ACSM1

Summary

ACSM1 (acyl-CoA synthetase medium chain family member 1, HGNC:18049) is a protein-coding gene on chromosome 16p12.3, encoding Acyl-coenzyme A synthetase ACSM1, mitochondrial (Q08AH1). Catalyzes the activation of fatty acids by CoA to produce an acyl-CoA, the first step in fatty acid metabolism.

Enables benzoate-CoA ligase activity; decanoate-CoA ligase activity; and long-chain fatty acid-CoA ligase activity. Predicted to be involved in acyl-CoA metabolic process and fatty acid biosynthetic process. Located in mitochondrial matrix.

Source: NCBI Gene 116285 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 114 total — 1 pathogenic
• MANE Select transcript: NM_001318890

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18049
Approved symbol	ACSM1
Name	acyl-CoA synthetase medium chain family member 1
Location	16p12.3
Locus type	gene with protein product
Status	Approved
Aliases	MACS1
Ensembl gene	ENSG00000166743
Ensembl biotype	protein_coding
OMIM	614357
Entrez	116285

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 8 protein_coding, 1 retained_intron, 1 nonsense_mediated_decay

ENST00000307493, ENST00000519031, ENST00000519745, ENST00000520010, ENST00000523065, ENST00000524149, ENST00000888161, ENST00000888162, ENST00000888163, ENST00000888164

RefSeq mRNA: 2 — MANE Select: NM_001318890 NM_001318890, NM_052956

CCDS: CCDS10587

Canonical transcript exons

ENST00000520010 — 14 exons

Exon	Start	End
ENSE00001142043	20636739	20636840
ENSE00001612923	20627189	20627316
ENSE00002104959	20690997	20691239
ENSE00002116995	20697636	20697680
ENSE00002121512	20623235	20623572
ENSE00003462188	20624096	20624215
ENSE00003551880	20671531	20671671
ENSE00003590800	20661794	20661873
ENSE00003592835	20637371	20637451
ENSE00003596094	20625423	20625522
ENSE00003600137	20685193	20685403
ENSE00003622389	20640461	20640584
ENSE00003670408	20682256	20682463
ENSE00003687044	20669827	20669986

Expression profiles

Bgee: expression breadth ubiquitous, 163 present calls, max score 80.88.

Top tissues by expression

291 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left ovary	UBERON:0002119	80.88	gold quality
right ovary	UBERON:0002118	79.35	gold quality
adrenal tissue	UBERON:0018303	77.38	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	76.75	silver quality
ovary	UBERON:0000992	74.92	gold quality
mucosa of stomach	UBERON:0001199	74.70	gold quality
left uterine tube	UBERON:0001303	73.11	gold quality
right testis	UBERON:0004534	72.16	gold quality
body of uterus	UBERON:0009853	71.99	gold quality
left testis	UBERON:0004533	71.51	gold quality
ectocervix	UBERON:0012249	70.44	gold quality
body of stomach	UBERON:0001161	70.18	gold quality
right lobe of liver	UBERON:0001114	69.18	gold quality
right uterine tube	UBERON:0001302	69.05	gold quality
testis	UBERON:0000473	69.03	gold quality
prostate gland	UBERON:0002367	68.67	gold quality
body of pancreas	UBERON:0001150	67.89	gold quality
islet of Langerhans	UBERON:0000006	66.48	gold quality
pancreas	UBERON:0001264	66.33	gold quality
endocervix	UBERON:0000458	66.18	gold quality
stomach	UBERON:0000945	66.05	gold quality
bone marrow cell	CL:0002092	65.36	silver quality
descending thoracic aorta	UBERON:0002345	65.12	gold quality
left coronary artery	UBERON:0001626	64.80	gold quality
right coronary artery	UBERON:0001625	64.79	gold quality
monocyte	CL:0000576	64.70	gold quality
mononuclear cell	CL:0000842	64.56	gold quality
leukocyte	CL:0000738	64.19	gold quality
coronary artery	UBERON:0001621	63.71	gold quality
minor salivary gland	UBERON:0001830	63.47	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-9801	yes	3.94
E-ANND-3	no	5.24

