ACTR6

Summary

ACTR6 (actin related protein 6, HGNC:24025) is a protein-coding gene on chromosome 12q23.1, encoding Actin-related protein 6 (Q9GZN1). Required for formation and/or maintenance of proper nucleolar structure and function. It is a selective cancer dependency (DepMap: 77.6% of cell lines).

Predicted to enable nucleosome binding activity. Involved in nucleolus organization. Located in nucleolus.

Source: NCBI Gene 64431 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 52 total — 1 pathogenic, 2 likely-pathogenic
• Cancer dependency (DepMap): dependent in 77.6% of screened cell lines
• MANE Select transcript: NM_022496

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24025
Approved symbol	ACTR6
Name	actin related protein 6
Location	12q23.1
Locus type	gene with protein product
Status	Approved
Aliases	ARP6, FLJ13433
Ensembl gene	ENSG00000075089
Ensembl biotype	protein_coding
OMIM	619729
Entrez	64431

Gene structure

Transcript identifiers

Ensembl transcripts: 22 — 14 protein_coding, 4 nonsense_mediated_decay, 3 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000188312, ENST00000546902, ENST00000547458, ENST00000548180, ENST00000549977, ENST00000550813, ENST00000551440, ENST00000551517, ENST00000551617, ENST00000551652, ENST00000552064, ENST00000552376, ENST00000553038, ENST00000899395, ENST00000899396, ENST00000899397, ENST00000899398, ENST00000899399, ENST00000899400, ENST00000926808, ENST00000926809, ENST00000926810

RefSeq mRNA: 1 — MANE Select: NM_022496 NM_022496

CCDS: CCDS9074

Canonical transcript exons

ENST00000188312 — 11 exons

Exon	Start	End
ENSE00001155372	100200815	100200919
ENSE00002419156	100223786	100224424
ENSE00003561595	100210295	100210351
ENSE00003569491	100212256	100212354
ENSE00003581214	100205676	100205744
ENSE00003591446	100218415	100218586
ENSE00003596784	100210073	100210208
ENSE00003603810	100220008	100220146
ENSE00003624458	100204940	100205057
ENSE00003689929	100212450	100212528
ENSE00003691303	100207663	100207786

Expression profiles

Bgee: expression breadth ubiquitous, 282 present calls, max score 93.71.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 13.8537 / max 315.7795, expressed in 1750 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
127560	13.8170	1750
127561	0.0368	19

Top tissues by expression

289 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ganglionic eminence	UBERON:0004023	93.71	gold quality
cortical plate	UBERON:0005343	93.58	gold quality
ventricular zone	UBERON:0003053	93.03	gold quality
buccal mucosa cell	CL:0002336	92.87	gold quality
Brodmann (1909) area 23	UBERON:0013554	92.39	gold quality
palpebral conjunctiva	UBERON:0001812	92.30	gold quality
choroid plexus epithelium	UBERON:0003911	91.94	gold quality
Brodmann (1909) area 9	UBERON:0013540	91.67	gold quality
bronchial epithelial cell	CL:0002328	91.63	gold quality
prefrontal cortex	UBERON:0000451	91.16	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	91.04	gold quality
monocyte	CL:0000576	90.78	gold quality
jejunal mucosa	UBERON:0000399	90.69	gold quality
calcaneal tendon	UBERON:0003701	90.69	gold quality
mononuclear cell	CL:0000842	90.65	gold quality
substantia nigra pars compacta	UBERON:0001965	90.41	gold quality
leukocyte	CL:0000738	90.38	gold quality
mucosa of paranasal sinus	UBERON:0005030	90.37	gold quality
primary visual cortex	UBERON:0002436	90.34	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	90.12	gold quality
anterior cingulate cortex	UBERON:0009835	90.05	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	89.96	gold quality
cingulate cortex	UBERON:0003027	89.89	gold quality
hypothalamus	UBERON:0001898	89.71	gold quality
neocortex	UBERON:0001950	89.56	gold quality
pigmented layer of retina	UBERON:0001782	89.55	gold quality
embryo	UBERON:0000922	89.52	gold quality
lateral nuclear group of thalamus	UBERON:0002736	89.52	gold quality
cerebral cortex	UBERON:0000956	89.48	gold quality
germinal epithelium of ovary	UBERON:0001304	89.43	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.98
E-MTAB-6142	no	180.41

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): EHMT2, GATA3, MTA3

miRNA regulators (miRDB)

