 |
| IRINOTECAN | 4 | SLC22A3 |
| PENTAMIDINE | 4 | SLC22A3 |
| MITOXANTRONE | 4 | SLC22A3 |
| DESIPRAMINE | 4 | SLC22A3 |
| PHENOXYBENZAMINE | 4 | SLC22A3 |
| CHLORHEXIDINE | 4 | SLC22A3 |
| FAMOTIDINE | 4 | SLC22A3 |
| IMATINIB | 4 | SLC22A3 |
| CELECOXIB | 4 | HDAC9 |
| PHENYLBUTANOIC ACID | 4 | HDAC9 |
| SODIUM PHENYLBUTYRATE | 4 | HDAC9 |
| ROMIDEPSIN | 4 | HDAC9 |
| BELINOSTAT | 4 | HDAC9 |
| PANOBINOSTAT | 4 | HDAC9 |
| VORINOSTAT | 4 | HDAC9 |
| GIVINOSTAT | 4 | HDAC9 |
| CHLORAMPHENICOL | 4 | MARS2 |
| CORTICOSTERONE | 3 | SLC22A3 |
| REMINERTANT | 3 | SORT1 |
Druggability pyramid
Cohort genes binned by druggability tier (high → low):
| Tier | Definition | Genes | Symbols |
|---|---|---|---|
| A | Approved (phase 4 drug) | 4 | RUNX1, SLC22A3, HDAC9, MARS2 |
| B | Phased (≥1) drug, not yet approved | 3 | SMARCA4, SORT1, PARK7 |
| C | Druggable family + PDB, no drug | 8 | SLC7A7, UVRAG, WNK1, ALDH1A2, ULK4, ERRFI1, REM2, ADGRL4 |
| D | Druggable family + AlphaFold only, no drug | 6 | SEMA3A, ADAMTS12, KCNG3, LPAL2, ADAMTS2, ADAMTS7 |
| E | Difficult family or no structure, no drug | 54 | SPARC, SPI1, SPINK2, SUPT3H, HNF1A, TCF21, TGFBI, UQCRFS1, XK, ZBTB14 (+44 more) |
Undrugged target profiles
68 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).
| Symbol | ChEMBL assays | Drugged partners (top 3) |
|---|---|---|
| WNK1 | 165 | — |
| SEMA3A | 0 | — |
| SLC7A7 | 0 | — |
| SPARC | 0 | — |
| SPI1 | 0 | — |
| SPINK2 | 0 | — |
| SUPT3H | 0 | — |
| HNF1A | 1 | — |
| TCF21 | 0 | — |
| TGFBI | 1 | — |
| UQCRFS1 | 0 | — |
| UVRAG | 2 | — |
| XK | 0 | — |
| ZBTB14 | 2 | — |
| ZNF160 | 0 | — |
| WDR12 | 5 | — |
| ICA1L | 0 | — |
| RNF213 | 1 | — |
| LRP10 | 0 | — |
| ADAMTS12 | 1 | — |
| NIN | 0 | — |
| WFDC1 | 0 | — |
| ALDH1A2 | 32 | — |
| IL1F10 | 0 | — |
| IL36RN | 0 | — |
| ULK4 | 0 | — |
| RASD1 | 0 | — |
| ABCC13 | 0 | — |
| SFXN4 | 0 | — |
| DAPP1 | 0 | — |
Clinical trials & evidence
Clinical trials
Clinical trials: 5,951.
