ACAD9

Summary

ACAD9 (acyl-CoA dehydrogenase family member 9, HGNC:21497) is a protein-coding gene on chromosome 3q21.3, encoding Complex I assembly factor ACAD9, mitochondrial (Q9H845). Together with NDUFAF1 and ECSIT, forms part of the mitochondrial complex I (MCIA),which is required for the biogenesis of respiratory Complex I (CI) and is therefore crucial for the activation of the oxidative phosphorylation system. It is a selective cancer dependency (DepMap: 10.8% of cell lines).

This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.

Source: NCBI Gene 28976 — RefSeq curated summary.

At a glance

• Gene–disease (curated): acyl-CoA dehydrogenase 9 deficiency (Definitive, ClinGen)
• GWAS associations: 2
• Clinical variants (ClinVar): 1,196 total — 51 pathogenic, 102 likely-pathogenic (top 2% of genes corpus-wide)
• GTEx eGene: eQTL in 49 tissues, sQTL in 41 (q < 0.05)
• Phenotypes (HPO): 40
• Cancer dependency (DepMap): dependent in 10.8% of screened cell lines
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.88 (unconstrained)
• MANE Select transcript: NM_014049
• Interaction hub: 2,286 STRING partners (top 5% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:21497
Approved symbol	ACAD9
Name	acyl-CoA dehydrogenase family member 9
Location	3q21.3
Locus type	gene with protein product
Status	Approved
Aliases	NPD002, MGC14452
Ensembl gene	ENSG00000177646
Ensembl biotype	protein_coding
OMIM	611103
Entrez	28976

Gene structure

Transcript identifiers

Ensembl transcripts: 71 — 42 nonsense_mediated_decay, 21 protein_coding, 6 retained_intron, 2 protein_coding_CDS_not_defined

MANE Select: ENST00000308982

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 2: 4, TSL 3: 3, TSL 4: 2, TSL 5: 1

ENST00000308982, ENST00000505192, ENST00000505602, ENST00000505867, ENST00000508971, ENST00000511227, ENST00000511325, ENST00000511526, ENST00000512801, ENST00000514336, ENST00000514643, ENST00000515429, ENST00000679399, ENST00000679431, ENST00000679613, ENST00000679715, ENST00000679824, ENST00000679990, ENST00000680636, ENST00000680638, ENST00000680744, ENST00000680764, ENST00000681319, ENST00000681367, ENST00000681552, ENST00000681583, ENST00000681585, ENST00000681589, ENST00000681784, ENST00000681886, ENST00000897729, ENST00000897730, ENST00000897731, ENST00000897732, ENST00000897733, ENST00000897734, ENST00000926996, ENST00000926997, ENST00000959715, ENST00000959716, ENST00000981940, ENST00000981941, ENST00000981942, ENST00000981943, ENST00000981944, ENST00000981945, ENST00000981946, ENST00000981947, ENST00000981950, ENST00000981951, ENST00000981952, ENST00001049457, ENST00001049458, ENST00001049459, ENST00001049460, ENST00001049461, ENST00001049463, ENST00001049464, ENST00001049465, ENST00001083203, ENST00001083204, ENST00001083205, ENST00001083206, ENST00001083207, ENST00001083208, ENST00001083209, ENST00001083210, ENST00001122815, ENST00001122816, ENST00001130642, ENST00001140615

RefSeq mRNA: 2 — MANE Select: NM_014049 NM_001410805, NM_014049

CCDS: CCDS3053, CCDS93369

Canonical transcript exons

ENST00000308982 — 18 exons

Exon	Start	End
ENSE00002032118	128912507	128913114
ENSE00002075968	128879620	128879841
ENSE00003461249	128897632	128897710
ENSE00003463821	128906121	128906249
ENSE00003468618	128884653	128884746
ENSE00003511926	128909344	128909421
ENSE00003543353	128908185	128908264
ENSE00003547393	128899287	128899461
ENSE00003551482	128904386	128904505
ENSE00003552663	128910021	128910149
ENSE00003559245	128901276	128901349
ENSE00003582093	128896436	128896536
ENSE00003600670	128908973	128909099
ENSE00003631720	128910741	128910813
ENSE00003637000	128902553	128902628
ENSE00003650148	128893555	128893656
ENSE00003660117	128904062	128904132
ENSE00003671677	128895310	128895416

Expression profiles

Bgee: expression breadth ubiquitous, 258 present calls, max score 97.95.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 25.9866 / max 325.4298, expressed in 1823 samples.

Highest expression (Bgee): upper arm skin, skin of abdomen, ventricle myocardium, tibialis anterior, cardiac muscle of right atrium.

Genetic regulation across tissues (GTEx eQTL / sQTL)

ACAD9 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 49 tissues and its splicing (sQTL) in 41 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 90 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Thyroid	eqtl	4.2e-84	+2.39	3:128878859:G:C
Lung	eqtl	2.2e-72	+1.99	3:128878859:G:C
Skin Sun Exposed Lower leg	eqtl	2.3e-58	+1.13	3:128878859:G:C
Muscle Skeletal	eqtl	4.0e-53	+1.80	3:128852857:C:T
Adipose Subcutaneous	eqtl	9.1e-53	+2.05	3:128852857:C:T
Whole Blood	eqtl	1.5e-51	+1.48	3:128852857:C:T
Skin Not Sun Exposed Suprapubic	eqtl	2.0e-51	+1.24	3:128852857:C:T
Nerve Tibial	eqtl	8.0e-49	+2.18	3:128852857:C:T
Adipose Visceral Omentum	eqtl	2.2e-47	+1.89	3:128878859:G:C
Muscle Skeletal	sqtl	1.0e-46	-2.81	3:128878859:G:C
Colon Transverse	eqtl	5.3e-43	+2.08	3:128878859:G:C
Colon Sigmoid	eqtl	4.0e-42	+2.24	3:128898459:G:GCAGTGGCACGATCTTGGCTCACTGCAGC
Cells EBV-transformed lymphocytes	eqtl	1.6e-39	+1.61	3:128852857:C:T
Artery Aorta	eqtl	2.6e-38	+2.17	3:128878859:G:C
Skin Not Sun Exposed Suprapubic	sqtl	2.6e-38	-2.96	3:128878859:G:C
Esophagus Gastroesophageal Junction	eqtl	2.1e-37	+2.04	3:128852857:C:T
Breast Mammary Tissue	eqtl	5.1e-37	+2.13	3:128852857:C:T
Artery Tibial	eqtl	1.9e-36	+1.72	3:128852857:C:T
Esophagus Muscularis	eqtl	2.0e-34	+1.84	3:128852857:C:T
Cells Cultured fibroblasts	eqtl	2.3e-31	+0.95	3:128852857:C:T

FANTOM5 promoters

4 alternative TSS:

Promoter ID	TPM avg	Samples expressed
38491	25.7708	1823
38490	0.1111	42
38492	0.0549	19
202924	0.0498	5