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

17 targeting ACSM1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-1296-3P	99.72	64.04	636
HSA-MIR-3175	99.65	66.30	2031
HSA-MIR-4744	99.01	69.91	1581
HSA-MIR-4774-3P	98.90	67.82	737
HSA-MIR-6501-3P	98.71	67.45	1480
HSA-MIR-16-1-3P	98.70	69.23	1538
HSA-MIR-4680-3P	98.64	68.60	2093
HSA-MIR-6847-5P	97.93	66.74	1808
HSA-MIR-6765-3P	97.83	64.59	1165
HSA-MIR-204-3P	97.80	66.84	1656
HSA-MIR-4646-5P	97.70	66.84	1692
HSA-MIR-144-5P	97.66	69.90	531
HSA-MIR-3152-5P	96.98	66.88	819
HSA-MIR-3677-5P	93.16	64.62	393

Literature-anchored findings (GeneRIF, showing 3)

• Single nucleotide polymorphisms(SNP) in exon 8 of A/G polymorphism of MACS1 gene and G/T SNP in intron 3 of SAH gene were associated with plasma levels of plasma HDL cholesterol. (PMID:15361761)
• Invasive apocrine carcinomas correspond to a distinct molecular subtype of breast carcinomas characterized by the expression of 15-prostaglandin dehydrogenase alone or in combination with a novel form of acyl-CoA synthetase medium-chain family member 1. (PMID:18632593)
• These data are the first to suggest a positive association of the ACSM1 gene with a genetic susceptibility for Schizophrenia and major depressive disorder in the Han Chinese population. (PMID:25656805)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	acss2l	ENSDARG00000069029
mus_musculus	Acsm1	ENSMUSG00000033533
rattus_norvegicus	Acsm1	ENSRNOG00000042084
caenorhabditis_elegans		WBGENE00009221
caenorhabditis_elegans		WBGENE00018488

Paralogs (13): ACSM3 (ENSG00000005187), ACSM2B (ENSG00000066813), AACS (ENSG00000081760), ACSS3 (ENSG00000111058), ACSS2 (ENSG00000131069), ACSS1 (ENSG00000154930), AASDH (ENSG00000157426), ACSF2 (ENSG00000167107), ACSM6 (ENSG00000173124), ACSF3 (ENSG00000176715), ACSM5 (ENSG00000183549), ACSM2A (ENSG00000183747), ACSM4 (ENSG00000215009)

Protein

Protein identifiers

Acyl-coenzyme A synthetase ACSM1, mitochondrial — Q08AH1 (reviewed: Q08AH1)

Alternative names: Acyl-CoA synthetase medium-chain family member 1, Benzoate–CoA ligase, Butyrate–CoA ligase 1, Butyryl-coenzyme A synthetase 1, Lipoate-activating enzyme, Middle-chain acyl-CoA synthetase 1, Xenobiotic/medium-chain fatty acid-CoA ligase HXM-B

All UniProt accessions (3): E5RFK0, Q08AH1, H0YAU5

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the activation of fatty acids by CoA to produce an acyl-CoA, the first step in fatty acid metabolism. Capable of activating medium-chain fatty acids (e.g. butyric (C4) to decanoic (C10) acids), and certain carboxylate-containing xenobiotics, e.g. benzoate. Also catalyzes the activation of lipoate to lipoyl-nucleoside monophosphate. Activates lipoate with GTP at a 1000-fold higher rate than with ATP and activates both (R)- and (S)-lipoate to the respective lipoyl-GMP, with a preference for (R)-lipoate.

Subunit / interactions. Monomer.

Subcellular location. Mitochondrion matrix. Mitochondrion.

Activity regulation. Activated by monovalent cations, such as potassium, rubidium or ammonium.

Similarity. Belongs to the ATP-dependent AMP-binding enzyme family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q08AH1-1	1	yes
Q08AH1-2	2

RefSeq proteins (2): NP_001305819, NP_443188 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000873	AMP-dep_synth/lig_dom	Domain
IPR020845	AMP-binding_CS	Conserved_site
IPR025110	AMP-bd_C	Domain
IPR042099	ANL_N_sf	Homologous_superfamily
IPR045851	AMP-b_sf	Homologous_superfamily
IPR051087	Mitochondrial_ACSM	Family

Pfam: PF00501, PF13193

Catalyzed reactions (Rhea), 10 shown:

• benzoate + ATP + CoA = benzoyl-CoA + AMP + diphosphate (RHEA:10132)
• hexadecanoate + ATP + CoA = hexadecanoyl-CoA + AMP + diphosphate (RHEA:30751)
• tetradecanoate + ATP + CoA = tetradecanoyl-CoA + AMP + diphosphate (RHEA:33619)
• dodecanoate + ATP + CoA = dodecanoyl-CoA + AMP + diphosphate (RHEA:33623)
• decanoate + ATP + CoA = decanoyl-CoA + AMP + diphosphate (RHEA:33627)
• octanoate + ATP + CoA = octanoyl-CoA + AMP + diphosphate (RHEA:33631)
• hexanoate + ATP + CoA = hexanoyl-CoA + AMP + diphosphate (RHEA:43740)
• butanoate + ATP + CoA = butanoyl-CoA + AMP + diphosphate (RHEA:46172)
• (R)-lipoate + GTP + H(+) = (R)-lipoyl-GMP + diphosphate (RHEA:46700)
• a medium-chain fatty acid + ATP + CoA = a medium-chain fatty acyl-CoA + AMP + diphosphate (RHEA:48340)

UniProt features (27 total): modified residue 16, binding site 4, sequence variant 3, transit peptide 1, chain 1, splice variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q08AH1-F1	88.80	0.76

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (4): 226–234; 452; 467; 563

Post-translational modifications (16): 204, 204, 214, 237, 356, 356, 391, 391, 531, 538, 538, 549, 85, 146, 146, 183

Function

Pathways and Gene Ontology

Reactome pathways

7 pathways

ID	Pathway
R-HSA-177135	Conjugation of benzoate with glycine
R-HSA-177162	Conjugation of phenylacetate with glutamine
R-HSA-1430728	Metabolism
R-HSA-156580	Phase II - Conjugation of compounds
R-HSA-156587	Amino Acid conjugation
R-HSA-159424	Conjugation of carboxylic acids
R-HSA-211859	Biological oxidations

MSigDB gene sets: 102 (showing top): GOBP_LIPID_MODIFICATION, REACTOME_BIOLOGICAL_OXIDATIONS, GOBP_STEROL_HOMEOSTASIS, BROWNE_HCMV_INFECTION_8HR_UP, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, GOBP_LONG_CHAIN_FATTY_ACID_METABOLIC_PROCESS, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_BIOSYNTHETIC_PROCESS, GOBP_NUCLEOBASE_CONTAINING_SMALL_MOLECULE_METABOLIC_PROCESS, GOBP_LIPID_HOMEOSTASIS, GOBP_GENERATION_OF_PRECURSOR_METABOLITES_AND_ENERGY, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, GOBP_SHORT_CHAIN_FATTY_ACID_METABOLIC_PROCESS, GOBP_AMIDE_METABOLIC_PROCESS, GOBP_FATTY_ACID_BIOSYNTHETIC_PROCESS

GO Biological Process (11): fatty acid biosynthetic process (GO:0006633), acyl-CoA metabolic process (GO:0006637), xenobiotic metabolic process (GO:0006805), energy derivation by oxidation of organic compounds (GO:0015980), benzoate metabolic process (GO:0018874), fatty acid oxidation (GO:0019395), butyrate metabolic process (GO:0019605), cholesterol homeostasis (GO:0042632), long-chain fatty acid metabolic process (GO:0001676), lipid metabolic process (GO:0006629), fatty acid metabolic process (GO:0006631)

GO Molecular Function (15): fatty-acyl-CoA synthase activity (GO:0004321), long-chain fatty acid-CoA ligase activity (GO:0004467), ATP binding (GO:0005524), GTP binding (GO:0005525), fatty acid ligase activity (GO:0015645), CoA-ligase activity (GO:0016405), benzoate-CoA ligase activity (GO:0018858), medium-chain fatty acid-CoA ligase activity (GO:0031956), metal ion binding (GO:0046872), decanoate-CoA ligase activity (GO:0102391), nucleotide binding (GO:0000166), protein binding (GO:0005515), ligase activity (GO:0016874), ligase activity, forming carbon-sulfur bonds (GO:0016877), acid-thiol ligase activity (GO:0016878)

