Toxic epidermal necrolysis

Summary

Toxic epidermal necrolysis (MONDO:0019810) is a disease with 23 cohort genes (71 GWAS associations across 12 studies) and 15 clinical trials. Top therapeutic interventions include abrocitinib, clobetasol propionate, and daratumumab.

At a glance

• Prevalence: 1-9 / 1 000 000 (Taiwan, Province of China) [Orphanet-validated]
• Cohort genes: 23
• GWAS associations: 71
• ClinVar variants: 2
• Phenotypes (HPO): 64
• Clinical trials: 15

Clinical features

Epidemiology

Prevalence records

4 prevalence record(s), Orphanet:

Type	Class	Value	Geography	Validation
Annual incidence	1-9 / 1 000 000	0.8	Taiwan, Province of China	Validated
Annual incidence	1-9 / 1 000 000	0.189	Germany	Validated
Annual incidence	1-9 / 1 000 000	0.19	Worldwide	Not yet validated
Annual incidence	1-9 / 1 000 000	0.19	United States	Not yet validated

Signs & symptoms

Clinical features (HPO)

64 HPO clinical features (Orphanet curated; top 50 by frequency):

HPO ID	Term	Frequency
HP:0001945	Fever	Very frequent (80-99%)
HP:0008066	Abnormal blistering of the skin	Very frequent (80-99%)
HP:0011123	Inflammatory abnormality of the skin	Very frequent (80-99%)
HP:0012378	Fatigue	Very frequent (80-99%)
HP:0030953	Conjunctival hyperemia	Very frequent (80-99%)
HP:0002910	Elevated circulating hepatic transaminase concentration	Frequent (30-79%)
HP:0003326	Myalgia	Frequent (30-79%)
HP:0012384	Rhinitis	Frequent (30-79%)
HP:0012735	Cough	Frequent (30-79%)
HP:0025426	Abnormal bronchus morphology	Frequent (30-79%)
HP:0025439	Pharyngitis	Frequent (30-79%)
HP:0031464	Genital blistering	Frequent (30-79%)
HP:0100792	Acantholysis	Frequent (30-79%)
HP:0200042	Skin ulcer	Frequent (30-79%)
HP:0200097	Oral mucosal blisters	Frequent (30-79%)
HP:0200136	Oral-pharyngeal dysphagia	Frequent (30-79%)
HP:0000509	Conjunctivitis	Frequent (30-79%)
HP:0000600	Abnormality of the pharynx	Frequent (30-79%)
HP:0000739	Anxiety	Frequent (30-79%)
HP:0000953	Hyperpigmentation of the skin	Frequent (30-79%)
HP:0000987	Atypical scarring of skin	Frequent (30-79%)
HP:0000988	Skin rash	Frequent (30-79%)
HP:0001097	Keratoconjunctivitis sicca	Frequent (30-79%)
HP:0001903	Anemia	Frequent (30-79%)
HP:0002039	Anorexia	Frequent (30-79%)
HP:0002098	Respiratory distress	Frequent (30-79%)
HP:0002315	Headache	Frequent (30-79%)
HP:0000036	Abnormality of the penis	Occasional (5-29%)
HP:0000217	Xerostomia	Occasional (5-29%)
HP:0000491	Keratitis	Occasional (5-29%)
HP:0000572	Visual loss	Occasional (5-29%)
HP:0000613	Photophobia	Occasional (5-29%)
HP:0000716	Depression	Occasional (5-29%)
HP:0000790	Hematuria	Occasional (5-29%)
HP:0001010	Hypopigmentation of the skin	Occasional (5-29%)
HP:0001128	Trichiasis	Occasional (5-29%)
HP:0001600	Abnormality of the larynx	Occasional (5-29%)
HP:0001875	Decreased total neutrophil count	Occasional (5-29%)
HP:0001919	Acute kidney injury	Occasional (5-29%)
HP:0002014	Diarrhea	Occasional (5-29%)
HP:0002090	Pneumonia	Occasional (5-29%)
HP:0003270	Abdominal distention	Occasional (5-29%)
HP:0004378	Abnormality of the anus	Occasional (5-29%)
HP:0004386	Gastrointestinal inflammation	Occasional (5-29%)
HP:0004887	Respiratory failure requiring assisted ventilation	Occasional (5-29%)
HP:0008404	Nail dystrophy	Occasional (5-29%)
HP:0008682	Renal tubular epithelial necrosis	Occasional (5-29%)
HP:0010285	Oral synechia	Occasional (5-29%)
HP:0011354	Generalized abnormality of skin	Occasional (5-29%)
HP:0012122	Anterior uveitis	Occasional (5-29%)

Identifiers

Disease identifiers

Field	Value
Canonical name	toxic epidermal necrolysis
Mondo ID	MONDO:0019810
EFO	EFO:0004775
Orphanet	95455
ICD-11	1575072695, 195467267
NCIT	C79777
SNOMED CT	23067006
UMLS	C0014518
MedGen	4501
GARD	0007743
MedDRA	10044223
Is cancer (heuristic)	no

Also known as: Lyell syndrome · Lyell’s syndrome · SJS-TEN · TEN · toxic epidermolysis

Data availability: 2 ClinVar variants · 71 GWAS associations (12 studies).