46 targeting ACTR6, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-4682	100.00	68.89	1258
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-568	99.98	69.86	2084
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-5582-3P	99.86	72.48	4221
HSA-MIR-548AR-3P	99.85	71.26	3889
HSA-MIR-548AZ-3P	99.82	70.56	3549
HSA-MIR-548BC	99.82	70.61	3524
HSA-MIR-548E-3P	99.82	70.59	3514
HSA-MIR-548F-3P	99.82	70.59	3540
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248
HSA-MIR-548A-3P	99.76	70.58	3524
HSA-MIR-548M	99.70	68.87	1749
HSA-MIR-466	99.67	70.85	2863
HSA-MIR-4261	99.59	70.30	3415
HSA-MIR-510-3P	99.54	70.06	2965
HSA-MIR-6832-3P	99.52	70.44	1726
HSA-MIR-548G-3P	99.48	68.67	2159
HSA-MIR-582-5P	99.47	70.79	2635

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 77.6% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 2)

• Results describe the predominant nuclear localization of another Arp subfamily, Arp6, in vertebrate cells, and show its colocalization with heterochromatin protein 1 orthologs in pericentric heterochromatin. (PMID:16487625)
• under starvation, ARP6 was required for cell survival through the repression of rDNA transcription independently of H2A.Z (PMID:26164235)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	actr6	ENSDARG00000021370
mus_musculus	Actr6	ENSMUSG00000019948
rattus_norvegicus	Actr6	ENSRNOG00000007875
drosophila_melanogaster	Arp6	FBGN0011741
caenorhabditis_elegans		WBGENE00007434

Paralogs (26): ACTB (ENSG00000075624), ACTL6B (ENSG00000077080), ACTR5 (ENSG00000101442), ACTR3C (ENSG00000106526), ACTA2 (ENSG00000107796), ACTR8 (ENSG00000113812), ACTR1B (ENSG00000115073), ACTR3 (ENSG00000115091), ACTL8 (ENSG00000117148), ACTRT1 (ENSG00000123165), ACTR10 (ENSG00000131966), ACTR3B (ENSG00000133627), ACTL6A (ENSG00000136518), ACTR2 (ENSG00000138071), ACTR1A (ENSG00000138107), ACTA1 (ENSG00000143632), ACTL7B (ENSG00000148156), ACTC1 (ENSG00000159251), ACTG2 (ENSG00000163017), ACTBL2 (ENSG00000169067), ACTRT2 (ENSG00000169717), ACTL9 (ENSG00000181786), ACTG1 (ENSG00000184009), ACTRT3 (ENSG00000184378), ACTL7A (ENSG00000187003), ACTL10 (ENSG00000288649)

Protein

Protein identifiers

Actin-related protein 6 — Q9GZN1 (reviewed: Q9GZN1)

Alternative names: hARPX

All UniProt accessions (8): Q9GZN1, F8VP72, F8VRL1, F8VSD1, F8W043, F8W057, F8W0Q1, G3V1Y1

UniProt curated annotations — full annotation on UniProt →

Function. Required for formation and/or maintenance of proper nucleolar structure and function. Plays a dual role in the regulation of ribosomal DNA (rDNA) transcription. In the presence of high glucose, maintains active rDNA transcription through H2A.Z deposition and under glucose starvation, is required for the repression of rDNA transcription, and this function may be independent of H2A.Z.

Subunit / interactions. Component of the chromatin-remodeling SRCAP complex composed of at least SRCAP, DMAP1, RUVBL1, RUVBL2, ACTL6A, YEATS4, ACTR6 and ZNHIT1. Interacts with CBX1, CBX3 and CBX5.

Subcellular location. Cytoplasm. Cytoskeleton. Nucleus. Nucleolus.

Similarity. Belongs to the actin family. ARP6 subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9GZN1-1	1	yes
Q9GZN1-2	2

RefSeq proteins (1): NP_071941* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004000	Actin	Family
IPR043129	ATPase_NBD	Homologous_superfamily

Pfam: PF00022

UniProt features (9 total): sequence conflict 3, modified residue 2, splice variant 2, initiator methionine 1, chain 1

Structure

Experimental structures (PDB)

9 structures.