Top tissues by expression

showing 100 of 261 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
upper arm skin	UBERON:0004263	97.95	gold quality
skin of abdomen	UBERON:0001416	95.41	gold quality
left ventricle myocardium	UBERON:0006566	95.33	gold quality
tibialis anterior	UBERON:0001385	94.61	gold quality
cardiac muscle of right atrium	UBERON:0003379	94.52	gold quality
skin of leg	UBERON:0001511	94.41	gold quality
ileal mucosa	UBERON:0000331	94.31	gold quality
zone of skin	UBERON:0000014	93.93	gold quality
upper leg skin	UBERON:0004262	91.68	gold quality
kidney epithelium	UBERON:0004819	91.41	gold quality
right adrenal gland cortex	UBERON:0035827	91.17	gold quality
right adrenal gland	UBERON:0001233	91.07	gold quality
apex of heart	UBERON:0002098	91.04	gold quality
esophagus mucosa	UBERON:0002469	90.87	gold quality
sural nerve	UBERON:0015488	90.83	gold quality
left adrenal gland	UBERON:0001234	90.72	gold quality
muscle of leg	UBERON:0001383	90.66	gold quality
gastrocnemius	UBERON:0001388	90.58	gold quality
lower esophagus mucosa	UBERON:0035834	90.35	gold quality
heart left ventricle	UBERON:0002084	90.28	gold quality
deltoid	UBERON:0001476	90.24	silver quality
left adrenal gland cortex	UBERON:0035825	90.24	gold quality
nipple	UBERON:0002030	90.22	gold quality
adrenal gland	UBERON:0002369	90.22	gold quality
cardiac atrium	UBERON:0002081	90.21	gold quality
esophagus	UBERON:0001043	90.08	gold quality
right atrium auricular region	UBERON:0006631	90.08	gold quality
bone marrow cell	CL:0002092	89.98	gold quality
cardiac ventricle	UBERON:0002082	89.94	gold quality
adrenal cortex	UBERON:0001235	89.89	gold quality
hindlimb stylopod muscle	UBERON:0004252	89.79	gold quality
right lobe of thyroid gland	UBERON:0001119	89.76	gold quality
adrenal tissue	UBERON:0018303	89.76	gold quality
metanephros cortex	UBERON:0010533	89.68	gold quality
right uterine tube	UBERON:0001302	89.65	gold quality
mucosa of transverse colon	UBERON:0004991	89.63	gold quality
right hemisphere of cerebellum	UBERON:0014890	89.45	gold quality
heart	UBERON:0000948	89.43	gold quality
adenohypophysis	UBERON:0002196	89.42	gold quality
body of stomach	UBERON:0001161	89.31	gold quality
body of uterus	UBERON:0009853	89.21	gold quality
lower esophagus	UBERON:0013473	89.20	gold quality
pituitary gland	UBERON:0000007	89.19	gold quality
lower esophagus muscularis layer	UBERON:0035833	89.18	gold quality
mammalian vulva	UBERON:0000997	89.11	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	89.11	gold quality
skeletal muscle organ	UBERON:0014892	89.11	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	89.06	gold quality
smooth muscle tissue	UBERON:0001135	89.02	gold quality
cerebellar hemisphere	UBERON:0002245	88.98	gold quality
cerebellar cortex	UBERON:0002129	88.95	gold quality
granulocyte	CL:0000094	88.94	gold quality
right lobe of liver	UBERON:0001114	88.90	gold quality
left lobe of thyroid gland	UBERON:0001120	88.86	gold quality
ectocervix	UBERON:0012249	88.78	gold quality
left ovary	UBERON:0002119	88.72	gold quality
muscle layer of sigmoid colon	UBERON:0035805	88.69	gold quality
transverse colon	UBERON:0001157	88.67	gold quality
stomach	UBERON:0000945	88.62	gold quality
thyroid gland	UBERON:0002046	88.58	gold quality
prefrontal cortex	UBERON:0000451	88.56	gold quality
minor salivary gland	UBERON:0001830	88.41	gold quality
left coronary artery	UBERON:0001626	88.39	gold quality
right ovary	UBERON:0002118	88.37	gold quality
coronary artery	UBERON:0001621	88.31	gold quality
adult mammalian kidney	UBERON:0000082	88.29	gold quality
nerve	UBERON:0001021	88.21	gold quality
tibial nerve	UBERON:0001323	88.21	gold quality
left uterine tube	UBERON:0001303	88.20	gold quality
cerebellum	UBERON:0002037	88.20	gold quality
descending thoracic aorta	UBERON:0002345	88.20	gold quality
mucosa of stomach	UBERON:0001199	88.19	gold quality
colonic epithelium	UBERON:0000397	88.16	gold quality
penis	UBERON:0000989	88.15	gold quality
omental fat pad	UBERON:0010414	88.15	gold quality
peritoneum	UBERON:0002358	88.13	gold quality
calcaneal tendon	UBERON:0003701	88.12	gold quality
stromal cell of endometrium	CL:0002255	88.10	gold quality
vagina	UBERON:0000996	88.00	gold quality
thoracic aorta	UBERON:0001515	87.98	gold quality
endocervix	UBERON:0000458	87.97	gold quality
adipose tissue of abdominal region	UBERON:0007808	87.97	gold quality
ascending aorta	UBERON:0001496	87.96	gold quality
cortex of kidney	UBERON:0001225	87.95	gold quality
popliteal artery	UBERON:0002250	87.94	gold quality
tibial artery	UBERON:0007610	87.93	gold quality
right frontal lobe	UBERON:0002810	87.91	gold quality
aorta	UBERON:0000947	87.90	gold quality
body of pancreas	UBERON:0001150	87.88	gold quality
uterine cervix	UBERON:0000002	87.86	gold quality
right coronary artery	UBERON:0001625	87.81	gold quality
rectum	UBERON:0001052	87.58	gold quality
spleen	UBERON:0002106	87.37	gold quality
skin of hip	UBERON:0001554	87.33	gold quality
adipose tissue	UBERON:0001013	87.29	gold quality
Brodmann (1909) area 9	UBERON:0013540	87.27	gold quality
fundus of stomach	UBERON:0001160	87.26	gold quality
mouth mucosa	UBERON:0003729	87.25	gold quality
ventricular zone	UBERON:0003053	87.23	gold quality
metanephros	UBERON:0000081	87.20	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	7.29
E-CURD-112	no	2.76