Disease family

An umbrella term covering 3 Mondo subtypes.

Classification path: disease › human disease › disease by body system or component › integumentary system disorder › skin disorder › toxic dermatosis › toxic epidermal necrolysis

Related subtypes (4): drug rash with eosinophilia and systemic symptoms, acute generalized exanthematous pustulosis, fixed pigmented erythema, erythema multiforme major

Subtypes (3): Stevens-Johnson syndrome, Lyell syndrome, Stevens-Johnson syndrome/toxic epidermal necrolysis overlap syndrome

Genetics & variants

GWAS landscape

71 GWAS associations across 12 studies. Top hits map to 30 distinct genes (as reported by GWAS).

Top associations by p-value

rsID	p-value	Gene	Risk allele	Odds ratio
HLA-B*59:01	5e-22		?	4122.11
rs6457109	3e-16	POLR1HASP, POLR1HASP	C	4.52
rs7760545	4e-16	POLR1HASP, POLR1HASP	A	4.37
rs35835721	8e-15	POLR1HASP, POLR1HASP	G	3.09
rs137899365	3e-14	LTBP3	C	6.63
rs60581484	2e-13	HLA-F-AS1, HLA-F	A	4.2
rs1131151	4e-12	HLA-C	T	70.77
rs2074494	5e-12	HLA-C	T	63
rs4917014	8e-11	SPMIP7 - IKZF1	?	2
rs1562468327	6e-10	TAB2 - ZC3H12D	TCAGCCAGTGTGTCAGTCAGCCAGTGTTAGTCAGCCAGTGTGTCAGTCAGCCAGTGTCAGCCACCCAGTGTCAGTCAGCCAGTGTGTCAGCCACTGTCAGCCAATGTCAGCCAGTGTGTCAGC	9.7
rs199755581	7e-10	NIPAL2	CA	9.7
rs11509487	1e-09	MICB	T	16.32
rs9469003	2e-09	MICA - LINC01149	C	1.73
rs4471527	2e-09	LINC02370 - LINC02414	T	5.7
chr21:9790175	4e-09		CCTCTCTCCAGGCTCACACATTGAAGAGAA	7.4
rs28381346	5e-09	MSH5, CLIC1, MSH5-SAPCD1	A	25.02
rs6500265	6e-09	ZNF423 - RPL34P29	T	2.65
chr10:132158722	7e-09		?	2.28
rs114908185	7e-09	MUC22	A	31.12
rs1297852527	9e-09	SLC9B1P3	G	5.4
rs17137412	1e-08	UMAD1	?	4
rs1371146120	1e-08		A	3.69
rs77491650	1e-08	DDX12P	C	0.3
chr4:820728	1e-08		G	0.3
rs77542827	1e-08	FRG1JP, FRG1JP	T	17.9
rs3130501	2e-08	POU5F1	G	1.74
rs2734583	2e-08	ATP6V1G2-DDX39B, DDX39B	?	66.8
rs16957893	2e-08	HCN4 - REC114	C	5.61
rs536142737	2e-08	SMC2 - TOPORSLP	A	4.64
rs150289893	2e-08	SLC35B3	T	32.64

Top studies (by case count)

Study	Lead author	Year	Cases	Controls	Title
GCST001181	Genin E	2011	424	1,881	Genome-wide association study of Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis in Europe.
GCST90093113	Kawai Y	2021	133	0	Mapping of susceptible variants for cold medicine-related Stevens-Johnson syndrome by whole-genome resequencing.
GCST004072	Ueta M	2017	117	0	Genome-wide association study using the ethnicity-specific Japonica array: identification of new susceptibility loci for cold medicine-related Stevens-Johnson syndrome with severe ocular complications.
GCST002779	Ueta M	2015	117	0	IKZF1, a new susceptibility gene for cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis with severe mucosal involvement.
GCST90103802	Mullan KA	2022	113	0	Potential role of regulatory DNA variants in modifying the risk of severe cutaneous reactions induced by aromatic anti-seizure medications.
GCST90103803	Mullan KA	2022	85	0	Potential role of regulatory DNA variants in modifying the risk of severe cutaneous reactions induced by aromatic anti-seizure medications.
GCST000942	Shen Y	2011	72	4,251	Genome-wide association study of serious blistering skin rash caused by drugs.
GCST004115	Carr DF	2017	51	0	Genome-wide association study of nevirapine hypersensitivity in a sub-Saharan African HIV-infected population.
GCST90103804	Mullan KA	2022	35	0	Potential role of regulatory DNA variants in modifying the risk of severe cutaneous reactions induced by aromatic anti-seizure medications.
GCST008385	Nicoletti P	2019	16	8,438	Shared genetic risk factors across carbamazepine-induced hypersensitivity reactions.