Phase distribution (across all retrieved trials)
| Phase | Trials |
|---|---|
| PHASE2 | 246 |
| PHASE3 | 194 |
| Not specified | 193 |
| PHASE4 | 155 |
| PHASE1 | 130 |
| PHASE1/PHASE2 | 82 |
| EARLY_PHASE1 | 51 |
| PHASE2/PHASE3 | 49 |
Top trials by phase / activity
| NCT | Phase | Status | Title |
|---|---|---|---|
| NCT02670161 | PHASE4 | ENROLLING_BY_INVITATION | Quality Improvement and Practice Based Research in Neurology Using the EMR |
| NCT03568890 | PHASE4 | ACTIVE_NOT_RECRUITING | Short-Term Anticoagulation Versus Antiplatelet Therapy for Preventing Device Thrombosis Following Left Atrial Appendage Closure |
| NCT03862859 | PHASE4 | RECRUITING | The Danish Warfarin-Dialysis Study - Safety and Efficacy of Warfarin in Patients With Atrial Fibrillation on Dialysis |
| NCT03968393 | PHASE4 | RECRUITING | Anticoagulation for Stroke Prevention In Patients With Recent Episodes of Atrial Fibrillation Occurring Transiently With Stress |
| NCT04436978 | PHASE4 | RECRUITING | What is the Optimal Antithrombotic Strategy in Patients With Atrial Fibrillation Undergoing PCI? |
| NCT04908423 | PHASE4 | RECRUITING | Xeomin® and Gait Related Mobility After Stroke |
| NCT05169021 | PHASE4 | NOT_YET_RECRUITING | Folic Acid and Intensive Antihypertensive Therapy for Hypertension With CSVD |
| NCT05260125 | PHASE4 | RECRUITING | Comparison of the Efficacy of Ultrasound Guided vs Non-guided Suprascapular Nerve Block Treatment in Stroke Patients |
| NCT05284747 | PHASE4 | ACTIVE_NOT_RECRUITING | EVOLVE-MI: EVOLocumab Very Early After Myocardial Infarction |
| NCT06108414 | PHASE4 | RECRUITING | Low-dose Versus Standard-dose Rivaroxaban in Elderly Patients With Atrial Fibrillation |
| NCT06429332 | PHASE4 | RECRUITING | International Care Bundle Evaluation in Cerebral Hemorrhage Research |
| NCT06486792 | PHASE4 | NOT_YET_RECRUITING | Stroke Prevention In Ischemic Stroke With Covert Atrial Fibrillation |
| NCT06526117 | PHASE4 | RECRUITING | Stroke Prevention in Nigeria 2 Trial |
| NCT06543758 | PHASE4 | RECRUITING | Effectiveness and Safety of At-home Gait Rehabilitation Using Wearable Exoskeletal Robot |
| NCT06823999 | PHASE4 | NOT_YET_RECRUITING | Prevention and Treatment for Bruises in Patients With Ischemic Stroke |
| NCT06897176 | PHASE4 | RECRUITING | Effects of Cerebrolysin on Language Ability in Non-fluent Aphasia Patients After Stroke: A Randomized, Placebo-controlled, Double-blinded, Single Center Study |
| NCT06899464 | PHASE4 | NOT_YET_RECRUITING | Safety and Feasibility of Using Cerebrolysin in the Treatment of Primary Intracerebral Hemorrhage - a Prospective Randomized Open Blinded End-point Trial |
| NCT06921616 | PHASE4 | NOT_YET_RECRUITING | Neuroendoscopic Hematoma Evacuation Combined With Methylprednisolone Sodium Succinate in the Treatment of Lobar Intracerebral Hemorrhage at the Early Stage. |
| NCT06924983 | PHASE4 | NOT_YET_RECRUITING | Neuroendoscopic Hematoma Evacuation Combined With Methylprednisolone Sodium Succinate in the Treatment of Basal Ganglia Intracerebral Hemorrhage at the Early Stage |
| NCT07095790 | PHASE4 | RECRUITING | Tirofiban With Sequential Dual Antiplatelet Therapy in Mild Stroke |
| NCT07111559 | PHASE4 | RECRUITING | Lacunar Stroke hyperAcute Clinical Utilization of Novel Approach Regimens: Rt-PA vs. DAPT Randomised Clinical Trial |
| NCT07237308 | PHASE4 | NOT_YET_RECRUITING | BEACON-AA: Apixaban With or Without Clopidogrel in Stroke Patients With Atrial Fibrillation and Cerebral Atherosclerosis |
| NCT07519044 | PHASE4 | RECRUITING | Safety and Efficacy of Adjunctive GM1 to Mechanical Thrombectomy for Acute Anterior Circulation Large Vessel Occlusion |
| NCT00004727 | PHASE4 | COMPLETED | Antiplatelet Therapy to Prevent Stroke in African Americans |