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Skin 1	tissue	28.9	high
Tongue	tissue	27.1
Parathyroid gland	tissue	26.1	high
Skeletal muscle	tissue	23.7	low
Spinal cord	tissue	20.5
Liver	tissue	19.3	medium
Heart muscle	tissue	18.7	medium
Frontal cortex	tissue	18.5
Substantia nigra	tissue	18.0
Esophagus	tissue	17.9	high
Midbrain	tissue	17.7
Medulla oblongata	tissue	17.4
Thalamus	tissue	16.6
Cerebral cortex	tissue	16.5	medium
Motor cortex	tissue	16.5
Hippocampal formation	tissue	16.3
Superior colliculi	tissue	16.1
Pons	tissue	16.0
Prefrontal cortex	tissue	15.9
Caudate putamen	tissue	15.9
Adipose tissue	tissue	15.6	not detected
Somatosensory cortex	tissue	15.6
Retrosplenial and cingulate cortex	tissue	15.3
Insular cortex	tissue	15.3
Hypothalamus	tissue	15.0
Entorhinal cortex	tissue	15.0
Ventral forebrain	tissue	14.7
Occipital cortex	tissue	14.7
Putamen	tissue	14.6
Retrosplenial cortex	tissue	14.6
Temporal cortex	tissue	14.6
Septum	tissue	14.4
Basal ganglia	tissue	14.3	medium
Corpus callosum	tissue	14.3
Amygdala	tissue	13.9
Adrenal gland	tissue	13.8	medium
Kidney	tissue	13.6	high
Periaqueductal gray	tissue	13.6
Choroid plexus	tissue	12.5
Vagina	tissue	12.1	medium
Salivary gland	tissue	11.9	medium
Pituitary gland	tissue	11.4
Pancreas	tissue	11.4	high
Locus coeruleus	tissue	11.4
Seminal vesicle	tissue	11.3	high
Thymus	tissue	11.3
Olfactory bulb	tissue	11.0
Breast	tissue	10.7	medium
Thyroid gland	tissue	10.7	medium
Colon	tissue	10.5	high
Tonsil	tissue	10.5	high
Smooth muscle	tissue	10.4	not detected
Cervix	tissue	10.2	medium
Ovary	tissue	10.0	not detected
Nucleus accumbens	tissue	9.9
Cerebellum	tissue	9.9	high
Fallopian tube	tissue	9.8	medium
Prostate	tissue	9.1	low
Hippocampus	tissue	9.0	high
Rectum	tissue	8.9	high

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Ventral spinal cord (20.5), Dorsal spinal cord (16.4), Dorsal hippocampus (16.3), Ventral hippocampus (15.9), Subiculum (15.0).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting ACAD9 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

16 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-101-3P	99.94	75.03	2230
HSA-MIR-6844	99.82	70.69	2423
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-132-3P	99.73	70.56	1424
HSA-MIR-212-3P	99.73	70.65	1424
HSA-MIR-1303	99.65	69.77	1662
HSA-MIR-4672	99.50	71.58	2893
HSA-MIR-6083	99.47	68.73	2393
HSA-MIR-3123	99.47	67.15	2693
HSA-MIR-1237-3P	98.55	67.65	1423
HSA-MIR-758-3P	98.42	68.60	1122
HSA-MIR-147A	98.33	66.40	795
HSA-MIR-4468	98.01	66.85	1187
HSA-MIR-490-3P	97.79	65.54	606
HSA-MIR-764	94.16	64.85	656

Functional genomics

gnomAD constraint: pLI 1.14e-12, LOEUF 0.884, missense Z 0.861 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000308982 — one region, missense o/e 0.97. DepMap (CRISPR cell-line fitness): dependent in 10.8% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): NB7 (-1.125), LP-1 (-0.973), D-423MG (-0.965), TOV-112D (-0.879), NZM42 (-0.87), P4E6 (-0.869), HGC-27 (-0.83), C84 (-0.824), C3A (-0.821), RPMI 2650 (-0.81), NALM-6 (-0.787), U-251 MG DM (-0.786), IPC-298 (-0.78), MDA-MB-453 (-0.779), MC116 (-0.777).

Literature-anchored findings (GeneRIF, showing 17)

• Very high activity of CPT2 and VCLAD, involved in the metabolism of long-chain fatty acids. Fatty acid oxidation may play role in energy generation in placenta, and deficiency in may result in placental dysfunction and gestational complications. (PMID:12971426)
• ACAD9 may play a role in the turnover of lipid membrane unsaturated fatty acids that are essential for membrane integrity and structure (PMID:16020546)
• acyl-CoA dehydrogenase 9 (ACAD 9)was identified as the long-chain ACAD in human embryonic and fetal brain and central nervous tissue, using in situ hybridization as well as enzymatic studies (PMID:16750164)
• We now report three cases of ACAD9 deficiency. (PMID:17564966)
• Validated occurrence of an unusual TG 3’ splice site in intron 10. (PMID:17672918)
• Accumulation of 3-hydroxylated intermediates of long-chain fatty acids may contribute to the pathogenesis of retinopathy in MTP deficiencies. (PMID:18385088)
• Data show that two closely related metabolic enzymes, ACAD9 and VLCAD, diverged at the root of the vertebrate lineage to function in two separate mitochondrial metabolic pathways and have clinical implications for the diagnosis of complex I deficiency. (PMID:20816094)
• Our data support a new function for ACAD9 in complex I function, making this gene an important new candidate for patients with complex I deficiency, which could be improved by riboflavin treatment. (PMID:20929961)
• ACAD9 screening of 120 additional complex I-defective index cases led us to identify two additional unrelated cases and a total of five pathogenic ACAD9 alleles. (PMID:21057504)
• Strong candidate gene for mitochondrial disease, based on recessive mutations detected in infantile patients (PMID:22277967)
• Our results underscore the importance of the ACAD9 protein in complex I assembly and suggest that the enzymatic activity is a rudiment of the duplication event. (PMID:24158852)
• In cells where it is strongly expressed, ACAD9 plays a physiological role in fatty acid oxidation. (PMID:25721401)
• ACAD9 mutation is the most frequent cause of cardiac hypertrophy and isolated complex I deficiency. (PMID:26669660)
• Case Report: neonatal multiorgan failure due to ACAD9 mutation and complex I deficiency with mitochondrial hyperplasia in liver, cardiac myocytes, skeletal muscle, and renal tubules. (PMID:26826406)
• Study identified new mutations in ACAD9 responsible for a wide spectrum of heart diseases in the presence of elevated serum lactate levels. (PMID:27233227)
• Mutations in the ND6, NDUFV1 or ACAD9 genes are responsible for the mitochondrial complex I deficiency. (PMID:29348607)
• Immunodeficiency with susceptibility to lymphoma with complex genotype affecting energy metabolism (FBP1, ACAD9) and vesicle trafficking (RAB27A). (PMID:37388727)

Cross-species orthologs

11 orthologs

Organism	Symbol	Gene ID
danio_rerio	acad9	ENSDARG00000055620
mus_musculus	Acad9	ENSMUSG00000027710
rattus_norvegicus	Acad9	ENSRNOG00000014178
caenorhabditis_elegans	acox-1.1	WBGENE00008564
caenorhabditis_elegans	acox-1.2	WBGENE00008565
caenorhabditis_elegans	acox-1.3	WBGENE00008566
caenorhabditis_elegans	acox-1.4	WBGENE00008567
caenorhabditis_elegans		WBGENE00015894
caenorhabditis_elegans	acdh-1	WBGENE00016943
caenorhabditis_elegans		WBGENE00019406
caenorhabditis_elegans		WBGENE00020366

