Waardenburg syndrome type 4B

Summary

Waardenburg syndrome type 4B (MONDO:0013201) is a disease caused by EDN3 (GenCC Definitive), with 1 cohort gene.

At a glance

• Causal gene: EDN3 (GenCC Definitive)
• Cohort genes: 1
• ClinVar variants: 16

Clinical features

No curated clinical features (Orphanet) for this disease.

Identifiers

Disease identifiers

Field	Value
Canonical name	Waardenburg syndrome type 4B
Mondo ID	MONDO:0013201
MeSH	C567680
OMIM	613265
DOID	DOID:0110954
UMLS	C2750457
MedGen	412961
GARD	0015641
Is cancer (heuristic)	no

Also known as: EDN3 Waardenburg syndrome · Waardenburg syndrome caused by mutation in EDN3 · Waardenburg syndrome type 4B · Waardenburg syndrome, type 4B · WS4B

Data availability: 16 ClinVar variants · 7 GenCC gene-disease records.

Disease family

Classification path: disease › human disease › disease by etiologic mechanism › disease of genetic or genomic mechanism › hereditary disease › autosomal genetic disease › autosomal dominant disease › Waardenburg syndrome › Waardenburg-Shah syndrome › Waardenburg syndrome type 4B

Related subtypes (2): Waardenburg syndrome type 4A, Waardenburg syndrome type 4C

Genetics & variants

GWAS landscape

No GWAS associations recorded — common-variant (GWAS) studies don’t cover this disease (typical for Mendelian / rare diseases). See the curated gene cohort and Mendelian overlap below.

Variant details and genetic-evidence tiers

ClinVar germline variants

16 retrieved; paginated sample, class counts are floors:

6 uncertain significance, 5 pathogenic, 2 benign/likely benign, 1 likely benign, 1 conflicting classifications of pathogenicity, 1 likely pathogenic

ClinVar	Variant (HGVS)	Gene	Classification	Review
16643	NM_207034.3(EDN3):c.262_263delinsT (p.Ala88fs)	EDN3	Pathogenic	no assertion criteria provided
16644	NM_207034.3(EDN3):c.476G>T (p.Cys159Phe)	EDN3	Pathogenic	no assertion criteria provided
16649	NM_207034.3(EDN3):c.507C>A (p.Cys169Ter)	EDN3	Pathogenic	no assertion criteria provided
16650	NM_207034.3(EDN3):c.335A>G (p.His112Arg)	EDN3	Pathogenic	no assertion criteria provided
16651	NM_207034.3(EDN3):c.277C>G (p.Arg93Gly)	EDN3	Pathogenic	no assertion criteria provided
547292	NM_207034.3(EDN3):c.334C>A (p.His112Asn)	EDN3	Likely pathogenic	criteria provided, single submitter
339123	NM_207034.3(EDN3):c.293C>A (p.Thr98Lys)	EDN3	Conflicting classifications of pathogenicity	criteria provided, conflicting classifications
339121	NM_207034.3(EDN3):c.43T>G (p.Ser15Ala)	EDN3	Uncertain significance	criteria provided, multiple submitters, no conflicts
339126	NM_207034.3(EDN3):c.688C>T (p.Arg230Cys)	EDN3	Uncertain significance	criteria provided, multiple submitters, no conflicts
3892384	NM_207034.3(EDN3):c.646A>C (p.Met216Leu)	EDN3	Uncertain significance	criteria provided, single submitter
4070994	NM_207034.3(EDN3):c.472C>T (p.Arg158Cys)	EDN3	Uncertain significance	no assertion criteria provided
523332	NM_207034.3(EDN3):c.143AGACTGTGGCTGGCCCTGGCGAGG[3] (p.48ETVAGPGE[3])	EDN3	Uncertain significance	criteria provided, multiple submitters, no conflicts
545507	NM_207034.3(EDN3):c.332G>T (p.Cys111Phe)	EDN3	Uncertain significance	criteria provided, single submitter
16647	NM_207034.3(EDN3):c.670G>A (p.Ala224Thr)	EDN3	Likely benign	criteria provided, multiple submitters, no conflicts
227351	NM_207034.3(EDN3):c.565dup (p.Thr189fs)	EDN3	Benign/Likely benign	criteria provided, multiple submitters, no conflicts
339124	NM_207034.3(EDN3):c.426G>A (p.Ala142=)	EDN3	Benign/Likely benign	criteria provided, multiple submitters, no conflicts