PDB	Method	Resolution (Å)
8X15	ELECTRON MICROSCOPY	3.2
8X19	ELECTRON MICROSCOPY	3.2
8X1C	ELECTRON MICROSCOPY	3.2
9CA7	ELECTRON MICROSCOPY	3.35
9CA9	ELECTRON MICROSCOPY	3.56
9CA8	ELECTRON MICROSCOPY	3.92
9CAB	ELECTRON MICROSCOPY	3.94
6IGM	ELECTRON MICROSCOPY	4
9CAA	ELECTRON MICROSCOPY	4.04

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9GZN1-F1	94.37	0.87

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 2, 260

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 139 (showing top): MODULE_255, CHIANG_LIVER_CANCER_SUBCLASS_UNANNOTATED_DN, MODULE_317, PATIL_LIVER_CANCER, MODULE_331, MILI_PSEUDOPODIA_HAPTOTAXIS_UP, GOBP_NUCLEUS_ORGANIZATION, ZHANG_BREAST_CANCER_PROGENITORS_UP, ACEVEDO_LIVER_CANCER_UP, GOBP_CHROMATIN_REMODELING, MODULE_207, OSMAN_BLADDER_CANCER_DN, GOCC_INO80_TYPE_COMPLEX, GOMF_CHROMATIN_BINDING, MOREAUX_MULTIPLE_MYELOMA_BY_TACI_DN

GO Biological Process (5): chromatin remodeling (GO:0006338), regulation of DNA-templated transcription (GO:0006355), nucleolus organization (GO:0007000), negative regulation of transcription by RNA polymerase I (GO:0016479), positive regulation of transcription by RNA polymerase I (GO:0045943)

GO Molecular Function (2): nucleosome binding (GO:0031491), protein binding (GO:0005515)

GO Cellular Component (6): nucleosome (GO:0000786), Swr1 complex (GO:0000812), nucleus (GO:0005634), nucleolus (GO:0005730), cytoskeleton (GO:0005856), cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of transcription by RNA polymerase I	2
transcription by RNA polymerase I	2
intracellular membraneless organelle	2
chromatin organization	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
nucleus organization	1
negative regulation of DNA-templated transcription	1
positive regulation of DNA-templated transcription	1
chromatin binding	1
protein-containing complex binding	1
binding	1
chromatin	1
protein-DNA complex	1
histone deacetylase complex	1
nuclear chromosome	1
INO80-type complex	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
cellular anatomical structure	1

Protein interactions and networks

STRING

1660 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ACTR6	H2AZ1	P0C0S5	620
ACTR6	DMAP1	Q9NPF5	524
ACTR6	KLHL38	Q2WGJ6	494
ACTR6	NEURL1B	A8MQ27	486
ACTR6	ZNHIT1	O43257	463
ACTR6	CAPZA3	Q96KX2	461
ACTR6	DEPDC4	Q8N2C3	458
ACTR6	HIPK4	Q8NE63	455
ACTR6	HIP1R	O75146	426
ACTR6	TRIP12	Q14669	414
ACTR6	MYO10	Q9HD67	409
ACTR6	TADA2A	O75478	405
ACTR6	ANAPC5	Q9UJX4	398
ACTR6	HCLS1	P14317	391
ACTR6	RUVBL2	Q9Y230	389

IntAct

81 interactions, top by confidence:

A	B	Type	Score
UBXN2B	VCP	psi-mi:“MI:0914”(association)	0.910
RUVBL1	ZNHIT1	psi-mi:“MI:0914”(association)	0.860
ACTR6	ZNHIT1	psi-mi:“MI:0914”(association)	0.820
ACTR6	ZNHIT1	psi-mi:“MI:0915”(physical association)	0.820
RUVBL2	ZNHIT1	psi-mi:“MI:0914”(association)	0.810
YEATS4	ZNHIT1	psi-mi:“MI:0914”(association)	0.790
ZNHIT1	YEATS4	psi-mi:“MI:0914”(association)	0.790
H2AZ1	ZNHIT1	psi-mi:“MI:0914”(association)	0.770
ZNHIT1	H2AZ1	psi-mi:“MI:0914”(association)	0.770
ACTL6A	ZNHIT1	psi-mi:“MI:0914”(association)	0.720
VPS72	ZNHIT1	psi-mi:“MI:0914”(association)	0.690
ACTR6	H2AZ1	psi-mi:“MI:0915”(physical association)	0.670
H2BC1	PPM1G	psi-mi:“MI:0914”(association)	0.640
P4HA3	FAM171A2	psi-mi:“MI:0914”(association)	0.640
QPRT	PIK3C2A	psi-mi:“MI:0914”(association)	0.640
RUVBL1	POLR3A	psi-mi:“MI:0914”(association)	0.640

