ACTRT2

Summary

ACTRT2 (actin related protein T2, HGNC:24026) is a protein-coding gene on chromosome 1p36.32, encoding Actin-related protein T2 (Q8TDY3).

The protein encoded by this intronless gene belongs to the actin family. Studies have shown that this protein may be involved in cytoskeletal organization similar to other cytoplasmic actin-related protein (ARP) subfamily members. Antibody raised against the human protein has been used to detect the protein by immunoblotting and immunofluorescence microscopy, demonstrating its specific synthesis in the testis, late in spermatid differentiation, and its localization in the calyx.

Source: NCBI Gene 140625 — RefSeq curated summary.

At a glance

• GWAS associations: 11
• Clinical variants (ClinVar): 100 total — 11 pathogenic
• MANE Select transcript: NM_080431

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24026
Approved symbol	ACTRT2
Name	actin related protein T2
Location	1p36.32
Locus type	gene with protein product
Status	Approved
Aliases	Arp-T2, ARPM2, FLJ25424
Ensembl gene	ENSG00000169717
Ensembl biotype	protein_coding
OMIM	608535
Entrez	140625

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000378404

RefSeq mRNA: 1 — MANE Select: NM_080431 NM_080431

CCDS: CCDS45

Canonical transcript exons

ENST00000378404 — 1 exons

Exon	Start	End
ENSE00001477363	3021467	3022903

Expression profiles

Bgee: expression breadth broad, 31 present calls, max score 96.67.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.1568 / max 148.8580, expressed in 7 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
273	0.1420	7
201325	0.0076	3
272	0.0073	3

Top tissues by expression

206 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left testis	UBERON:0004533	96.67	gold quality
right testis	UBERON:0004534	96.58	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	95.97	gold quality
testis	UBERON:0000473	93.53	gold quality
sperm	CL:0000019	88.47	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.10	gold quality
adult organism	UBERON:0007023	84.52	gold quality
pancreatic ductal cell	CL:0002079	72.40	silver quality
upper arm skin	UBERON:0004263	65.53	gold quality
left ventricle myocardium	UBERON:0006566	64.85	gold quality
cardiac muscle of right atrium	UBERON:0003379	64.76	gold quality
epithelial cell of pancreas	CL:0000083	56.15	gold quality
quadriceps femoris	UBERON:0001377	56.14	gold quality
epithelium of nasopharynx	UBERON:0001951	56.10	gold quality
pericardium	UBERON:0002407	55.87	gold quality
myocardium	UBERON:0002349	55.82	gold quality
kidney epithelium	UBERON:0004819	55.47	gold quality
vastus lateralis	UBERON:0001379	55.37	gold quality
superficial temporal artery	UBERON:0001614	55.04	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	54.90	gold quality
parotid gland	UBERON:0001831	54.38	gold quality
mucosa of paranasal sinus	UBERON:0005030	54.35	gold quality
deltoid	UBERON:0001476	53.26	gold quality
tibialis anterior	UBERON:0001385	51.41	silver quality
oocyte	CL:0000023	49.67	gold quality
nasal cavity epithelium	UBERON:0005384	48.81	gold quality
layer of synovial tissue	UBERON:0007616	48.00	gold quality
ileal mucosa	UBERON:0000331	47.15	silver quality
body of tongue	UBERON:0011876	47.08	gold quality
cauda epididymis	UBERON:0004360	46.66	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-GEOD-134144	yes	31.68
E-ANND-3	no	0.66

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 1)

• Describes the discovery of two actin-related proteins as major components in a cytoskeletal, nonmotile structure of bull spermatozoa, suggesting that certain members of this family of proteins may serve functions other than nucleation of actin filaments. (PMID:12243744)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Actrt2	ENSMUSG00000051276
rattus_norvegicus	Actrt2	ENSRNOG00000012586

Paralogs (26): ACTR6 (ENSG00000075089), ACTB (ENSG00000075624), ACTL6B (ENSG00000077080), ACTR5 (ENSG00000101442), ACTR3C (ENSG00000106526), ACTA2 (ENSG00000107796), ACTR8 (ENSG00000113812), ACTR1B (ENSG00000115073), ACTR3 (ENSG00000115091), ACTL8 (ENSG00000117148), ACTRT1 (ENSG00000123165), ACTR10 (ENSG00000131966), ACTR3B (ENSG00000133627), ACTL6A (ENSG00000136518), ACTR2 (ENSG00000138071), ACTR1A (ENSG00000138107), ACTA1 (ENSG00000143632), ACTL7B (ENSG00000148156), ACTC1 (ENSG00000159251), ACTG2 (ENSG00000163017), ACTBL2 (ENSG00000169067), ACTL9 (ENSG00000181786), ACTG1 (ENSG00000184009), ACTRT3 (ENSG00000184378), ACTL7A (ENSG00000187003), ACTL10 (ENSG00000288649)

Protein

Protein identifiers

Actin-related protein T2 — Q8TDY3 (reviewed: Q8TDY3)

Alternative names: Actin-related protein M2

All UniProt accessions (1): Q8TDY3

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Cytoplasm. Cytoskeleton.