Variant details and genetic-evidence tiers

Tier distribution (top 50 variants)

Tier	Variants
Tier 1: coding	2
Tier 2: splice/UTR	1
Tier 3: regulatory	1
Tier 4: intronic/intergenic	46

MAF distribution

Bucket	Variants
common (>=0.05)	34
low_freq (0.01-0.05)	10
rare (<0.01)	4
unknown	2

Functional consequences

Consequence	Count
intron_variant	26
intergenic_variant	11
unknown	6
synonymous_variant	2
3_prime_UTR_variant	1
missense_variant	1
non_coding_transcript_exon_variant	1
regulatory_region_variant	1
frameshift_variant	1

Top variants

rsID	Chr	Pos	Alleles	MAF	Consequence	Gene	p-value	Tier
HLA-B*59:01							5e-22	Tier 4: intronic/intergenic
rs6457109	6	29965484	T>C	0.252	intron_variant	POLR1HASP, POLR1HASP	3e-16	Tier 4: intronic/intergenic
rs7760545	6	29865695	C>A,G	0.259	intron_variant	POLR1HASP, POLR1HASP	4e-16	Tier 4: intronic/intergenic
rs35835721	6	29974609	T>C,G	0.462	intron_variant	POLR1HASP, POLR1HASP	8e-15	Tier 4: intronic/intergenic
rs137899365	11	65558514	C>CTGGGGGG	0.147	intron_variant	LTBP3	3e-14	Tier 4: intronic/intergenic
rs60581484	6	29729537	T>A	0.218	3_prime_UTR_variant	HLA-F-AS1, HLA-F	2e-13	Tier 2: splice/UTR
rs1131151	6	31271853	C>A,T	0.006	missense_variant	HLA-C	4e-12	Tier 1: coding
rs2074494	6	31271956	C>G,T	0.007	non_coding_transcript_exon_variant	HLA-C	5e-12	Tier 4: intronic/intergenic
rs4917014	7	50266267	T>C,G	0.05	intergenic_variant	SPMIP7 - IKZF1	8e-11	Tier 4: intronic/intergenic
rs1562468327	6	149444136	TCAGCCAGTGTGTCAGTCAGCCAGTGTTAGTCAGCCAGTGTGTCAGTCAGCCAGTGTCAGCCACCCAGTGTCAGTCAGCCAGTGTGTCAGCCACTGTCAGCCAATGTCAGCCAGTGTGTCAGC>T	0.1	regulatory_region_variant	TAB2 - ZC3H12D	6e-10	Tier 3: regulatory
rs199755581	8	98263824	CA>C	0.1	intron_variant	NIPAL2	7e-10	Tier 4: intronic/intergenic
rs11509487	6	31507308	C>CTGGGGTGA	0.071	intron_variant	MICB	1e-09	Tier 4: intronic/intergenic
rs9469003	6	31440051	T>C	0.15	intron_variant	MICA - LINC01149	2e-09	Tier 4: intronic/intergenic
rs4471527	12	131623246	T>A,C	0.08	intergenic_variant	LINC02370 - LINC02414	2e-09	Tier 4: intronic/intergenic
chr21:9790175				0.16			4e-09	Tier 4: intronic/intergenic
rs28381346	6	31740377	C>T	0.029	intron_variant	MSH5, CLIC1, MSH5-SAPCD1	5e-09	Tier 4: intronic/intergenic
rs6500265	16	49912759	C>G,T	0.278	intergenic_variant	ZNF423 - RPL34P29	6e-09	Tier 4: intronic/intergenic
chr10:132158722				0.5			7e-09	Tier 4: intronic/intergenic
rs114908185	6	31029214	A>G	0.041	synonymous_variant	MUC22	7e-09	Tier 4: intronic/intergenic
rs1297852527	10	38643144	A>C,G	0.08	intron_variant	SLC9B1P3	9e-09	Tier 4: intronic/intergenic
rs17137412	7	7761056	T>G	0.05	intron_variant	UMAD1	1e-08	Tier 4: intronic/intergenic
rs1371146120				0.147			1e-08	Tier 4: intronic/intergenic
rs77491650	12	9426934	G>C,T	0.49	intron_variant	DDX12P	1e-08	Tier 4: intronic/intergenic
chr4:820728				0.49			1e-08	Tier 4: intronic/intergenic
rs77542827	9	63832271	G>C,T	0.03	intron_variant	FRG1JP, FRG1JP	1e-08	Tier 4: intronic/intergenic
rs3130501	6	31168676	A>G,T	0.26	intron_variant	POU5F1	2e-08	Tier 4: intronic/intergenic
rs2734583	6	31537703	A>C,G,T	0.005	intron_variant	ATP6V1G2-DDX39B, DDX39B	2e-08	Tier 4: intronic/intergenic
rs16957893	15	73437142	G>C	0.08	intergenic_variant	HCN4 - REC114	2e-08	Tier 4: intronic/intergenic
rs536142737	9	104234951	ATGCTCCTCACTTCCCAGACGGGGCGGCCGGGCAGAGG>A	0.11	intron_variant	SMC2 - TOPORSLP	2e-08	Tier 4: intronic/intergenic
rs150289893	6	8427876	C>T	0.008	intron_variant	SLC35B3	2e-08	Tier 4: intronic/intergenic