Genes & proteins

Mendelian disease overlap and somatic drivers

GenCC: 12 · Orphanet: 3 · OMIM-shared: 0 · Dual-evidence (GWAS+Mendelian): 0

GenCC gene–disease validity (cohort genes)

the Disease column is the GenCC-asserted condition — a cohort gene’s strongest validity may be for a related predisposition syndrome.

Gene	Classification	Inheritance	Disease	Records
EDN3	Definitive	Autosomal dominant	Waardenburg syndrome type 4B	12

Orphanet rare-disease linkage (cohort genes)

Gene	Orphanet ID	Rare disease
EDN3	Orphanet:388	Hirschsprung disease
EDN3	Orphanet:661	Congenital central hypoventilation syndrome
EDN3	Orphanet:897	Waardenburg-Shah syndrome

Cohort genes → proteins

1 cohort genes, 1 distinct canonical proteins.

Evidence partition

Subset	Genes
multi_evidence	1

Cohort genes (full)

Symbol	HGNC	Ensembl	UniProt	Name	Evidence
EDN3	HGNC:3178	ENSG00000124205	P14138	Endothelin-3	gencc,clinvar

Cohort function summary

Lead sentence per gene, UniProt-curated.

Symbol	Protein name	Function (lead sentence)
EDN3	Endothelin-3	Endothelins are endothelium-derived vasoconstrictor peptides.

Protein-family classification

Druggable: 0 · Difficult: 0 · Unknown: 1 · Druggable fraction: 0.0

Family distribution

Cohort families vs a genome-wide background (hypergeometric, BH-FDR; fold = observed/expected). Counts kept; sorted by enrichment, so the catch-all Other/Unknown bucket no longer leads.

Family	Genes	Fold	FDR
Other/Unknown	1	1.8×	0.558

Per-gene assignment

Symbol	Family	Druggable?	EC	InterPro (top 3)
EDN3	Other/Unknown	no		Endothln-like_toxin, Endothelin_toxin_CS, Endothelin

Expression context

Cohort genes with no expression data: 0.

1 cohort gene are a single-cell marker in ≥1 SCXA experiment.

Breadth distribution (Bgee present_calls)

Bucket	Genes
narrow (1-5 tissues)	0
moderate (6-20)	0
broad (>20)	1
unknown	0

Top tissues across cohort

Tissue	Cohort genes
jejunal mucosa	1
penis	1
primordial germ cell in gonad	1

Per-gene tissue summary (top 30)

Symbol	Bgee breadth	FANTOM5 breadth	SCXA	Top tissues
EDN3	175	broad	marker	penis, jejunal mucosa, primordial germ cell in gonad

Protein interactions among cohort

Intra-cohort edges: 0.

Hub genes (top 10 by interactor count)

Symbol	Interactor count
EDN3	1,376

Structural data

PDB: 1 · AlphaFold-only: 0 · No structure: 0

Cohort genes with PDB structures (top 30)

Symbol	UniProt	PDB entries
EDN3	P14138	1

Function

Pathway analysis

Distinct Reactome pathways touched by cohort: 3. Enrichment computed across 1 evidence-associated genes (1 with Reactome annotation).

Pathways by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

Pathway	Cohort genes	Fold	FDR	Sample cohort genes
Transcriptional and post-translational regulation of MITF-M expression and activity	1	178.4×	0.017	EDN3
Peptide ligand-binding receptors	1	74.2×	0.017	EDN3
G alpha (q) signalling events	1	57.4×	0.017	EDN3

GO biological processes by enrichment

Over-representation of cohort genes vs the genome-wide background (hypergeometric test, Benjamini-Hochberg FDR; fold = observed/expected over 1 annotated cohort genes). Counts and members are kept as ground-truth; sorted by enrichment.