GO Cellular Component (5): mitochondrion (GO:0005739), mitochondrial matrix (GO:0005759), extracellular exosome (GO:0070062), blood microparticle (GO:0072562), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
Conjugation of carboxylic acids	2
Biological oxidations	1
Phase II - Conjugation of compounds	1
Amino Acid conjugation	1
Metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
fatty acid metabolic process	3
monocarboxylic acid metabolic process	2
fatty acid-CoA ligase activity	2
purine ribonucleoside triphosphate binding	2
acid-thiol ligase activity	2
cellular anatomical structure	2
lipid biosynthetic process	1
monocarboxylic acid biosynthetic process	1
nucleoside phosphate metabolic process	1
sulfur compound metabolic process	1
purine-containing compound metabolic process	1
metabolic process	1
cellular response to xenobiotic stimulus	1
generation of precursor metabolites and energy	1
benzene-containing compound metabolic process	1
lipid oxidation	1
short-chain fatty acid metabolic process	1
sterol homeostasis	1
primary metabolic process	1
lipid metabolic process	1
acyltransferase activity, transferring groups other than amino-acyl groups	1
long-chain fatty acid metabolic process	1
adenyl ribonucleotide binding	1
guanyl ribonucleotide binding	1
ATP-dependent activity	1
CoA-ligase activity	1
cation binding	1
medium-chain fatty acid-CoA ligase activity	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
catalytic activity	1
ligase activity	1
ligase activity, forming carbon-sulfur bonds	1
cytoplasm	1
intracellular membrane-bounded organelle	1
mitochondrion	1
intracellular organelle lumen	1
extracellular vesicle	1
extracellular region	1

Protein interactions and networks

STRING

1766 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ACSM1	AASDH	Q4L235	525
ACSM1	RNF32	Q9H0A6	517
ACSM1	CACNG1	Q06432	506
ACSM1	CAPN9	O14815	453
ACSM1	LIPT1	Q9Y234	418
ACSM1	PDLIM3	Q53GG5	404
ACSM1	ALOX15	P16050	404
ACSM1	FABP7	O15540	367
ACSM1	FADS2	O95864	352
ACSM1	LMBR1	Q8WVP7	350
ACSM1	SUOX	P51687	342
ACSM1	LIAS	O43766	322
ACSM1	CBARP	Q8N350	315
ACSM1	POLDIP2	Q9Y2S7	311
ACSM1	CLRN3	Q8NCR9	309

IntAct

22 interactions, top by confidence:

A	B	Type	Score
GBP5	GBP1	psi-mi:“MI:0914”(association)	0.720
PRC1	ACSM1	psi-mi:“MI:0915”(physical association)	0.590
ACSM1	MTUS2	psi-mi:“MI:0915”(physical association)	0.560
ACSM1	OSBPL3	psi-mi:“MI:0915”(physical association)	0.560
MAGEA2	ACSM1	psi-mi:“MI:0915”(physical association)	0.560
ACSM1	CMTM5	psi-mi:“MI:0915”(physical association)	0.560
APBA3	DUSP11	psi-mi:“MI:0914”(association)	0.530
SLC22A16	APBA3	psi-mi:“MI:0914”(association)	0.530
SLC22A16	AGPAT2	psi-mi:“MI:0914”(association)	0.350
ACSM1	MTUS2	psi-mi:“MI:0915”(physical association)	0.000
ACSM1	OSBPL3	psi-mi:“MI:0915”(physical association)	0.000
ACSM1	MAGEA2	psi-mi:“MI:0915”(physical association)	0.000
ACSM1	CMTM5	psi-mi:“MI:0915”(physical association)	0.000
ACSM1		psi-mi:“MI:0915”(physical association)	0.000

BioGRID (14): ACSM1 (Affinity Capture-MS), ACSM1 (Affinity Capture-MS), ACSM1 (Affinity Capture-MS), ACSM1 (Affinity Capture-MS), ACSM1 (Two-hybrid), ACSM1 (Two-hybrid), ACSM1 (Two-hybrid), MAGEA2B (Two-hybrid), MAGEA2 (Two-hybrid), ACSM1 (Positive Genetic), ACSM1 (Affinity Capture-MS), ACSM1 (Affinity Capture-MS), ACSM1 (Affinity Capture-MS), ACSM1 (Affinity Capture-MS)