Similarity. Belongs to the actin family.

RefSeq proteins (1): NP_536356* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004000	Actin	Family
IPR020902	Actin/actin-like_CS	Conserved_site
IPR043129	ATPase_NBD	Homologous_superfamily

Pfam: PF00022

UniProt features (4 total): sequence conflict 2, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8TDY3-F1	93.42	0.85

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 24 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_DN, MARTINEZ_RB1_TARGETS_UP, MARTINEZ_RB1_AND_TP53_TARGETS_UP, GOMF_STRUCTURAL_CONSTITUENT_OF_CYTOSKELETON, GOMF_STRUCTURAL_MOLECULE_ACTIVITY, chr1p36, ZNF436_TARGET_GENES, GSE13229_IMM_VS_INTMATURE_NKCELL_UP, GSE13485_DAY3_VS_DAY21_YF17D_VACCINE_PBMC_DN, GSE13485_DAY7_VS_DAY21_YF17D_VACCINE_PBMC_DN, GSE10211_UV_INACT_SENDAI_VS_LIVE_SENDAI_VIRUS_TRACHEAL_EPITHELIAL_CELLS_UP, GSE17721_PAM3CSK4_VS_GADIQUIMOD_6H_BMDC_DN, GSE17974_IL4_AND_ANTI_IL12_VS_UNTREATED_12H_ACT_CD4_TCELL_DN, GOCC_ACTIN_CYTOSKELETON, GSE8921_UNSTIM_0H_VS_TLR1_2_STIM_MONOCYTE_3H_UP

GO Biological Process (0):

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (3): actin cytoskeleton (GO:0015629), cytoplasm (GO:0005737), cytoskeleton (GO:0005856)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	1
cytoskeleton	1
intracellular anatomical structure	1
cellular anatomical structure	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

2100 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ACTRT2	OR2T34	Q8NGX1	542
ACTRT2	OR10J1	P30954	516
ACTRT2	TSACC	Q96A04	507
ACTRT2	C22orf23	Q9BZE7	507
ACTRT2	PRDM16	Q9HAZ2	495
ACTRT2	ACTL9	Q8TC94	478
ACTRT2	CATSPERT	Q53TS8	474
ACTRT2	CFAP161	Q6P656	462
ACTRT2	FAM186B	Q8IYM0	453
ACTRT2	TMEM247	A6NEH6	452
ACTRT2	ACTRT1	Q8TDG2	449
ACTRT2	PRR30	Q53SZ7	447
ACTRT2	GKAP1	Q5VSY0	447
ACTRT2	SLC67A1-AS	Q8N1D0	447
ACTRT2	CAPZA3	Q96KX2	444

IntAct

3 interactions, top by confidence:

A	B	Type	Score
ACTRT2	PDCL3	psi-mi:“MI:0915”(physical association)	0.500
ACTRT2	ACSL4	psi-mi:“MI:0914”(association)	0.350

BioGRID (10): PDCL3 (Affinity Capture-MS), CCT6A (Affinity Capture-MS), CCT6B (Affinity Capture-MS), CCT2 (Affinity Capture-MS), CCT7 (Affinity Capture-MS), ACSL4 (Affinity Capture-MS), SLC25A19 (Affinity Capture-MS), CCT3 (Affinity Capture-MS), TCP1 (Affinity Capture-MS), ACTRT2 (Cross-Linking-MS (XL-MS))

ESM2 similar proteins: A0JNU3, A2AKE7, A6H603, A6QQ74, D3ZBP4, F1MH07, O43542, Q149M9, Q2T9W4, Q2TA43, Q2V057, Q32KZ2, Q32L91, Q3ZBE0, Q49HH9, Q49KI5, Q4QR76, Q4R317, Q4R6Q3, Q4R821, Q5JWF8, Q5REQ1, Q5XIK1, Q641W9, Q643R3, Q68FW7, Q6AY16, Q6NVG1, Q76HM9, Q86U10, Q8CG27, Q8K4F6, Q8TC94, Q8TDG2, Q8TDY3, Q8TDZ2, Q8VCZ9, Q8VDP3, Q8VEI3, Q95JK8