Paralogs (14): ACADVL (ENSG00000072778), ACOX3 (ENSG00000087008), GCDH (ENSG00000105607), ACAD10 (ENSG00000111271), ACADL (ENSG00000115361), ACADM (ENSG00000117054), ACADS (ENSG00000122971), IVD (ENSG00000128928), ACAD8 (ENSG00000151498), ACOXL (ENSG00000153093), ACOX1 (ENSG00000161533), ACOX2 (ENSG00000168306), ACADSB (ENSG00000196177), ACAD11 (ENSG00000240303)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1914272) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 13 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal heart morphology	1
muscle weakness	1
postnatal lethality	1
abnormal muscle morphology	1
thick ventricular wall	1
decreased cardiac muscle contractility	1
cardiomyopathy	1
abnormal mitochondrial physiology	1
centrally nucleated skeletal muscle fibers	1
prenatal lethality, complete penetrance	1
impaired exercise endurance	1
lactic acidosis	1
myocardial fiber disarray	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Escherichia coli APEC O1	A1A789	100.0%	Diamond
Escherichia coli O139:H28 str. E24377A	A7ZHD0	100.0%	Diamond
Escherichia coli HS	A7ZVY9	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7	A9MYJ9	100.0%	Diamond
Escherichia coli ATCC 8739	B1IRD7	100.0%	Diamond
Escherichia coli SMS-3-5	B1LFX2	100.0%	Diamond
Escherichia coli str. K-12 substr. DH10B	B1XBG4	100.0%	Diamond
Proteus mirabilis HI4320	B4EY23	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Newport str. SL254	B4T6J8	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Heidelberg str. SL476	B4TIH2	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633	B4TWR6	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601	B5BL57	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Agona str. SL483	B5F752	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853	B5FHG7	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Enteritidis str. P125109	B5R1R2	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91	B5RGA6	100.0%	Diamond
Escherichia coli O157:H7 str. EC4115	B5YYD3	100.0%	Diamond
Escherichia coli SE11	B6HYZ0	100.0%	Diamond
Escherichia coli 55989	B7L4G2	100.0%	Diamond
Escherichia fergusonii ATCC 35469	B7LWN0	100.0%	Diamond
Escherichia coli S88	B7MAG2	100.0%	Diamond
Escherichia coli ED1a	B7MNP6	100.0%	Diamond
Escherichia coli UMN026	B7N7R4	100.0%	Diamond
Escherichia coli IAI39	B7NHE3	100.0%	Diamond
Escherichia coli O127:H6 str. E2348/69	B7UI85	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594	C0Q4L5	100.0%	Diamond
Escherichia coli BW2952	C4ZPW5	100.0%	Diamond
Escherichia coli K-12	P0A9U8	100.0%	Diamond
Escherichia coli CFT073	P0A9U9	100.0%	Diamond
Escherichia coli O157:H7	P0A9V0	100.0%	Diamond
Shigella flexneri	P60587	100.0%	Diamond
Mycobacterium tuberculosis variant bovis AF2122/97	P63428	100.0%	Diamond
Mycobacterium tuberculosis CDC1551	P9WQF6	100.0%	Diamond
Mycobacterium tuberculosis H37Rv	P9WQF7	100.0%	Diamond
Escherichia coli UTI89	Q1RGF9	100.0%	Diamond
Shigella dysenteriae Sd197	Q32K58	100.0%	Diamond
Shigella sonnei Ss046	Q3Z5W9	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67	Q57TI8	100.0%	Diamond
Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150	Q5PIN6	100.0%	Diamond
Proteus sp. LE138	Q8GB20	100.0%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
GP9	protein-coding	2815
CFAP92	protein-coding	57501
EFCC1	protein-coding	79825
ACAD9-DT	ncRNA	123706524

Protein

Protein identifiers

Complex I assembly factor ACAD9, mitochondrial — Q9H845 (reviewed: Q9H845)

Alternative names: Acyl-CoA dehydrogenase family member 9

All UniProt accessions (15): A0A7P0T7Z1, A0A7P0T871, A0A7P0T8U3, A0A7P0T9N9, A0A7P0TB58, A0A7P0TB68, A0A7P0Z450, D6R9Z3, D6RCD8, D6RDK9, D6RGK6, D6RJA8, H0Y8Z9, Q9H845, Q9H9W4

UniProt curated annotations — full annotation on UniProt →

Function. Together with NDUFAF1 and ECSIT, forms part of the mitochondrial complex I (MCIA),which is required for the biogenesis of respiratory Complex I (CI) and is therefore crucial for the activation of the oxidative phosphorylation system. ECSIT binding triggers a large conformational change, switching ACAD9 from a fatty acid oxidation (FAO) enzyme to a CI assembly factor. The function in CI assembly is independent of the fatty acid oxidation (FAO) activity of the protein. As FAO enzyme, it catalyzes the first step in mitochondrial FAO, which consists in the proR-proR stereospecific alpha, beta-dehydrogenation of fatty acyl-CoA thioesters using the electron transfer flavoprotein (ETF) as their physiologic electron acceptor, resulting in the formation of trans-2-enoyl-CoA ((2E)-enoyl-CoA). Its preferred substrates are both saturated and unsaturated long-chain acyl-CoA substrates, with optimum activity toward the latter. In addition, based on its established catalytic mechanism, and combined genetic interaction or mutant phenotype evidence, it is predicted to act also on substrates that have not been tested experimentally but are metabolized by mitochondrial FAO, including long-chain unsaturated fatty acids such as linoleate (9Z,12Z-octadecadienoate), linolenate (9Z,12Z,15Z-octadecatrienoate), and others. Among the different mitochondrial acyl-CoA dehydrogenases, its FAO activity overlaps with that of ACADV and ACADL, but plays a primary role in tissues where it is the main long-chain ACAD expressed, such as the central nervous system. It differs significantly from ACADVL in the use of polyunsaturated substrates in vitro, especially docosahexaenoic acid (which is not primarily used for energy but mainly beta-oxidized in the peroxisomes).

Subunit / interactions. Homodimer. Interacts with NDUFAF1 and ECSIT. Part of the mitochondrial complex I assembly/MCIA complex that comprises at least the core subunits TMEM126B, NDUFAF1, ECSIT and ACAD9 and complement subunits such as COA1 and TMEM186. Interacts with TMEM70 and TMEM242.

Subcellular location. Mitochondrion inner membrane.

Tissue specificity. Ubiquitously expressed in most normal human tissues and cancer cell lines with higher levels in heart, skeletal muscles, and the central nervous system (where it is the highest expressed ACAD). Highly expressed (at protein level) in the cerebellum (Purkinje neurons, dentate nucleus, and in the granular layer), where ACADV is not found.

Disease relevance. Mitochondrial complex I deficiency, nuclear type 20 (MC1DN20) [MIM:611126] An autosomal recessive metabolic disorder associated with mitochondrial complex I deficiency, resulting in multisystemic and variable manifestations. Clinical features include infantile onset of acute metabolic acidosis, Reye-like episodes (brain edema and vomiting that may rapidly progress to seizures, coma and death), exercise intolerance, hypertrophic cardiomyopathy, liver failure, muscle weakness, and neurologic dysfunction. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the acyl-CoA dehydrogenase family.