ESM2 similar proteins: A4IHY0, H9A1V3, M4IRL9, O70490, P0C7M7, P39062, Q08AH1, Q08AH3, Q0P4F7, Q17QJ1, Q3TMV7, Q3UNX5, Q3URE1, Q499N5, Q4G176, Q4R3Y4, Q4R4Z9, Q4R510, Q53FZ2, Q58DN7, Q5E9H9, Q5EA45, Q5I0K5, Q5R9G9, Q5RDY4, Q5REV5, Q5REX5, Q67Y55, Q68CK6, Q6AYT9, Q6GLK6, Q6P1M0, Q6P461, Q6PE15, Q6SKG1, Q7T0X7, Q7TN78, Q80W40, Q84P17, Q8K0L3

Diamond homologs: A0A0H2ZF83, A0A0H2ZGB9, A8NF97, A9W5V0, B7KPN8, G3J456, M4IQQ5, M4ISH2, O07899, O53521, O60011, P0C7M7, P10378, P38135, P39002, P40871, P71716, P80436, P86831, P86832, P9WEY3, P9WEZ0, Q01574, Q08AH1, Q08AH3, Q1IAK8, Q21LV0, Q2G512, Q2KHW5, Q53FZ2, Q5P603, Q5REV5, Q5SKN9, Q5ZKR7, Q68CK6, Q6SKG1, Q6ZAC1, Q7TYX8, Q7X279, Q84HC5

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

114 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	89
Likely benign	11
Benign	2

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
443422	GRCh37/hg19 16p12.3-11.2(chr16:18238275-30177240)x3	Pathogenic

SpliceAI

2071 predictions. Top by Δscore:

Variant	Effect	Δscore
16:20623571:ACCTG:A	acceptor_loss	1.0000
16:20623577:T:C	acceptor_gain	1.0000
16:20623577:T:TC	acceptor_gain	1.0000
16:20624092:TCACC:T	donor_loss	1.0000
16:20624094:ACC:A	donor_loss	1.0000
16:20624094:ACCTT:A	donor_gain	1.0000
16:20624095:C:CG	donor_loss	1.0000
16:20624095:CCTT:C	donor_gain	1.0000
16:20624095:CCTTC:C	donor_gain	1.0000
16:20624098:T:A	donor_gain	1.0000
16:20624217:T:A	acceptor_loss	1.0000
16:20627313:CACC:C	acceptor_gain	1.0000
16:20627315:CC:C	acceptor_gain	1.0000
16:20627316:CC:C	acceptor_gain	1.0000
16:20627316:CCT:C	acceptor_loss	1.0000
16:20627317:C:A	acceptor_loss	1.0000
16:20627317:C:CC	acceptor_gain	1.0000
16:20627318:T:C	acceptor_loss	1.0000
16:20661874:C:CC	acceptor_gain	1.0000
16:20682254:A:AC	donor_gain	1.0000
16:20682255:C:CC	donor_gain	1.0000
16:20682259:A:C	donor_gain	1.0000
16:20623569:CCAC:C	acceptor_gain	0.9900
16:20623570:CAC:C	acceptor_gain	0.9900
16:20623570:CACC:C	acceptor_gain	0.9900
16:20623573:C:CC	acceptor_gain	0.9900
16:20623574:T:A	acceptor_loss	0.9900
16:20623576:G:GC	acceptor_gain	0.9900
16:20623583:A:AC	acceptor_gain	0.9900
16:20623583:A:C	acceptor_gain	0.9900