Diamond homologs: A2BDB0, O13419, O18499, O18500, O18840, O42161, O74258, O93400, P02576, P02578, P07830, P10365, P10984, P10988, P10989, P10993, P12432, P14883, P17304, P20359, P26197, P27131, P29751, P30162, P41340, P48465, P48975, P50138, P53455, P53485, P53500, P53505, P53689, P60009, P60010, P60011, P60706, P60707, P60708, P60709

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

100 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	11
Likely pathogenic	0
Uncertain significance	81
Likely benign	7
Benign	0

Top pathogenic / likely-pathogenic (11)

Variant ID	HGVS	Classification
148513	GRCh38/hg38 1p36.32-36.31(chr1:2906020-5336116)x1	Pathogenic
1808734	GRCh37/hg19 1p36.33-36.32(chr1:2173570-5023430)x1	Pathogenic
3063066	GRCh37/hg19 1p36.33-36.31(chr1:1959612-5471235)x1	Pathogenic
443115	GRCh37/hg19 1p36.33-36.32(chr1:1415800-5007235)x1	Pathogenic
565062	GRCh37/hg19 1p36.33-36.32(chr1:2190850-3503606)x1	Pathogenic
58040	GRCh38/hg38 1p36.32(chr1:2659405-3273322)x3	Pathogenic
58319	GRCh38/hg38 1p36.33-36.32(chr1:1482278-3152536)x1	Pathogenic
58321	GRCh38/hg38 1p36.32(chr1:2683403-4729121)x1	Pathogenic
625765	GRCh37/hg19 1p36.33-36.31(chr1:1471075-5831645)	Pathogenic
638130	GRCh37/hg19 1p36.33-36.32(chr1:2261222-5304873)x1	Pathogenic
666432	GRCh37/hg19 1p36.33-36.32(chr1:1723651-3444846)x1	Pathogenic

SpliceAI

46 predictions. Top by Δscore:

Variant	Effect	Δscore
1:3022549:A:AG	donor_gain	0.6500
1:3022406:G:T	donor_gain	0.5800
1:3022491:C:G	donor_gain	0.5800
1:3022406:G:GT	donor_gain	0.5700
1:3022562:G:GT	donor_gain	0.5200
1:3022577:G:T	donor_gain	0.4900
1:3022349:C:G	donor_gain	0.4600
1:3022543:A:G	donor_gain	0.4600
1:3022577:G:GT	donor_gain	0.4600
1:3022544:G:GG	donor_gain	0.4400
1:3022398:GTCC:G	donor_gain	0.4000
1:3022399:TCCT:T	donor_gain	0.4000
1:3022395:G:GT	donor_gain	0.3900
1:3022638:G:GT	donor_gain	0.3600
1:3022698:T:TA	donor_gain	0.3300
1:3022699:G:GA	donor_gain	0.3200
1:3022405:GGGA:G	donor_gain	0.3100
1:3022662:G:GT	donor_gain	0.3100
1:3022154:G:GA	donor_gain	0.3000
1:3021597:G:GT	donor_gain	0.2800
1:3022197:G:GC	acceptor_gain	0.2800
1:3021597:G:T	donor_gain	0.2700
1:3022477:T:A	donor_gain	0.2700
1:3022220:A:AG	acceptor_gain	0.2600
1:3022221:G:GG	acceptor_gain	0.2600
1:3022547:T:A	donor_gain	0.2600
1:3022695:C:A	acceptor_gain	0.2600
1:3022110:G:GT	donor_gain	0.2500
1:3022153:T:TA	donor_gain	0.2500
1:3022374:G:GT	donor_gain	0.2500

AlphaMissense

2473 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:3022161:A:C	S159R	0.974
1:3022163:C:A	S159R	0.974
1:3022163:C:G	S159R	0.974
1:3022533:A:C	S283R	0.971
1:3022535:C:A	S283R	0.971
1:3022535:C:G	S283R	0.971
1:3022710:T:A	W342R	0.970
1:3022710:T:C	W342R	0.970
1:3022337:A:C	K217N	0.967
1:3022337:A:T	K217N	0.967
1:3022068:T:C	F128L	0.963
1:3022070:C:A	F128L	0.963
1:3022070:C:G	F128L	0.963
1:3022758:T:A	W358R	0.960
1:3022758:T:C	W358R	0.960
1:3022627:G:C	R314P	0.956
1:3022746:T:C	F354L	0.956
1:3022748:C:A	F354L	0.956
1:3022748:C:G	F354L	0.956
1:3022815:T:C	F377L	0.951
1:3022817:C:A	F377L	0.951
1:3022817:C:G	F377L	0.951
1:3021752:A:C	K22N	0.949
1:3021752:A:T	K22N	0.949
1:3022476:T:C	F264L	0.945
1:3022478:C:A	F264L	0.945
1:3022478:C:G	F264L	0.945
1:3022189:C:A	P168H	0.941
1:3022630:T:C	L315P	0.934
1:3022525:T:A	V280D	0.932