RefSeq proteins (2): NP_001397734, NP_054768* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006089	Acyl-CoA_DH_CS	Conserved_site
IPR006091	AcylCoA_DH/ox_M	Domain
IPR009075	AcylCo_DH/oxidase_C	Domain
IPR009100	AcylCoA_DH/oxidase_NM_dom_sf	Homologous_superfamily
IPR013786	AcylCoA_DH/ox_N	Domain
IPR036250	AcylCo_DH-like_C	Homologous_superfamily
IPR037069	AcylCoA_DH/ox_N_sf	Homologous_superfamily
IPR046373	Acyl-CoA_Oxase/DH_mid-dom_sf	Homologous_superfamily
IPR049448	ACAD9/ACADV-like_C	Domain

Pfam: PF00441, PF02770, PF02771, PF21343

Catalyzed reactions (Rhea)

• a medium-chain 2,3-saturated fatty acyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = a medium-chain (2E)-enoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:14477)
• a long-chain 2,3-saturated fatty acyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = a long-chain (2E)-enoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:17721)
• oxidized [electron-transfer flavoprotein] + hexadecanoyl-CoA + H(+) = (2E)-hexadecenoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:43448)
• eicosanoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E)-eicosenoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47236)
• octadecanoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E)-octadecenoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47240)
• dodecanoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E)-dodecenoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47296)
• oxidized [electron-transfer flavoprotein] + (9Z)-octadecenoyl-CoA + H(+) = (2E,9Z)-octadecadienoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47300)
• (9Z)-hexadecenoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E,9Z)-hexadecadienoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47304)
• tetradecanoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E)-tetradecenoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47316)
• (7Z)-hexadecenoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E,7Z)-hexadecadienoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47432)
• (5Z)-tetradecenoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E,5Z)-tetradecadienoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:47448)
• decanoyl-CoA + oxidized [electron-transfer flavoprotein] + H(+) = (2E)-decenoyl-CoA + reduced [electron-transfer flavoprotein] (RHEA:48176)

UniProt features (77 total): helix 27, sequence variant 18, strand 16, turn 6, modified residue 5, transit peptide 1, chain 1, active site 1, mutagenesis site 1, sequence conflict 1

Structure

Experimental structures (PDB)

2 structures by resolution:

PDB	Title	Method	Resolution (Å)
8PHE	ACAD9-WT in complex with ECSIT-CTER	ELECTRON MICROSCOPY	3.1
8PHF	Cryo-EM structure of human ACAD9-S191A	ELECTRON MICROSCOPY	3.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9H845-F1	92.09	0.85

Human Protein Atlas

Protein class: Metabolic proteins, Predicted intracellular proteins, Disease related genes, Human disease related genes, Congenital disorders of metabolism, Congenital disorders of lipid/glycolipid metabolism

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): mitochondria

Antibody reliability (HPA): IH supported · IF enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
426	proton acceptor

Post-translational modifications (5)

Type	Positions
N6-acetyllysine	41, 521
N6-succinyllysine	92, 521
Phosphothreonine	478

Mutagenesis-validated functional residues (1)

Position	Phenotype
426	loss of long-chain-acyl-coa dehydrogenase activity. does not affect mitochondrial complex i assembly.

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 4; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

4 pathways:

ID	Pathway	Evidence
R-HSA-6799198	Complex I biogenesis	curated
R-HSA-1428517	Aerobic respiration and respiratory electron transport	—
R-HSA-1430728	Metabolism	—
R-HSA-611105	Respiratory electron transport	—

MSigDB gene sets: 225 (showing top): GOMF_OXIDOREDUCTASE_ACTIVITY_ACTING_ON_THE_CH_CH_GROUP_OF_DONORS, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GOBP_MITOCHONDRIAL_RESPIRATORY_CHAIN_COMPLEX_ASSEMBLY, DARWICHE_SKIN_TUMOR_PROMOTER_DN, DARWICHE_PAPILLOMA_RISK_LOW_UP, DARWICHE_PAPILLOMA_RISK_HIGH_DN, GOBP_LONG_CHAIN_FATTY_ACID_METABOLIC_PROCESS, DARWICHE_SQUAMOUS_CELL_CARCINOMA_DN, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS, MCBRYAN_PUBERTAL_BREAST_4_5WK_DN, SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM4, GOCC_MITOCHONDRIAL_ENVELOPE, GOBP_LIPID_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_METABOLIC_PROCESS, DOUGLAS_BMI1_TARGETS_DN

GO Biological Process (5): long-chain fatty acid metabolic process (GO:0001676), mitochondrial respiratory chain complex I assembly (GO:0032981), medium-chain fatty acid metabolic process (GO:0051791), fatty acid metabolic process (GO:0006631), carboxylic acid metabolic process (GO:0019752)

GO Molecular Function (9): acyl-CoA dehydrogenase activity (GO:0003995), long-chain fatty acyl-CoA dehydrogenase activity (GO:0004466), very-long-chain fatty acyl-CoA dehydrogenase activity (GO:0017099), protein-macromolecule adaptor activity (GO:0030674), flavin adenine dinucleotide binding (GO:0050660), medium-chain fatty acyl-CoA dehydrogenase activity (GO:0070991), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)

GO Cellular Component (6): nucleus (GO:0005634), mitochondrion (GO:0005739), mitochondrial inner membrane (GO:0005743), dendrite (GO:0030425), mitochondrial membrane (GO:0031966), mitochondrial complex I intermediate assembly complex (GO:0160295)

Reactome top-level categories

3 top-level categories:

Category	Pathways
Respiratory electron transport	1
Metabolism	1
Aerobic respiration and respiratory electron transport	1

GO top-level categories

25 GO namespaces:

Category	Terms
acyl-CoA dehydrogenase activity	3
fatty acid metabolic process	2
intracellular membrane-bounded organelle	2
NADH dehydrogenase complex assembly	1
mitochondrial respiratory chain complex assembly	1
lipid metabolic process	1
monocarboxylic acid metabolic process	1
oxoacid metabolic process	1
oxidoreductase activity, acting on the CH-CH group of donors, with a flavin as acceptor	1
protein binding	1
molecular adaptor activity	1
nucleotide binding	1
anion binding	1
binding	1
catalytic activity	1
oxidoreductase activity	1
cytoplasm	1
organelle inner membrane	1
mitochondrial membrane	1
neuron projection	1
dendritic tree	1
mitochondrion	1
mitochondrial envelope	1
organelle membrane	1
inner mitochondrial membrane protein complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 13 of 20 annotations. The rest are phylogenetic / computational / electronic (IEA).