| NCT00029172 | PHASE4 | COMPLETED | Treatment for Post-Stroke Depression |
| NCT00079638 | PHASE4 | COMPLETED | Comparative Efficacy Evaluation of Lipids When Treated With Niaspan & Statin or Other Lipid-Modifying Therapies-COMPELL |
| NCT00101543 | PHASE4 | COMPLETED | Gait Training For Acute Stroke: Functional Neuromuscular Stimulation (FNS) and Weight Supported Treadmill Training |
| NCT00102869 | PHASE4 | COMPLETED | Dopaminergic Enhancement of Learning and Memory in Aphasia |
| NCT00106886 | PHASE4 | UNKNOWN | HOPE-2 Study (Heart Outcomes Prevention Evaluation-2 Study) |
| NCT00108706 | PHASE4 | UNKNOWN | Acute Candesartan Cilexetil Outcomes Stroke Trial (ACCOST) |
| NCT00126087 | PHASE4 | TERMINATED | Potentiation of Procedural Motor Learning in Health and Disease |
| NCT00149227 | PHASE4 | COMPLETED | Add-on Effects of Valsartan on Morbi- Mortality (KYOTO HEART Study) |
| NCT00153062 | PHASE4 | COMPLETED | PRoFESS - Prevention Regimen For Effectively Avoiding Second Strokes |
| NCT00153946 | PHASE4 | COMPLETED | Edaravone and Argatroban Stroke Therapy Study for Acute Ischemic Stroke |
| NCT00163150 | PHASE4 | COMPLETED | Vasomotor Reactivity In Cerebral Small Vessel Disease And New Approach To Treat Lacunar Stroke |
| NCT00177424 | PHASE4 | TERMINATED | Sertraline for Preventing Post-stroke Depression and Improving Rehabilitation Outcomes |
| NCT00178646 | PHASE4 | COMPLETED | Comparative Efficacy of Three Preparations of Botox-A in Treating Spasticity |
| NCT00196690 | PHASE4 | COMPLETED | Donepezil in Chronic Poststroke Aphasia: a Randomized Controlled Trial |
| NCT00196703 | PHASE4 | UNKNOWN | Memantine and Constraint-Induced Language Therapy in Chronic Poststroke Aphasia:A Randomized Controlled Trial |
| NCT00216411 | PHASE4 | COMPLETED | Effects on Quality of Life Following Dysport Treatment in Post-stroke Spasticity of the Arm |
Drugs tested across these trials (top 30)
| Molecule | Max phase | Trials referencing |
|---|---|---|
| ASPIRIN | 4 | 40 |
| ALTEPLASE | 4 | 17 |
| TENECTEPLASE | 4 | 11 |
| WARFARIN | 4 | 11 |
| BOTULINUM TOXIN TYPE A | 4 | 9 |
| CARBIDOPA ANHYDROUS | 4 | 9 |
| CLOPIDOGREL | 4 | 9 |
| APIXABAN | 4 | 8 |
| RIVAROXABAN | 4 | 8 |
| ATORVASTATIN | 4 | 7 |
| CILOSTAZOL | 4 | 6 |
| FINGOLIMOD | 4 | 6 |
| ROSUVASTATIN | 4 | 6 |
| DABIGATRAN ETEXILATE | 4 | 5 |
| ABCIXIMAB | 4 | 4 |
| EDOXABAN | 4 | 4 |
| HYDROXYUREA | 4 | 4 |
| LOSARTAN | 4 | 4 |
| ONABOTULINUMTOXINA | 4 | 4 |
| COLCHICINE | 4 | 3 |
| DONEPEZIL | 4 | 3 |
| EDARAVONE | 4 | 3 |
| EPTIFIBATIDE | 4 | 3 |
| LEVODOPA | 4 | 3 |
| MANNITOL | 4 | 3 |
| MARAVIROC | 4 | 3 |
| MINOCYCLINE | 4 | 3 |
| NICARDIPINE | 4 | 3 |
| SORBITOL | 4 | 3 |
| ACENOCOUMAROL | 4 | 2 |
Related Atlas pages
- Cohort genes: RUNX1, SEMA3A, SLC22A3, SLC7A7, SMARCA4, SORT1, SPARC, SPI1, SPINK2, SUPT3H, HNF1A, TCF21, TGFBI, UQCRFS1, UVRAG, XK, ZBTB14, ZNF160, HDAC9, WDR12, ICA1L, RNF213, WNK1, LRP10, ADAMTS12, NIN, WFDC1, ALDH1A2, IL1F10, IL36RN, ULK4, RASD1, SFXN4, PARK7, DAPP1, MRPL52, CPAP, TRIM29, SLC44A2, CDC5L, TSPAN5, ERRFI1, BTBD7, KCNG3, GTSCR1, CHD3, RBM23, REM2, CLDN17, NBEAL1, ADGRL4, SLC39A13, FOXQ1, PHACTR1, ADTRP, KLHL32, LINC00472, ADAMTS2, COL4A1, NANOS3, ADAMTS7, COX7A2L, TSPAN15, ZCCHC14, CDKN2AIP, MICAL2, NKX2-5, MARS2, CTTNBP2NL, FAR2, RFTN2, FAM135B, TMEM108
- Drugs: Aspirin, Alteplase, Tenecteplase, Warfarin, Botulinum Toxin Type A, Carbidopa, Clopidogrel, Apixaban, Rivaroxaban, Atorvastatin, Cilostazol, Fingolimod, Rosuvastatin, Dabigatran Etexilate, Abciximab, Edoxaban, Hydroxyurea, Losartan, Onabotulinumtoxina, Colchicine, Donepezil, Edaravone, Eptifibatide, Levodopa, Mannitol, Maraviroc, Minocycline, Nicardipine, Sorbitol, Acenocoumarol