ClinVar germline variants

2 retrieved; paginated sample, class counts are floors:

2 risk factor

ClinVar	Variant (HGVS)	Gene	Classification	Review
14909	HLA-B*15:02	HLA-B	risk factor	no assertion criteria provided
14911	HLA–B*58:01	HLA-B	risk factor	no assertion criteria provided

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 0 · Orphanet: 17 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
IKZF1	Orphanet:317473	Common variable immunodeficiency phenotype due to IKAROS functional haploinsufficiency
IKZF1	Orphanet:36426	Stevens-Johnson syndrome
IKZF1	Orphanet:585909	B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2)
IKZF1	Orphanet:695172	Combined immunodeficiency due to dimerization defective IKAROS mutation
IKZF1	Orphanet:697414	Early-onset combined immunodeficiency with low Ig due to dominant negative IKAROS mutation
ZNF423	Orphanet:2318	Joubert syndrome with oculorenal defect
ZNF423	Orphanet:93591	Infantile nephronophthisis
HLA-B	Orphanet:117	Behçet disease
HLA-B	Orphanet:275798	Pulmonary arterial hypertension associated with connective tissue disease
HLA-B	Orphanet:29207	Reactive arthritis
HLA-B	Orphanet:3287	Takayasu arteritis
HLA-B	Orphanet:36426	Stevens-Johnson syndrome
HLA-B	Orphanet:397	Giant cell arteritis
HLA-C	Orphanet:585909	B-lymphoblastic leukemia/lymphoma with t(9;22)(q34.1;q11.2)
MAFB	Orphanet:233	Duane retraction syndrome
MAFB	Orphanet:2774	Multicentric carpo-tarsal osteolysis with or without nephropathy
MAFB	Orphanet:529574	Duane retraction syndrome with congenital deafness

Cohort genes → proteins

23 cohort genes, 18 distinct canonical proteins.

Evidence partition

Subset	Genes
gwas_only	22
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
RPA3	HGNC:10291	ENSG00000106399	P35244	Replication protein A 14 kDa subunit	gwas
TCF19	HGNC:11629	ENSG00000137310	Q9Y242	Transcription factor 19	gwas
IKZF1	HGNC:13176	ENSG00000185811	Q13422	DNA-binding protein Ikaros	gwas
DDX39B	HGNC:13917	ENSG00000198563	Q13838	Spliceosome RNA helicase DDX39B	gwas
CCHCR1	HGNC:13930	ENSG00000204536	Q8TD31	Coiled-coil alpha-helical rod protein 1	gwas
ZNF423	HGNC:16762	ENSG00000102935	Q2M1K9	Zinc finger protein 423	gwas
PSORS1C1	HGNC:17202	ENSG00000204540	Q9UIG5	Psoriasis susceptibility 1 candidate gene 1 protein	gwas
PSORS1C3	HGNC:17203	ENSG00000204528		psoriasis susceptibility 1 candidate 3	gwas
NPTN	HGNC:17867	ENSG00000156642	Q9Y639	Neuroplastin	gwas
CD276	HGNC:19137	ENSG00000103855	Q5ZPR3	CD276 antigen	gwas
ADAM22	HGNC:201	ENSG00000008277	Q9P0K1	Disintegrin and metalloproteinase domain-containing protein 22	gwas
SLC22A23	HGNC:21106	ENSG00000137266	A1A5C7	Solute carrier family 22 member 23	gwas
MUC21	HGNC:21661	ENSG00000204544	Q5SSG8	Mucin-21	gwas
CYCSP5	HGNC:24416	ENSG00000227735		CYCS pseudogene 5	gwas
REC114	HGNC:25065	ENSG00000183324	Q7Z4M0	Meiotic recombination protein REC114	gwas
CNEP1R1	HGNC:26759	ENSG00000205423	Q8N9A8	Nuclear envelope phosphatase-regulatory subunit 1	gwas
POLR2LP1	HGNC:31340	ENSG00000238211		RNA polymerase II subunit L pseudogene 1	gwas
HLA-B	HGNC:4932	ENSG00000234745	P01889	HLA class I histocompatibility antigen, B alpha chain	clinvar
HLA-C	HGNC:4933	ENSG00000204525	P10321	HLA class I histocompatibility antigen, C alpha chain	gwas
MAFB	HGNC:6408	ENSG00000204103	Q9Y5Q3	Transcription factor MafB	gwas
MICC	HGNC:7092	ENSG00000226577		MHC class I polypeptide-related sequence C (pseudogene)	gwas
POU5F1	HGNC:9221	ENSG00000204531	Q01860	POU domain, class 5, transcription factor 1	gwas
PPIAP9	HGNC:9272	ENSG00000219797		peptidylprolyl isomerase A pseudogene 9	gwas