13 experimentally-supported GO terms:

GO term	NS	Evidence
long-chain fatty acid metabolic process	BP	direct assay
medium-chain fatty acid metabolic process	BP	direct assay
mitochondrial respiratory chain complex I assembly	BP	mutant phenotype
dendrite	CC	direct assay
mitochondrial complex I intermediate assembly complex	CC	direct assay
mitochondrial membrane	CC	direct assay
mitochondrion	CC	direct assay
nucleus	CC	direct assay
acyl-CoA dehydrogenase activity	MF	direct assay
long-chain fatty acyl-CoA dehydrogenase activity	MF	direct assay
medium-chain fatty acyl-CoA dehydrogenase activity	MF	direct assay
protein-macromolecule adaptor activity	MF	direct assay
very-long-chain fatty acyl-CoA dehydrogenase activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 2,286 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ACAD9	HADHA	P40939	869
ACAD9	TMEM126B	Q8IUX1	797
ACAD9	NDUFAF1	Q9Y375	774
ACAD9	ECSIT	Q9BQ95	692
ACAD9	TMEM186	Q96B77	663
ACAD9	FOXRED1	Q96CU9	657
ACAD9	NDUFV1	P49821	641
ACAD9	NUBPL	Q8TB37	618
ACAD9	TMEM70	Q9BUB7	602
ACAD9	NDUFA10	O95299	598
ACAD9	NDUFAF6	Q330K2	597
ACAD9	ETFDH	Q16134	596
ACAD9	COA1	Q9GZY4	596
ACAD9	ACAA2	P42765	591
ACAD9	TIMMDC1	Q9NPL8	583

IntAct

Human interaction partners of ACAD9 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

5 partners by confidence:

Partner	Interaction type	MIscore	Records
PPL	association	0.530	1
A2ML1	association	0.350	1
ATP5PD	association	0.350	1
NDUFS2	association	0.350	1
RFX3	physical association	0.000	1

BioGRID (578 interactions; top human partners by supporting records): NDUFAF1 (Affinity Capture-MS; 9 records), ECSIT (Affinity Capture-MS; 8 records), NDUFS3 (Affinity Capture-MS; 6 records), TIMMDC1 (Affinity Capture-MS; 6 records), DBT (Affinity Capture-MS; 4 records), FAF2 (Affinity Capture-MS; 4 records), NDUFA13 (Affinity Capture-MS; 4 records), NDUFS7 (Affinity Capture-MS; 4 records), PDK1 (Affinity Capture-MS; 4 records), CLPP (Proximity Label-MS; 3 records), COA1 (Affinity Capture-MS; 3 records), CS (Proximity Label-MS; 3 records), EYA2 (Affinity Capture-MS; 3 records), MTRF1L (Affinity Capture-MS; 3 records), NDUFAF3 (Affinity Capture-MS; 3 records)

Disease & clinical

Genetic variants

Variant evidence for ACAD9: 1,196 ClinVar records (153 pathogenic / likely pathogenic); 2 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

1,196 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	51
Likely pathogenic	102
Uncertain significance	264
Likely benign	577
Benign	67

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 153 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
1075114	NM_014049.5(ACAD9):c.253C>T (p.Arg85Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	3
1456248	NM_014049.5(ACAD9):c.187G>T (p.Glu63Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	3
948204	NM_014049.5(ACAD9):c.1173G>A (p.Trp391Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
2065147	NM_014049.5(ACAD9):c.744_747del (p.Arg249fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
631903	NM_014049.5(ACAD9):c.453+2T>A	Likely pathogenic	criteria provided, multiple submitters, no conflicts	4
1479693	NM_014049.5(ACAD9):c.1674_1692+34del	Likely pathogenic	criteria provided, multiple submitters, no conflicts	4
372569	NM_014049.5(ACAD9):c.514G>A (p.Gly172Arg)	Likely pathogenic	criteria provided, multiple submitters, no conflicts	3
1345064	NM_014049.5(ACAD9):c.1278+1G>T	Likely pathogenic	criteria provided, multiple submitters, no conflicts	3
1473184	NM_014049.5(ACAD9):c.1358+2T>G	Likely pathogenic	criteria provided, multiple submitters, no conflicts	3
2090521	NM_014049.5(ACAD9):c.453+1G>A	Likely pathogenic	criteria provided, multiple submitters, no conflicts	3
2679699	NM_014049.5(ACAD9):c.1752_1753del (p.Gln585fs)	Likely pathogenic	criteria provided, multiple submitters, no conflicts	3
952504	NM_014049.5(ACAD9):c.1359-45_1383del	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2
1067512	NM_014049.5(ACAD9):c.882+1G>A	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2
1469383	NM_014049.5(ACAD9):c.1150-2A>G	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2
1722425	NM_014049.5(ACAD9):c.634-1G>A	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2

Per-variant reference — Sugi Variant

Explore ACAD9’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 35 predictions of 1,887):

Position(s)	Effect	Δscore	Sites
3:128893549–128893550	acceptor_gain	1.0000	2
3:128893553–128893554	acceptor_loss	1.0000	5
3:128893657–128893658	donor_loss	1.0000	5
3:128896434–128896435	acceptor_loss	1.0000	5
3:128896537–128896538	donor_loss	1.0000	5
3:128897711	donor_loss	1.0000	2
3:128899285–128899286	acceptor_loss	1.0000	2
3:128899462–128899463	donor_loss	1.0000	5
3:128901266	acceptor_gain	1.0000
3:128901274–128901275	acceptor_loss	1.0000	3

AlphaMissense

1,170 missense substitutions predicted likely pathogenic (of 4,077 scored), across 354 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D418	8	0.964	0.994
H145	8	0.939	0.989
D88	8	0.909	0.967
D135	8	0.905	0.964
F226	8	0.898	0.977
F425	8	0.889	0.986
F245	8	0.820	0.983
D368	8	0.763	0.900
F178	7	0.968	0.994
F332	7	0.968	0.994
E182	7	0.964	0.984
W213	7	0.954	0.993
N216	7	0.952	0.996
K211	7	0.946	0.995
D188	7	0.927	0.955
R329	7	0.919	0.985
F293	7	0.916	0.969
F56	7	0.904	0.979
F107	7	0.904	0.944
K383	7	0.904	0.981

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	8.34e-07

Disease associations

OMIM: gene MIM:611103 | disease phenotypes: MIM:611126

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
acyl-CoA dehydrogenase 9 deficiency	Definitive	Autosomal recessive	6

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

1 validity classifications:

Disease	Classification	Inheritance
acyl-CoA dehydrogenase 9 deficiency	Definitive	AR

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (16 panels, 16 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

16 panels:

Panel	Rating
Acute rhabdomyolysis	green
DDG2P	green
Fetal anomalies	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Likely inborn error of metabolism	green
Mitochondrial disorder with complex I deficiency	green
Mitochondrial disorders	green
Other rare neuromuscular disorders	green
Paediatric disorders	green
Paediatric or syndromic cardiomyopathy	green
Possible mitochondrial disorder, nuclear genes	green
Rhabdomyolysis and metabolic muscle disorders	green
Undiagnosed metabolic disorders	green
Unexplained death in infancy and sudden unexplained death in childhood	green

Mondo (3): acyl-CoA dehydrogenase 9 deficiency (MONDO:0012624), mitochondrial complex I deficiency (MONDO:0100133), hypertrophic cardiomyopathy (MONDO:0005045)