BioGRID (89): ACTR6 (Affinity Capture-MS), ACTR6 (Affinity Capture-MS), ACTR6 (Affinity Capture-MS), DMAP1 (Affinity Capture-MS), SRCAP (Affinity Capture-MS), ZNHIT1 (Affinity Capture-MS), ACTR6 (Affinity Capture-MS), ACTR6 (Affinity Capture-MS), ACTR6 (Co-fractionation), CHMP5 (Co-fractionation), PUS7 (Co-fractionation), RUVBL1 (Co-fractionation), RUVBL2 (Co-fractionation), YWHAE (Co-fractionation), ACTR6 (Proximity Label-MS)

ESM2 similar proteins: A2X6S3, A2XLF2, A2XNS1, A2YR10, O16808, O81221, P0DM41, P0DM42, P10990, P30162, P30163, P30168, P32390, P42528, P45886, P47117, P53460, P53461, P53463, P53464, P53490, P69004, P69005, P78712, P81228, P81229, P92179, P93374, P93375, P93376, P93584, P93586, P93587, Q10AZ4, Q10DV7, Q26065, Q61WW9, Q6K908, Q6NVA9, Q6ZJW9

Diamond homologs: A2BDB0, A2WNB0, O18840, O74258, O94241, P02578, P04751, P07829, P0CM04, P0CM05, P10984, P10986, P10990, P10995, P12716, P14235, P17128, P17304, P20399, P27131, P29751, P30162, P30163, P45890, P48975, P49055, P53455, P53458, P53459, P53472, P53479, P53486, P53505, P60009, P60010, P60011, P60706, P60708, P60709, P60710

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 71 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
HATs acetylate histones	11	17.4×	1e-08
FXIIa activates plasma kallikrein-kinin system	5	17.3×	8e-04
Deposition of new CENPA-containing nucleosomes at the centromere	5	15.9×	1e-03
UCH proteinases	6	14.9×	4e-04
Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks	5	14.6×	1e-03
RUNX1 regulates transcription of genes involved in differentiation of HSCs	7	13.3×	2e-04
Amyloid fiber formation	6	12.3×	8e-04
Formation of the beta-catenin:TCF transactivating complex	5	12.0×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
regulation of double-strand break repair	6	52.8×	3e-07
positive regulation of double-strand break repair via homologous recombination	6	34.8×	2e-06
regulation of embryonic development	6	30.0×	4e-06
positive regulation of DNA repair	5	27.2×	5e-05
regulation of DNA repair	5	20.9×	1e-04
chromatin remodeling	11	12.2×	3e-07
regulation of apoptotic process	9	11.4×	6e-06
regulation of cell cycle	10	11.3×	2e-06

Disease & clinical

Clinical variants and AI predictions

ClinVar

52 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	2
Uncertain significance	36
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (3)

Variant ID	HGVS	Classification
59817	GRCh38/hg38 12q23.1(chr12:100078579-100273980)x3	Pathogenic
148826	GRCh38/hg38 12q23.1-23.2(chr12:97394550-101410225)x3	Likely pathogenic
563984	GRCh37/hg19 12q23.1(chr12:96719383-101537641)x3	Likely pathogenic

SpliceAI

1585 predictions. Top by Δscore:

Variant	Effect	Δscore
12:100204931:T:TA	acceptor_gain	1.0000
12:100204937:TA:T	acceptor_loss	1.0000
12:100204938:A:AG	acceptor_gain	1.0000
12:100204938:AG:A	acceptor_gain	1.0000
12:100204938:AGG:A	acceptor_gain	1.0000
12:100204938:AGGGT:A	acceptor_loss	1.0000
12:100204939:G:GT	acceptor_gain	1.0000
12:100204939:GG:G	acceptor_gain	1.0000
12:100204939:GGG:G	acceptor_gain	1.0000
12:100204939:GGGT:G	acceptor_gain	1.0000
12:100204939:GGGTT:G	acceptor_gain	1.0000
12:100205053:AAAAG:A	donor_loss	1.0000
12:100205055:AAGGT:A	donor_loss	1.0000
12:100205056:AGG:A	donor_loss	1.0000
12:100205058:GTA:G	donor_loss	1.0000
12:100205059:T:A	donor_loss	1.0000
12:100207658:TATA:T	acceptor_loss	1.0000
12:100207661:A:AC	acceptor_loss	1.0000
12:100207661:AGGTT:A	acceptor_gain	1.0000
12:100207662:G:A	acceptor_loss	1.0000
12:100207662:GGTT:G	acceptor_gain	1.0000
12:100207662:GGTTG:G	acceptor_gain	1.0000
12:100207719:A:AG	acceptor_gain	1.0000
12:100207784:ATGGT:A	donor_loss	1.0000
12:100207785:TGGT:T	donor_loss	1.0000
12:100207786:GGTGA:G	donor_loss	1.0000
12:100207787:G:GG	donor_gain	1.0000
12:100207787:GTG:G	donor_loss	1.0000
12:100207788:TGA:T	donor_loss	1.0000
12:100207789:GAG:G	donor_loss	1.0000