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
RPA3	Replication protein A 14 kDa subunit	As part of the heterotrimeric replication protein A complex (RPA/RP-A), binds and stabilizes single-stranded DNA intermediates that form during DNA replication or upon DNA stress.
TCF19	Transcription factor 19	Potential transcription factor that may play a role in the regulation of genes involved in cell cycle G1/S transition.
IKZF1	DNA-binding protein Ikaros	Transcription regulator of hematopoietic cell differentiation.
DDX39B	Spliceosome RNA helicase DDX39B	Involved in nuclear export of spliced and unspliced mRNA.
CCHCR1	Coiled-coil alpha-helical rod protein 1	May be a regulator of keratinocyte proliferation or differentiation.
ZNF423	Zinc finger protein 423	Transcription factor that can both act as an activator or a repressor depending on the context.
NPTN	Neuroplastin	Probable homophilic and heterophilic cell adhesion molecule involved in long term potentiation at hippocampal excitatory synapses through activation of p38MAPK.
CD276	CD276 antigen	May participate in the regulation of T-cell-mediated immune response.
ADAM22	Disintegrin and metalloproteinase domain-containing protein 22	Probable ligand for integrin in the brain.
REC114	Meiotic recombination protein REC114	Required for DNA double-strand breaks (DSBs) formation in unsynapsed regions during meiotic recombination.
CNEP1R1	Nuclear envelope phosphatase-regulatory subunit 1	Forms with the serine/threonine protein phosphatase CTDNEP1 an active complex which dephosphorylates and may activate LPIN1 and LPIN2.
HLA-B	HLA class I histocompatibility antigen, B alpha chain	Antigen-presenting major histocompatibility complex class I (MHCI) molecule.
HLA-C	HLA class I histocompatibility antigen, C alpha chain	Antigen-presenting major histocompatibility complex class I (MHCI) molecule with an important role in reproduction and antiviral immunity.
MAFB	Transcription factor MafB	Acts as a transcriptional activator or repressor.
POU5F1	POU domain, class 5, transcription factor 1	Transcription factor that binds to the octamer motif (5’-ATTTGCAT-3’).

Protein-family classification

Druggable: 6 · Difficult: 5 · Unknown: 12 · Druggable fraction: 0.26

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Antibody/Immunoglobulin	4	5.1×	0.036
Transcription factor	5	1.8×	0.343
Transporter	1	3.4×	0.429
Protease	1	1.6×	0.589
Other/Unknown	12	0.9×	0.714

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
RPA3	Other/Unknown	no		NA-bd_OB-fold, Rfa2
TCF19	Transcription factor	no		FHA_dom, Znf_PHD, SMAD_FHA_dom_sf
IKZF1	Transcription factor	no		Znf_C2H2_type, Znf_C2H2_sf, Ikaros_C2H2-ZF
DDX39B	Other/Unknown	no		Helicase_C-like, DEAD/DEAH_box_helicase_dom, Helicase_ATP-bd
CCHCR1	Other/Unknown	no		HCR
ZNF423	Transcription factor	no		Znf_C2H2_type, Znf_C2H2_sf
PSORS1C1	Other/Unknown	no		SEEK1
PSORS1C3	Other/Unknown	no
NPTN	Antibody/Immunoglobulin	yes		Ig_sub2, Ig_sub, Ig-like_dom
CD276	Antibody/Immunoglobulin	yes		Ig_C1-set, Ig_sub2, Ig_sub
ADAM22	Protease	yes		EGF, Peptidase_M12B, Disintegrin_dom
SLC22A23	Transporter	yes		MFS_sugar_transport-like, Sugar_transporter_CS, MFS_dom
MUC21	Other/Unknown	no		Tandem-repeating_mucin, Mucin_dom
CYCSP5	Other/Unknown	no
REC114	Other/Unknown	no		REC114L
CNEP1R1	Other/Unknown	no		NEP1-R1
POLR2LP1	Other/Unknown	no
HLA-B	Antibody/Immunoglobulin	yes		MHC_I_a_a1/a2, Ig/MHC_CS, Ig_C1-set
HLA-C	Antibody/Immunoglobulin	yes		MHC_I_a_a1/a2, Ig_C1-set, Ig-like_dom
MAFB	Transcription factor	no		bZIP_Maf, bZIP, TF_DNA-bd_sf
MICC	Other/Unknown	no
POU5F1	Transcription factor	no		POU_dom, HD, Homeodomain-like_sf
PPIAP9	Other/Unknown	no

Expression context

Cohort genes with no expression data: 0.

14 cohort genes are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	1
moderate (6-20)	0
broad (>20)	22
unknown	0