AlphaMissense

3766 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:20627275:G:C	F447L	0.987
16:20627275:G:T	F447L	0.987
16:20627277:A:G	F447L	0.987
16:20669892:A:G	W283R	0.987
16:20669892:A:T	W283R	0.987
16:20640514:A:G	W355R	0.983
16:20640514:A:T	W355R	0.983
16:20627262:C:G	D452H	0.981
16:20623564:A:C	F552L	0.980
16:20623564:A:T	F552L	0.980
16:20623566:A:G	F552L	0.980
16:20624201:A:C	F514L	0.980
16:20624201:A:T	F514L	0.980
16:20624203:A:G	F514L	0.980
16:20627216:C:A	R467M	0.980
16:20624103:G:T	P547Q	0.979
16:20627261:T:G	D452A	0.979
16:20627215:C:A	R467S	0.976
16:20627215:C:G	R467S	0.976
16:20627255:C:T	G454D	0.976
16:20671602:A:C	S227R	0.976
16:20671602:A:T	S227R	0.976
16:20671604:T:G	S227R	0.976
16:20627216:C:G	R467T	0.975
16:20636788:C:T	G417D	0.975
16:20685332:G:C	F88L	0.975
16:20685332:G:T	F88L	0.975
16:20685334:A:G	F88L	0.975
16:20624145:A:G	L533P	0.974
16:20624206:C:G	A513P	0.974

dbSNP variants (sampled 300 via entrez): RS1000038699 (16:20655248 T>C,G), RS1000038876 (16:20672940 AAC>A), RS1000044672 (16:20658403 C>G), RS1000077365 (16:20658208 A>G), RS1000187317 (16:20680262 C>A,G), RS1000188687 (16:20633901 G>T), RS1000218431 (16:20631986 ACTACTAAAATAAAAAAATTAAAAGGGCACTAACACCATT>A), RS1000255509 (16:20631277 A>G), RS1000335271 (16:20661536 T>C), RS1000343847 (16:20668257 G>A), RS1000367747 (16:20664864 A>T), RS1000371737 (16:20672320 C>A,T), RS1000451650 (16:20632953 A>C), RS1000522490 (16:20680425 A>G), RS1000568366 (16:20629670 C>A,G)

Disease associations

OMIM: gene MIM:614357 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): breast ductal adenocarcinoma (MONDO:0005590)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST000164_3	Schizophrenia	6.000000e-06
GCST000607_1	Schizophrenia	3.000000e-06
GCST004639_15	Prudent dietary pattern	3.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008111	diet measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D018270	Carcinoma, Ductal, Breast	C04.557.470.200.025.232.500; C04.557.470.615.132.500; C04.588.180.390; C17.800.090.500.390

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

11 total (human), top 11 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	increases methylation, decreases expression	2
Aflatoxin B1	decreases expression, increases methylation	2
dicrotophos	decreases expression	1
benazol P	affects expression	1
S-(1,2-dichlorovinyl)cysteine	increases expression	1
enzalutamide	decreases expression	1
Arsenicals	decreases expression	1
Lead	decreases expression	1
Dihydrotestosterone	increases expression	1
Valproic Acid	decreases expression	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

11 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT03414970	PHASE3	ACTIVE_NOT_RECRUITING	Hypofractionated Radiation Therapy After Mastectomy in Preventing Recurrence in Patients With Stage IIa-IIIa Breast Cancer
NCT00461344	PHASE2	TERMINATED	Docetaxel + Doxorubicin as Neoadjuvant Chemotherapy in Patients With Breast Cancer
NCT07499999	PHASE2	NOT_YET_RECRUITING	Randomized Double-Blind Phase II Trial of Baby Exemestane Versus Baby Tamoxifen in Post-Menopausal Women at High Risk for Breast Cancer
NCT00637364	PHASE1/PHASE2	SUSPENDED	High Intensity Focused Ultrasound Tumor Treatment for Pancreatic Cancer Pain
NCT02779855	PHASE1/PHASE2	COMPLETED	Talimogene Laherparepvec in Combination With Neoadjuvant Chemotherapy in Triple Negative Breast Cancer
NCT01753908	EARLY_PHASE1	COMPLETED	Broccoli Sprout Extract in Treating Patients With Breast Cancer
NCT01796041	EARLY_PHASE1	COMPLETED	Intraoperative Imaging of Breast Cancer With Indocyanine Green
NCT01208974	Not specified	ACTIVE_NOT_RECRUITING	Nipple-Areola Complex (NAC) Irradiation After Nipple-Sparing Mastectomy and Reconstruction
NCT01875198	Not specified	TERMINATED	Oncologic Impact of Splenectomy-omitting Radical Pancreatectomy in Well-selected Left-sided Pancreatic Cancer
NCT03543397	Not specified	UNKNOWN	MRI in Ductal Carcinoma in Situ (DCIS)
NCT03834532	Not specified	COMPLETED	Living Well After Breast Surgery