AFDN

Summary

AFDN (afadin, adherens junction formation factor, HGNC:7137) is a protein-coding gene on chromosome 6q27, encoding Afadin (P55196). Belongs to an adhesion system, probably together with the E-cadherin-catenin system, which plays a role in the organization of homotypic, interneuronal and heterotypic cell-cell adherens junctions (AJs).

This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.

Source: NCBI Gene 4301 — RefSeq curated summary.

At a glance

• Gene–disease (curated): cleft lip/palate (Limited, GenCC)
• GWAS associations: 7
• Clinical variants (ClinVar): 108 total — 23 pathogenic, 2 likely-pathogenic
• Cancer driver (intOGen): loss-of-function (tumor-suppressor-like) across 2 cancer types
• MANE Select transcript: NM_001386888

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:7137
Approved symbol	AFDN
Name	afadin, adherens junction formation factor
Location	6q27
Locus type	gene with protein product
Status	Approved
Aliases	AF-6, AF6
Ensembl gene	ENSG00000130396
Ensembl biotype	protein_coding
OMIM	159559
Entrez	4301

Gene structure

Transcript identifiers

Ensembl transcripts: 27 — 20 protein_coding, 5 retained_intron, 2 protein_coding_CDS_not_defined

ENST00000344191, ENST00000351017, ENST00000366806, ENST00000366809, ENST00000392108, ENST00000392112, ENST00000400822, ENST00000400824, ENST00000400825, ENST00000423229, ENST00000447894, ENST00000476946, ENST00000485634, ENST00000486649, ENST00000497596, ENST00000503021, ENST00000507679, ENST00000507704, ENST00000509296, ENST00000511503, ENST00000511637, ENST00000515794, ENST00000683244, ENST00000913561, ENST00000913562, ENST00000913563, ENST00000913564

RefSeq mRNA: 8 — MANE Select: NM_001386888 NM_001040000, NM_001207008, NM_001291964, NM_001366319, NM_001366320, NM_001366321, NM_001386888, NM_001410951

CCDS: CCDS47517, CCDS75553, CCDS78199, CCDS94033, CCDS94034, CCDS94035

Canonical transcript exons

ENST00000683244 — 34 exons

Exon	Start	End
ENSE00001010034	167893862	167893906
ENSE00001255928	167969782	167972023
ENSE00001750508	167872214	167872377
ENSE00002438520	167965757	167966045
ENSE00002690486	167962433	167962567
ENSE00003514287	167969114	167969198
ENSE00003922122	167826911	167827237
ENSE00003978622	167947853	167947944
ENSE00003978623	167896878	167896972
ENSE00003978624	167943941	167944059
ENSE00003978625	167911284	167911489
ENSE00003978626	167925005	167925091
ENSE00003978627	167948293	167948478
ENSE00003978628	167875335	167875495
ENSE00003978629	167914644	167914738
ENSE00003978630	167911101	167911162
ENSE00003978631	167889215	167889326
ENSE00003978632	167864551	167864746
ENSE00003978633	167890862	167891029
ENSE00003978635	167898205	167898467
ENSE00003978636	167917089	167917232
ENSE00003978637	167902317	167902386
ENSE00003978638	167943402	167943475
ENSE00003978639	167907171	167907289
ENSE00003978640	167915168	167915433
ENSE00003978641	167880360	167880517
ENSE00003978642	167922856	167922959
ENSE00003978643	167913403	167913423
ENSE00003978644	167914168	167914313
ENSE00003978645	167946707	167946901
ENSE00003978646	167918735	167918933
ENSE00003978647	167870386	167870498
ENSE00003978648	167943129	167943194
ENSE00003978649	167951186	167952187

Expression profiles

Bgee: expression breadth ubiquitous, 269 present calls, max score 99.38.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.1917 / max 162.7461, expressed in 1650 samples.

FANTOM5 promoters (10 alternative TSS)

Promoter ID	TPM avg	Samples expressed
71214	10.9158	1622
71215	0.7961	517
71212	0.1223	62
71233	0.1188	57
71224	0.1042	38
71232	0.0721	39
71213	0.0262	9
71223	0.0238	14
71231	0.0088	4
71230	0.0036	2

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right uterine tube	UBERON:0001302	99.38	gold quality
sural nerve	UBERON:0015488	98.92	gold quality
lower esophagus mucosa	UBERON:0035834	98.70	gold quality
cortical plate	UBERON:0005343	98.48	gold quality
bronchial epithelial cell	CL:0002328	98.45	gold quality
ganglionic eminence	UBERON:0004023	98.02	gold quality
right lung	UBERON:0002167	97.97	gold quality
buccal mucosa cell	CL:0002336	97.94	gold quality
minor salivary gland	UBERON:0001830	97.82	gold quality
body of pancreas	UBERON:0001150	97.68	gold quality
rectum	UBERON:0001052	97.61	gold quality
esophagus mucosa	UBERON:0002469	97.57	gold quality
caput epididymis	UBERON:0004358	97.48	gold quality
jejunal mucosa	UBERON:0000399	97.43	gold quality
esophagus squamous epithelium	UBERON:0006920	97.42	gold quality
amniotic fluid	UBERON:0000173	97.36	gold quality
calcaneal tendon	UBERON:0003701	97.36	gold quality
mouth mucosa	UBERON:0003729	97.33	gold quality
oral cavity	UBERON:0000167	97.29	gold quality
saliva-secreting gland	UBERON:0001044	97.27	gold quality
mucosa of paranasal sinus	UBERON:0005030	97.12	gold quality
skin of leg	UBERON:0001511	96.98	gold quality
skin of abdomen	UBERON:0001416	96.89	gold quality
left lobe of thyroid gland	UBERON:0001120	96.88	gold quality
upper lobe of left lung	UBERON:0008952	96.85	gold quality
colonic epithelium	UBERON:0000397	96.75	gold quality
upper lobe of lung	UBERON:0008948	96.73	gold quality
right lobe of thyroid gland	UBERON:0001119	96.68	gold quality
vagina	UBERON:0000996	96.57	gold quality
thyroid gland	UBERON:0002046	96.53	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-CURD-119	yes	17.13
E-ANND-3	yes	14.42