Top tissues across cohort

Tissue	Cohort genes
primordial germ cell in gonad	6
ventricular zone	4
right testis	3
stromal cell of endometrium	3
blood	3
granulocyte	2
left testis	2
testis	2
metanephros cortex	2
lateral nuclear group of thalamus	2
ganglionic eminence	2
spleen	2
bronchial epithelial cell	1
bronchus	1
epithelium of bronchus	1
lymph node	1
leukocyte	1
monocyte	1
mononuclear cell	1
adenohypophysis	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
RPA3	287	ubiquitous	marker	bronchial epithelial cell, epithelium of bronchus, bronchus
TCF19	133	ubiquitous	yes	primordial germ cell in gonad, ventricular zone, lymph node
IKZF1	225	broad	marker	leukocyte, monocyte, mononuclear cell
DDX39B	263	ubiquitous	marker	granulocyte, adenohypophysis, ventricular zone
CCHCR1	134	ubiquitous	marker	left testis, right testis, testis
ZNF423	252	broad	marker	skeletal muscle tissue of biceps brachii, biceps brachii, cartilage tissue
PSORS1C1	124	ubiquitous	yes	left testis, right testis, testis
PSORS1C3	125	tissue_specific	yes	primordial germ cell in gonad, gall bladder, metanephros cortex
NPTN	295	ubiquitous	marker	Brodmann (1909) area 23, lateral nuclear group of thalamus, cerebellar vermis
CD276	233	ubiquitous	marker	stromal cell of endometrium, ganglionic eminence, ventricular zone
ADAM22	221	ubiquitous	yes	lateral nuclear group of thalamus, middle temporal gyrus, pons
SLC22A23	247	ubiquitous	marker	pancreatic ductal cell, ileal mucosa, ganglionic eminence
MUC21	103	tissue_specific	marker	lower esophagus mucosa, esophagus mucosa, vagina
CYCSP5	97		yes	primordial germ cell in gonad, male germ line stem cell (sensu Vertebrata) in testis, corpus callosum
REC114	99	tissue_specific	yes	oocyte, secondary oocyte, right testis
CNEP1R1	255	ubiquitous	marker	left ventricle myocardium, upper arm skin, cardiac muscle of right atrium
POLR2LP1	83		yes	primordial germ cell in gonad, right coronary artery, colonic epithelium
HLA-B	134	ubiquitous	marker	blood, spleen, granulocyte
HLA-C	134	ubiquitous	marker	blood, right lung, spleen
MAFB	277	ubiquitous	marker	renal glomerulus, skin of hip, gingiva
MICC	2		yes	stromal cell of endometrium, ventricular zone, bone marrow cell
POU5F1	132	tissue_specific	marker	primordial germ cell in gonad, right uterine tube, metanephros cortex
PPIAP9	130		yes	primordial germ cell in gonad, blood, stromal cell of endometrium

Protein interactions among cohort

Intra-cohort edges: 5.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
DDX39B	5,600
RPA3	5,390
IKZF1	4,096
HLA-B	3,209
MAFB	2,671
CD276	2,292
TCF19	1,774
NPTN	1,675
ZNF423	1,526
CCHCR1	1,383

Intra-cohort edges

A	B	Sources
CCHCR1	PSORS1C1	string_interaction
CCHCR1	TCF19	string_interaction
HLA-B	HLA-C	biogrid_interaction, intact
HLA-B	PSORS1C1	string_interaction
PSORS1C1	TCF19	string_interaction

Structural data

PDB: 11 · AlphaFold-only: 7 · No structure: 5

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
HLA-B	P01889	237
DDX39B	Q13838	17
POU5F1	Q01860	16
HLA-C	P10321	13
RPA3	P35244	10
IKZF1	Q13422	10
ADAM22	Q9P0K1	10
CD276	Q5ZPR3	3
CNEP1R1	Q8N9A8	2
ZNF423	Q2M1K9	1
NPTN	Q9Y639	1

AlphaFold-only cohort genes (top 30 by pLDDT)

Symbol	UniProt	pLDDT
CCHCR1	Q8TD31	79.52
MUC21	Q5SSG8	74.30
REC114	Q7Z4M0	73.71
SLC22A23	A1A5C7	73.39
MAFB	Q9Y5Q3	63.87
TCF19	Q9Y242	63.17
PSORS1C1	Q9UIG5	55.10

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 79. Enrichment computed across 23 evidence-associated genes (13 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 13 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Endosomal/Vacuolar pathway	2	159.7×	0.005	HLA-B, HLA-C
DAP12 interactions	2	73.2×	0.013	HLA-B, HLA-C
Antigen Presentation: Folding, assembly and peptide loading of class I MHC	2	60.6×	0.013	HLA-B, HLA-C
Interferon alpha/beta signaling	2	23.4×	0.052	HLA-B, HLA-C
ER-Phagosome pathway	2	20.0×	0.052	HLA-B, HLA-C
Interaction of NuRD complexes with transcription factors	2	19.5×	0.052	TCF19, IKZF1
Interferon gamma signaling	2	19.3×	0.052	HLA-B, HLA-C
POU5F1 (OCT4), SOX2, NANOG repress genes related to differentiation	1	87.8×	0.059	POU5F1
Formation of the anterior neural plate	1	79.9×	0.059	POU5F1
POU5F1 (OCT4), SOX2, NANOG activate genes related to proliferation	1	67.6×	0.059	POU5F1
Specification of primordial germ cells	1	67.6×	0.059	POU5F1
Mismatch repair (MMR) directed by MSH2:MSH6 (MutSalpha)	1	62.8×	0.059	RPA3
Mismatch repair (MMR) directed by MSH2:MSH3 (MutSbeta)	1	62.8×	0.059	RPA3
LGI-ADAM interactions	1	62.8×	0.059	ADAM22
Removal of the Flap Intermediate	1	62.8×	0.059	RPA3
Depolymerization of the Nuclear Lamina	1	58.6×	0.059	CNEP1R1
Translesion synthesis by REV1	1	54.9×	0.059	RPA3
Defective GALNT3 causes HFTC	1	54.9×	0.059	MUC21
Defective GALNT12 causes CRCS1	1	54.9×	0.059	MUC21
Defective C1GALT1C1 causes TNPS	1	51.7×	0.059	MUC21
Translesion synthesis by POLI	1	51.7×	0.059	RPA3
Germ layer formation at gastrulation	1	51.7×	0.059	POU5F1
Removal of the Flap Intermediate from the C-strand	1	48.8×	0.059	RPA3
Translesion synthesis by POLK	1	48.8×	0.059	RPA3
Specification of the neural plate border	1	48.8×	0.059	POU5F1
SARS-CoV-2 activates/modulates innate and adaptive immune responses	2	13.7×	0.059	HLA-B, HLA-C
Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell	2	13.4×	0.059	HLA-B, HLA-C
Translesion Synthesis by POLH	1	46.2×	0.060	RPA3
Transcriptional regulation of pluripotent stem cells	1	41.8×	0.064	POU5F1
PCNA-Dependent Long Patch Base Excision Repair	1	39.9×	0.064	RPA3