dbSNP variants (sampled 300 via entrez): RS1000415473 (1:3022307 G>A), RS1000783590 (1:3019639 C>T), RS1001000664 (1:3021108 T>A), RS1002720697 (1:3023286 G>A), RS1002770605 (1:3021579 A>T), RS1004385684 (1:3022955 GGCCCTGACAGTGAATCTGTGAAGTGTCTTGGTCCACACCC>G), RS1004549796 (1:3019733 C>T), RS1004621741 (1:3019575 G>A,T), RS1006784944 (1:3021905 C>A), RS1007207452 (1:3023054 A>G), RS1008782805 (1:3019900 G>A), RS1010732877 (1:3019933 C>T), RS1011232692 (1:3023027 G>A,T), RS1011744431 (1:3023260 G>A,C), RS1012258936 (1:3022512 C>G,T)

Disease associations

OMIM: gene MIM:608535 | disease phenotypes: MIM:607872

GenCC curated gene-disease

Mondo (2): chromosome 1p36 deletion syndrome (MONDO:0011929), intellectual disability (MONDO:0001071)

Orphanet (2): 1p36 deletion syndrome (Orphanet:1606), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

11 associations (top):

Study	Trait	p-value
GCST003901_7	Cognitive decline (age-related)	1.000000e-06
GCST004749_57	Lung cancer in ever smokers	4.000000e-06
GCST005194_148	Coronary artery disease	2.000000e-07
GCST005951_35	Body mass index	4.000000e-08
GCST006288_592	Heel bone mineral density	6.000000e-14
GCST006288_699	Heel bone mineral density	1.000000e-07
GCST006288_95	Heel bone mineral density	1.000000e-06
GCST006979_848	Heel bone mineral density	7.000000e-47
GCST010866_12	Coronary artery disease	6.000000e-12
GCST012295_7	Schizophrenia, bipolar disorder or recurrent major depressive disorder x sex interaction	7.000000e-06
GCST012319_9	LDL levels x SSRI levels (escitalopram or citalopram) interaction in schizophrenia or bipolar disorder	5.000000e-06

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index
EFO:0009270	heel bone mineral density
EFO:0004952	disease recurrence
EFO:0008343	sex interaction measurement
EFO:0004611	low density lipoprotein cholesterol measurement

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
C535362	Chromosome 1p36 Deletion Syndrome (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

14 total (human), top 14 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Air Pollutants	affects methylation, increases abundance, decreases expression, increases expression	3
bisphenol A	decreases expression	1
sodium arsenite	increases expression	1
3,4,5,3’,4’-pentachlorobiphenyl	decreases expression	1
perfluorooctanoic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
Benzo(a)pyrene	decreases methylation, affects methylation	1
Coal	increases abundance, increases expression	1
Folic Acid	decreases expression	1
Ozone	affects methylation, increases abundance	1
Smoke	increases abundance, increases expression	1
Valproic Acid	increases methylation	1
Particulate Matter	increases abundance, decreases expression	1

Clinical trials (associated diseases)

199 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT02381457	Not specified	COMPLETED	SNP-based Microdeletion and Aneuploidy RegisTry (SMART)
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability
NCT02461420	Not specified	ACTIVE_NOT_RECRUITING	Mapping the Genotype, Phenotype, and Natural History of Phelan-McDermid Syndrome
NCT02461459	Not specified	ACTIVE_NOT_RECRUITING	Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) Determinants in Tuberous Sclerosis Complex (TSC)
NCT02486081	Not specified	COMPLETED	Development and Application-Smart Football for Movement Evaluation and Training in the Special Education Population
NCT02504502	Not specified	COMPLETED	Enhancing Genomic Laboratory Reports to Enhance Communication and Empower Patients
NCT02513277	Not specified	COMPLETED	Diabetes Screening & Prevention for People With Learning (Intellectual) Disabilities:STOP Diabetes Study
NCT02561754	Not specified	COMPLETED	Weight Management for Adolescents With IDD
NCT02591446	Not specified	COMPLETED	Transcranial Magnetic Stimulation Studies in Autism Spectrum Disorders
NCT02714868	Not specified	COMPLETED	Evaluation of Project TEAM (Teens Making Environmental and Activity Modifications)
NCT02721394	Not specified	UNKNOWN	FCT With Young Children With ID in the UK: A Feasibility Project V.1