AlphaMissense

2645 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:100205676:G:C	G63R	1.000
12:100205712:T:A	W75R	1.000
12:100205712:T:C	W75R	1.000
12:100210306:G:A	G176E	1.000
12:100210330:T:C	L184P	1.000
12:100210344:T:C	S189P	1.000
12:100210351:G:C	R191T	1.000
12:100210351:G:T	R191M	1.000
12:100212301:A:C	K206N	1.000
12:100212301:A:T	K206N	1.000
12:100212491:T:C	L238S	1.000
12:100212494:C:A	P239H	1.000
12:100220080:G:C	R332P	1.000
12:100200877:G:A	G9E	0.999
12:100204963:G:C	R31P	0.999
12:100205047:C:A	P59H	0.999
12:100205047:C:G	P59R	0.999
12:100205677:G:A	G63D	0.999
12:100205691:T:A	W68R	0.999
12:100205691:T:C	W68R	0.999
12:100207710:C:A	N101K	0.999
12:100207710:C:G	N101K	0.999
12:100207751:A:T	E115V	0.999
12:100210136:T:A	V148D	0.999
12:100210157:C:A	T155K	0.999
12:100210305:G:A	G176R	0.999
12:100210305:G:C	G176R	0.999
12:100210306:G:T	G176V	0.999
12:100210321:C:T	T181I	0.999
12:100210325:T:A	N182K	0.999

dbSNP variants (sampled 300 via entrez): RS1000093090 (12:100215528 T>C), RS1000113729 (12:100200047 C>T), RS1000148765 (12:100213485 A>G), RS1000193578 (12:100205465 A>G), RS1000377215 (12:100212689 A>G), RS1000464910 (12:100199557 A>G,T), RS1000546841 (12:100220021 T>A), RS1000639079 (12:100219713 C>A,T), RS1000754106 (12:100211891 G>A), RS1001290926 (12:100212368 C>T), RS1001517107 (12:100198908 G>A,T), RS1001645776 (12:100218028 C>T), RS1001879493 (12:100210516 C>T), RS1001900277 (12:100198881 CTCAGGTGGGAGGA>C,CTCAGGTGGGAGGATCAGGTGGGAGGA), RS1001934597 (12:100202994 A>G)

Disease associations

OMIM: gene MIM:619729 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

31 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases expression, decreases expression, affects cotreatment, increases abundance	4
Arsenic	increases abundance, increases expression, affects cotreatment	2
Valproic Acid	increases expression	2
Cadmium Chloride	increases expression, increases abundance	2
bisphenol F	affects cotreatment, increases expression	1
dicrotophos	decreases expression	1
bisphenol A	decreases methylation	1
arsenite	affects binding, increases reaction	1
cobaltous chloride	increases expression	1
manganese chloride	increases expression, affects cotreatment, increases abundance	1
beta-methylcholine	affects expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	decreases expression	1
ICG 001	decreases expression	1
bisphenol S	increases methylation	1
jinfukang	decreases expression	1
Resveratrol	increases expression, affects cotreatment	1
Temozolomide	increases expression	1
Cadmium	increases abundance, increases expression	1
Dexamethasone	affects cotreatment, increases expression	1
Hydrogen Peroxide	affects expression	1
Indomethacin	affects cotreatment, increases expression	1
Ivermectin	decreases expression	1
Manganese	increases abundance, increases expression, affects cotreatment	1
Plant Extracts	increases expression, affects cotreatment	1
Quercetin	decreases expression	1
Tretinoin	decreases expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, increases expression	1
Aflatoxin B1	increases methylation	1
Aflatoxin M1	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.