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 17 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
antigen processing and presentation of endogenous peptide antigen via MHC class Ib	2	152.5×	0.004	HLA-B, HLA-C
antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-independent	2	152.5×	0.004	HLA-B, HLA-C
positive regulation of T cell mediated cytotoxicity	2	60.1×	0.019	HLA-B, HLA-C
rhombomere 6 development	1	991.3×	0.019	MAFB
cell fate commitment involved in formation of primary germ layer	1	991.3×	0.019	POU5F1
regulation of receptor localization to synapse	1	991.3×	0.019	NPTN
endodermal-mesodermal cell signaling	1	495.6×	0.025	POU5F1
rhombomere 5 development	1	495.6×	0.025	MAFB
abducens nerve formation	1	495.6×	0.025	MAFB
brain segmentation	1	330.4×	0.030	MAFB
regulation of dendritic cell differentiation	1	330.4×	0.030	HLA-B
regulation of T cell anergy	1	247.8×	0.030	HLA-B
regulation of asymmetric cell division	1	247.8×	0.030	POU5F1
regulation of interleukin-12 production	1	247.8×	0.030	HLA-B
cardiac cell fate determination	1	247.8×	0.030	POU5F1
regulation of myeloid cell differentiation	1	198.3×	0.034	MAFB
endodermal cell fate specification	1	165.2×	0.034	POU5F1
lymphocyte differentiation	1	165.2×	0.034	IKZF1
protection from natural killer cell mediated cytotoxicity	1	165.2×	0.034	HLA-B
cornified envelope assembly	1	165.2×	0.034	MAFB
meiotic DNA double-strand break formation	1	141.6×	0.038	REC114
heart induction	1	123.9×	0.039	POU5F1
segment specification	1	123.9×	0.039	MAFB
positive regulation of long-term neuronal synaptic plasticity	1	110.1×	0.042	NPTN
regulation of interleukin-6 production	1	99.1×	0.045	HLA-B
negative regulation of erythrocyte differentiation	1	90.1×	0.046	MAFB
positive regulation of fibroblast growth factor receptor signaling pathway	1	90.1×	0.046	NPTN
detection of bacterium	1	82.6×	0.048	HLA-B
positive regulation of triglyceride biosynthetic process	1	76.2×	0.049	CNEP1R1
excitatory synapse assembly	1	76.2×	0.049	NPTN

Therapeutics

Drugs indicated or in trials for this disease

No drug has an approved disease-direct ChEMBL indication for this disease.

2 drugs in clinical trials for this disease (phase 2–3, investigational): efficacy not established — a trial record, not an indication.

Drug	Highest phase
Human Immunoglobulin G	Phase 3
Infliximab	Phase 2

Drug target analysis

Approved (phase 4): 2 · Phase ≥3: 2 · Phased (≥1): 2 · Undrugged: 21

Druggability breadth: 7 of 23 evidence-associated genes (30%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Genes with an approved drug

The molecule shown is one approved compound that hits the gene — not necessarily a drug of choice or one indicated for this disease.

Symbol	Example approved molecule
IKZF1	POMALIDOMIDE
POU5F1	FAMOTIDINE

Top cohort targets by molecule count

Symbol	Molecules	Max phase
IKZF1	3	4
POU5F1	1	4
RPA3	0	0
TCF19	0	0
DDX39B	0	0
CCHCR1	0	0
ZNF423	0	0
PSORS1C1	0	0
PSORS1C3	0	0
NPTN	0	0

Drugs targeting cohort genes (top 30)

Molecule	Max phase	Targets in cohort
POMALIDOMIDE	4	IKZF1
LENALIDOMIDE	4	IKZF1
FAMOTIDINE	4	POU5F1
IBERDOMIDE	3	IKZF1

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Cohort genes with ChEMBL bioactivity (full, sorted by assay count)

Symbol	Assays	Type breakdown
IKZF1	106	Binding:105, Functional:1
POU5F1	36	Binding:36
RPA3	1	Binding:1
DDX39B	1	Binding:1
HLA-B	1	Binding:1
HLA-C	1	Binding:1

Cohort genes with high screening signal

≥100 ChEMBL assays — a studied-ness signal; see Therapeutics for approved-drug status.