GO term	Cohort genes	Fold	FDR	Sample cohort genes
regulation of developmental pigmentation	1	5617.3×	0.002	EDN3
vein smooth muscle contraction	1	4213.0×	0.002	EDN3
regulation of systemic arterial blood pressure by endothelin	1	2808.7×	0.002	EDN3
intracellular magnesium ion homeostasis	1	2808.7×	0.002	EDN3
peptide hormone secretion	1	2808.7×	0.002	EDN3
positive regulation of hormone secretion	1	1685.2×	0.003	EDN3
positive regulation of leukocyte chemotaxis	1	1296.3×	0.003	EDN3
positive regulation of potassium ion transmembrane transport	1	991.3×	0.003	EDN3
positive regulation of smooth muscle contraction	1	936.2×	0.003	EDN3
vasoconstriction	1	887.0×	0.003	EDN3
regulation of vasoconstriction	1	802.5×	0.003	EDN3
melanocyte differentiation	1	802.5×	0.003	EDN3
positive regulation of heart rate	1	702.2×	0.003	EDN3
positive regulation of mitotic nuclear division	1	543.6×	0.004	EDN3
blood circulation	1	510.7×	0.004	EDN3
axon extension	1	495.6×	0.004	EDN3
neural crest cell migration	1	337.0×	0.005	EDN3
neutrophil chemotaxis	1	285.6×	0.006	EDN3
positive regulation of cell differentiation	1	267.5×	0.006	EDN3
establishment of localization in cell	1	160.5×	0.009	EDN3
intracellular calcium ion homeostasis	1	145.3×	0.010	EDN3
potassium ion transmembrane transport	1	135.9×	0.010	EDN3
cell population proliferation	1	102.8×	0.013	EDN3
axon guidance	1	90.6×	0.014	EDN3
regulation of gene expression	1	83.4×	0.014	EDN3
positive regulation of MAPK cascade	1	80.6×	0.014	EDN3
cell-cell signaling	1	69.6×	0.016	EDN3
cell surface receptor signaling pathway	1	64.1×	0.017	EDN3
positive regulation of cell population proliferation	1	33.6×	0.031	EDN3
signal transduction	1	16.1×	0.062	EDN3

Therapeutics

Drug target analysis

Approved (phase 4): 0 · Phase ≥3: 0 · Phased (≥1): 0 · Undrugged: 1

Druggability breadth: 0 of 1 evidence-associated genes (0%) have a ChEMBL target (buckets above are over the deeply-mined display cohort).

Top cohort targets by molecule count

Symbol	Molecules	Max phase
EDN3	0	0

Bioactivity and enzyme data

Enzyme cohort genes (≥1 EC): 0.

Pharmacogenomics

Cohort genes with a PharmGKB record: 1; with CPIC/DPWG dosing guidelines: 0.

No cohort gene has a CPIC/DPWG genotype-guided dosing guideline (PharmGKB).

Chemical tractability of cohort targets

0 approved/phased compounds have measured bioactivity against a cohort gene (and aren’t yet in disease-level trials). This is a research / tractability signal, NOT a therapeutic recommendation — a bioactivity row often reflects off-target or screening binding (e.g. promiscuous kinase inhibitors against a cohort kinase), implying no disease mechanism.

Druggability pyramid

Cohort genes binned by druggability tier (high → low):

Tier	Definition	Genes	Symbols
A	Approved (phase 4 drug)	0
B	Phased (≥1) drug, not yet approved	0
C	Druggable family + PDB, no drug	0
D	Druggable family + AlphaFold only, no drug	0
E	Difficult family or no structure, no drug	1	EDN3

Undrugged target profiles

1 cohort genes are undrugged. Ranked by ‘starting-point quality’ (assay depth + drugged-partner adjacency).

Symbol	ChEMBL assays	Drugged partners (top 3)
EDN3	0	—

Clinical trials & evidence

Clinical trials

Clinical trials: 0.