Orphanet (3): Acyl-CoA dehydrogenase 9 deficiency (Orphanet:99901), Isolated complex I deficiency (Orphanet:2609), Rare hypertrophic cardiomyopathy (Orphanet:217569)

HPO phenotypes

40 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0001252	Hypotonia
HP:0001290	Generalized hypotonia
HP:0001297	Stroke
HP:0001298	Encephalopathy
HP:0001324	Muscle weakness
HP:0001397	Hepatic steatosis
HP:0001399	Hepatic failure
HP:0001414	Microvesicular hepatic steatosis
HP:0001508	Failure to thrive
HP:0001522	Death in infancy
HP:0001635	Congestive heart failure
HP:0001639	Hypertrophic cardiomyopathy
HP:0001644	Dilated cardiomyopathy
HP:0001645	Sudden cardiac death
HP:0001873	Thrombocytopenia
HP:0001943	Hypoglycemia
HP:0001958	Nonketotic hypoglycemia
HP:0001987	Hyperammonemia
HP:0002151	Increased circulating lactate concentration
HP:0002181	Cerebral edema
HP:0002910	Elevated circulating hepatic transaminase concentration
HP:0003128	Lactic acidosis
HP:0003198	Myopathy
HP:0003215	Elevated urinary dicarboxylic acid level
HP:0003234	Decreased circulating carnitine concentration
HP:0003324	Generalized muscle weakness
HP:0003326	Myalgia
HP:0003458	EMG: myopathic abnormalities
HP:0003473	Fatigable weakness
HP:0003546	Exercise intolerance
HP:0003577	Congenital onset
HP:0003819	Death in childhood
HP:0006554	Acute hepatic failure
HP:0008151	Prolonged prothrombin time
HP:0008331	Elevated creatine kinase after exercise
HP:0011695	Cerebellar hemorrhage
HP:0011923	Decreased activity of mitochondrial complex I
HP:0025435	Increased circulating lactate dehydrogenase concentration
HP:0045045	Elevated circulating fatty acylcarnitine concentration

GWAS associations

2 associations:

Study	Trait	p-value
GCST007989_6	Facial morphology traits (63 three-dimensional facial segments)	1e-17
GCST001713_27	Dental caries	6e-6

MeSH disease descriptors

3 disease descriptors:

Descriptor	Name	Tree numbers
D002312	Cardiomyopathy, Hypertrophic	C14.280.238.100; C14.280.484.048.750.070.160
C567006	Acyl-CoA Dehydrogenase Family, Member 9, Deficiency of *(supp.)*
C537475	Mitochondrial complex I deficiency *(supp.)*

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6067161 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

61 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Arsenic	affects cotreatment, affects methylation, decreases expression, increases abundance	3
Valproic Acid	affects cotreatment, increases expression, decreases expression, decreases methylation	3
bisphenol F	increases expression, affects cotreatment, decreases expression	2
sodium arsenite	decreases expression, affects cotreatment, increases abundance	2
Smoke	decreases expression, increases abundance, increases expression	2
aristolochic acid I	decreases expression	1
GSK-J4	decreases expression	1
FR900359	increases phosphorylation	1
lasiocarpine	decreases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	affects cotreatment, decreases expression	1
sodium arsenate	decreases expression, increases abundance	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, affects localization, decreases expression	1
beta-lapachone	decreases expression	1
arsenite	decreases methylation	1
mono-(2-ethylhexyl)phthalate	increases abundance, increases methylation	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cobaltous chloride	decreases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
benzo(e)pyrene	decreases methylation	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	increases reaction, affects binding	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
bisphenol B	increases expression	1
bisphenol S	affects cotreatment, decreases methylation	1
LDN 193189	affects cotreatment, increases expression	1
NSC 689534	affects binding, decreases expression	1
bisphenol AF	increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5652865	Binding	Binding affinity to human ACAD9 incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — *ChemMedChem*

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B1IR	Abcam HeLa ACAD9 KO	Cancer cell line	Female
CVCL_C7ZC	HAP1 ACAD9 (-) 1	Cancer cell line	Male
CVCL_C7ZD	HAP1 ACAD9 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 234 trials:

NCT	Phase	Status	Title
NCT00879060	Phase 4	COMPLETED	Clinical and Therapeutic Implications of Fibrosis in Hypertrophic Cardiomyopathy
NCT01721967	Phase 4	COMPLETED	Ranolazine for the Treatment of Chest Pain in HCM Patients
NCT02948998	Phase 4	UNKNOWN	Evaluating the Effect of Spironolactone on Hypertrophic Cardiomyopathy
NCT03249272	Phase 4	TERMINATED	Microvascular Dysfunction in Nonischemic Cardiomyopathy: Insights From CMR Assessment of Coronary Flow Reserve
NCT04133532	Phase 4	COMPLETED	Effect of Metoprolol in Post Alcohol Septal Ablation Patients With Hypertrophic Cardiomyopathy
NCT06401343	Phase 4	UNKNOWN	Use of SGLT2i in noHCM With HFpEF
NCT07103655	Phase 4	ENROLLING_BY_INVITATION	The Therapeutic Value of Mavacamten in Hypertrophic Cardiomyopathy With Mid-to-Apical Left Ventricular Obstruction
NCT07600177	Phase 4	RECRUITING	Mavacamten to Aficamten Transition in Patients With Obstructive Hypertrophic Cardiomyopathy
NCT07807384	Phase 4	NOT_YET_RECRUITING	Efficacy and Safety of an LVEF-Guided Mavacamten Dose Up-Titration Strategy in Chinese Patients With Symptomatic Obstructive Hypertrophic Cardiomyopathy
NCT05162768	Phase 3	COMPLETED	Study to Evaluate Efficacy and Safety of Elamipretide in Subjects With Primary Mitochondrial Disease From Nuclear DNA Mutations (nPMD)
NCT00317967	Phase 3	COMPLETED	Study to Determine if Atorvastatin Reduces Size and Stiffness of Muscle in the Left Ventricle of the Heart
NCT00698074	Phase 3	UNKNOWN	Diastolic Ventricular Interaction and the Effects of Biventricular Pacing in Hypertrophic Cardiomyopathy
NCT00821353	Phase 3	COMPLETED	Antiarrhythmic Therapy Versus Catheter Ablation for Atrial Fibrillation in Hypertrophic Cardiomyopathy
NCT02431221	Phase 3	WITHDRAWN	Efficacy, Safety, and Tolerability of Perhexiline in Subjects With Hypertrophic Cardiomyopathy and Heart Failure
NCT03470545	Phase 3	COMPLETED	Clinical Study to Evaluate Mavacamten (MYK-461) in Adults With Symptomatic Obstructive Hypertrophic Cardiomyopathy
NCT05174416	Phase 3	COMPLETED	A Study to Evaluate the Efficacy and Safety of Mavacamten in Chinese Adults With Symptomatic Obstructive HCM
NCT05182658	Phase 3	ACTIVE_NOT_RECRUITING	Empagliflozin in Hypertrophic Cardiomyopathy
NCT05186818	Phase 3	COMPLETED	Phase 3 Trial to Evaluate the Efficacy and Safety of Aficamten Compared to Placebo in Adults With Symptomatic oHCM
NCT05767346	Phase 3	COMPLETED	Phase 3 Trial to Evaluate the Efficacy and Safety of Aficamten Compared to Metoprolol Succinate in Adults With Symptomatic oHCM
NCT06116968	Phase 3	COMPLETED	An Open-Label Study of Aficamten for Chinese Patients With Symptomatic oHCM
NCT06873828	Phase 3	NOT_YET_RECRUITING	Evaluation of the Efficacy and Safety of Wearable ECG (AT-Patch) in Patients With Hypertrophic Cardiomyopathy Requiring 48-Hour Holter MonitoringEvaluation of the Efficacy and Safety of Wearable ECG (AT-Patch) in Patients With Hypertrophic Cardiomyopathy Requiring 48-Hour Holter Monitoring
NCT07021976	Phase 3	ACTIVE_NOT_RECRUITING	A Phase III Trial of HRS-1893 in Patients With Obstructive Hypertrophic Cardiomyopathy
NCT07023341	Phase 3	ACTIVE_NOT_RECRUITING	A Study to Learn More About How Well Aficamten Works in Japanese Participants With Symptomatic Obstructive Hypertrophic Cardiomyopathy
NCT07202897	Phase 3	RECRUITING	LA-HCM Study : Rivaroxaban for Antithrombotic Prevention in Hypertrophic Cardiomyopathy Patients With Abnormal Left Atrial Strain.
NCT00001631	Phase 2	COMPLETED	Study of Blood Flow in Heart Muscle
NCT00001894	Phase 2	COMPLETED	A Comparison of Two Treatments: Pacemaker and Percutaneous Transluminal Septal Ablation for Hypertrophic Cardiomyopathy
NCT00001960	Phase 2	COMPLETED	Studying the Effectiveness of Pacemaker Therapy in Children Who Have Thickened Heart Muscle
NCT00011076	Phase 2	COMPLETED	Pirfenidone to Treat Hypertrophic Cardiomyopathy
NCT00035386	Phase 2	COMPLETED	Alcohol Septal Ablation in Obstructive Hypertrophic Cardiomyopathy: A Pilot Study
NCT00430833	Phase 2	UNKNOWN	CHANCE - Candesartan in Hypertrophic Cardiomyopathy
NCT00500552	Phase 2	COMPLETED	Perhexiline Therapy in Patients With Hypertrophic Cardiomyopathy
NCT01150461	Phase 2	COMPLETED	Effect of Losartan in Patients With Nonobstructive Hypertrophic Cardiomyopathy
NCT01230918	Phase 2	TERMINATED	Study to Develop a Non-invasive Marker for Monitoring Myocardial Fibrosis
NCT01447654	Phase 2	COMPLETED	Inhibition of the Renin Angiotensin System With Losartan in Patients With Hypertrophic Cardiomyopathy
NCT01696370	Phase 2	UNKNOWN	Trimetazidine Therapy in Hypertrophic Cardiomyopathy
NCT01912534	Phase 2	COMPLETED	Valsartan for Attenuating Disease Evolution In Early Sarcomeric HCM
NCT02590809	Phase 2	COMPLETED	Hypertrophic Cardiomyopathy Symptom Release by BX1514M
NCT03496168	Phase 2	COMPLETED	Extension Study of Mavacamten (MYK-461) in Adults With Symptomatic Obstructive Hypertrophic Cardiomyopathy Previously Enrolled in PIONEER
NCT03532802	Phase 2	COMPLETED	The Effect of Metoprolol in Patients With Hypertrophic Obstructive Cardiomyopathy.
NCT03832660	Phase 2	COMPLETED	Sacubitril/Valsartan vs Lifestyle in Hypertrophic Cardiomyopathy
NCT04219826	Phase 2	COMPLETED	Dose-finding Study to Evaluate the Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of CK-3773274 in Adults With Hypertrophic Cardiomyopathy
NCT04426578	Phase 2	UNKNOWN	Role of Perhexiline in Hypertrophic Cardiomyopathy
NCT04706429	Phase 2	COMPLETED	The Efficacy and Mechanism of Trientine in Patients With Hypertrophic Cardiomyopathy
NCT06347159	Phase 2	ACTIVE_NOT_RECRUITING	A Study of EDG-7500 in Adults With Hypertrophic Cardiomyopathy (CIRRUS-HCM)
NCT06516068	Phase 2	ACTIVE_NOT_RECRUITING	A Trial of HRS-1893 in Patients With Obstructive Hypertrophic Cardiomyopathy
NCT07021963	Phase 2	RECRUITING	A Clinical Study to Evaluate the Long-term Safety of HRS-1893 in Hypertrophic Cardiomyopathy
NCT07367724	Phase 2	RECRUITING	Ademetionine in Obstructive Hypertrophic Cardiomyopathy
NCT07675668	Phase 2	NOT_YET_RECRUITING	Aom0304 in Adult Patients With Symptomatic Hypertrophic Cardiomyopathy
NCT00001396	Phase 1	COMPLETED	Natural History and Results of Dual Chamber (DDD) Pacemaker Therapy of Children With Obstructive Hypertrophic Cardiomyop…
NCT00504647	Phase 1	UNKNOWN	Biventricular Pacing in Hypertrophic Cardiomyopathy
NCT01537926	Phase 1	COMPLETED	Hypertrophic Regression With N-Acetylcysteine in HCM
NCT02329184	Phase 1	COMPLETED	Study Evaluating the Safety, Tolerability and Preliminary Pharmacokinetics and Pharmacodynamics of MYK-461
NCT04783766	Phase 1	COMPLETED	Safety, Tolerability and Pharmacokinetics Study of CK-3773274
NCT05135871	Phase 1	COMPLETED	Study Evaluating the Pharmacokinetics of Mavacamten in Healthy Adult Chinese Subjects
NCT05879523	Phase 1	COMPLETED	A Trial of HRS-1893 in Healthy Volunteers and Patients With Obstructive Hypertrophic Cardiomyopathy
NCT06210607	Phase 1	UNKNOWN	A Trial of HS-10511 in Healthy Subjects
NCT06354556	Phase 1	COMPLETED	Effect of Verapamil Tablets on the Pharmacokinetic of HRS-1893 Tablets in Healthy Subjects
NCT06775834	Phase 1	COMPLETED	Safety and Pharmacokinetics Study of HRS-1893 Tablets in Healthy Subjects and Those With Impaired Kidney Function
NCT00319982	Phase 2/3	COMPLETED	Treatment of Preclinical Hypertrophic Cardiomyopathy With Diltiazem
NCT02291237	Phase 2/3	TERMINATED	Effect of Eleclazine (GS-6615) on Exercise Capacity in Subjects With Symptomatic Hypertrophic Cardiomyopathy

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for ACAD9 across ~30M SureChEMBL compounds — explore on Sugi Predict.