Symbol	ChEMBL assays
IKZF1	106

Pharmacogenomics

Cohort genes with a PharmGKB record: 22; with CPIC/DPWG dosing guidelines: 1.

Cohort genes with a CPIC/DPWG dosing guideline

Symbol	CPIC guidelines
HLA-B	1

Chemical tractability of cohort targets

4 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Compound	Max phase	Cohort target (bioactivity)
POMALIDOMIDE	4	IKZF1
LENALIDOMIDE	4	IKZF1
FAMOTIDINE	4	POU5F1
IBERDOMIDE	3	IKZF1

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	2	IKZF1, POU5F1
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	5	NPTN, CD276, ADAM22, HLA-B, HLA-C
D	Druggable family + AlphaFold only, no drug	1	SLC22A23
E	Difficult family or no structure, no drug	15	RPA3, TCF19, DDX39B, CCHCR1, ZNF423, PSORS1C1, PSORS1C3, MUC21, CYCSP5, REC114 (+5 more)

Undrugged target profiles

21 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
RPA3	1	—
TCF19	0	—
DDX39B	1	—
CCHCR1	0	—
ZNF423	0	—
PSORS1C1	0	—
PSORS1C3	0	—
NPTN	0	—
CD276	0	—
ADAM22	0	—
SLC22A23	0	—
MUC21	0	—
CYCSP5	0	—
REC114	0	—
CNEP1R1	0	—
POLR2LP1	0	—
HLA-B	1	—
HLA-C	1	—
MAFB	0	—
MICC	0	—
PPIAP9	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 15.

Phase distribution (across all retrieved trials)

Phase	Trials
Not specified	6
PHASE1/PHASE2	5
PHASE3	2
PHASE2	1
EARLY_PHASE1	1

Top trials by phase / activity

NCT	Phase	Status	Title
NCT06425224	PHASE3	RECRUITING	Effectiveness and Safety of TENS Therapy for Premature Ejaculation
NCT01696500	PHASE3	COMPLETED	Phase III Clinical Trial of NPB-01 in Patients With Stevens-Johnson Syndrome/ Toxic Epidermal Necrolysis Unresponsive to Corticosteroids.
NCT04711200	PHASE1/PHASE2	RECRUITING	LYell SYndrome MEsenchymal Stromal Cells Treatment
NCT07110662	PHASE1/PHASE2	NOT_YET_RECRUITING	New Therapeutic Target for Toxic Epidermal Necrolysis (TEN) Using Anti-CD38+ Monoclonal Antibodies.
NCT00372723	PHASE2	WITHDRAWN	Study of a Potential New Treatment for Patients With Toxic Epidermal Necrolysis (TEN)
NCT02037347	PHASE1/PHASE2	TERMINATED	Study to Evaluate the Use of Palifermin to Treat Toxic Epidermal Necrolysis
NCT02319616	PHASE1/PHASE2	WITHDRAWN	Topical Clobetasol for the Treatment of Toxic Epidermal Necrolysis
NCT05520086	PHASE1/PHASE2	UNKNOWN	Clinical Trial to Evaluate Safety and Efficacy of Cell Therapy in Patients With Cicatricial Conjuntivitis.
NCT06119490	EARLY_PHASE1	RECRUITING	Evaluation of the Efficacy and Safety of Methylprednisolone Combined With the JAK Inhibitors in the Treatment of Toxic Epidermal Necrolysis
NCT03659227	Not specified	RECRUITING	Drug Reactions Sampling (COLLECTIONTOXIDERMIES)
NCT02574988	Not specified	UNKNOWN	Severe Cutaneous Adverse Reactions in Thailand
NCT02795143	Not specified	WITHDRAWN	Evaluating the Effect of Isotretinoin in Regulatory T-cell Function in Adverse Cutaneous Drug Eruptions (ACDEs): A Pilot Study
NCT03548870	Not specified	TERMINATED	Transcutaneous Electrical Nerve Stimulation During Exercise in Patients With COPD
NCT03585946	Not specified	WITHDRAWN	Outcomes in Stevens Johnsons Syndrome and Toxic Epidermal Necrolysis
NCT06474078	Not specified	COMPLETED	Study To Evaluate The Efficacy Of Tofacitinib In Patients With SJS/TEN

Drugs tested across these trials (top 30)

Molecule	Max phase	Trials referencing
ABROCITINIB	4	1
CLOBETASOL PROPIONATE	4	1
DARATUMUMAB	4	1
PALIFERMIN	4	1
CLOBETASOL	3	1
DAPOXETINE	3	1