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 34)

• RYK, a catalytically inactive receptor tyrosine kinase, associates with EphB2 and EphB3 but does not interact with AF-6. (PMID:11956217)
• Bcr kinase downregulates Ras signaling by phosphorylating AF-6 and binding to its PDZ domain (PMID:12808105)
• Results report the solution structure of AF-6 PDZ domain and its interaction with the C-terminal peptides from Neurexin and Bcr. (PMID:15684424)
• AF6 negatively regulates Rap1-induced cell adhesion. (PMID:16051602)
• In the Acute Myeloid Leukemia patients, detected MLL rearrangements consisting of MLL/AF6, MLL/AF9, MLL/AF17 , MLL/ELL and MLL partial tandem duplication. MLL rearrangement include chromosome translocation and partial tandem duplication. (PMID:16086288)
• Loss of afadin is associated with breast cancer (PMID:16819513)
• AF6/s-afadin is a candidate for mediating control of cellular growth processes by regulated translocation to the nucleus. (PMID:17013812)
• c-Src is recruited by AF-6 to cell-cell contact sites, suggesting that c-Src is regulated by a PDZ protein in special cellular locations. (PMID:17491594)
• AF6 protein is important for spreading of Herpes simplex virus 1 in epithelial cells (PMID:17967423)
• two distal surfaces of the AF-6 PDZ domain respond differently to peptide binding; distal surface 1 changes in millisecond dynamics, whereas distal surface 2 undergoes structural rearrangement (PMID:18052198)
• JAM-A dimerization facilitates formation of a complex with Afadin and PDZ-GEF2 that activates Rap1A, which regulates beta1 integrin levels and cell migration. (PMID:19176753)
• Results demonstrate a novel molecular mechanism by which Rap1 and afadin regulate the VEGF- and S1P-induced angiogenesis. (PMID:20413783)
• The interaction between the PDZ domain of afadin (AF6_PDZ) and a series of polypeptides comprising the PDZ-binding motif, was studied. (PMID:20586101)
• AF6/afadin is a marker of poor outcome in breast cancer, and its loss induces cell migration, invasiveness and tumor growth (PMID:21478912)
• Results demonstrate a role for afadin in the regulation of vascular barrier function via coordination of adherens junction-tight junction and p120-catenin-ZO-1 interactions. (PMID:21732359)
• the Necl-5-nectin, nectin-nectin, and nectin-afadin interactions cooperatively increase the clustering of the nectin-afadin complex at the cell-cell contact sites, promoting the formation of the nectin-based cell-cell adhesion. (PMID:21880730)
• AF-6 is a positive modulator of the PINK1/parkin pathway and is deficient in Parkinson’s disease. (PMID:23393160)
• JAM-A regulates epithelial permeability via association with ZO-2, afadin, and PDZ-GEF1 to activate Rap2c and control contraction of the apical cytoskeleton. (PMID:23885123)
• The expression levels of CFTR and AF-6/afadin are significantly downregulated in human colon cancer tissues. (PMID:24373847)
• MLL-AF6 oncoprotein potentiates the activity of the RAS pathway through retention of AF6 within the nucleus. (PMID:24695851)
• AF-6/afadin could be a useful selection marker for fertility-sparing therapy for patients with atypical hyperplasia or grade 1 endometrioid adenocarcinoma with no myometrial invasion. (PMID:25879875)
• In pancreatic cancer cells, AF6 is expressed at reduced levels, causing Dvl2 to be upregulated and available to bind and enhance FOXE1-induced trans-activation of Snail, which promotes proliferation and metastasis. (PMID:26013125)
• miR-188-3p is a novel independent prognostic factor in colorectal cancer patients, which can be partly explained by its effect on MLLT4 expression and migration of cancer cells. (PMID:27601590)
• Afadin (AFDN), a cytoskeletal and junction-associated protein, was present in 2D and 3D keratinocyte cultures, and validated as a so-far-unknown EphA2-interacting protein. (PMID:27815408)
• AF6 employs a non-canonical, evolutionarily conserved alpha-helix to bind RAS, unique to AF6 and the classical RASSF effectors. (PMID:29062045)
• CLDN6 enhances the chemoresistance to ADM via activating the AF-6/ERK signaling pathway and up-regulating cancer stem cell characters in MDAMB231 cells. (PMID:29159771)
• high levels of both Claudin-2 and Afadin in primary tumors were associated with poor disease-specific survival, relapse-free survival, lung-specific relapse, and liver-specific relapse (PMID:30692208)
• The authors report here that the homophilic receptor PTPRK is stabilized at cell-cell contacts in epithelial cells. PTPRK directly and selectively dephosphorylates at least five substrates, including Afadin, PARD3 and delta-catenin family members, which are all important cell-cell adhesion regulators. (PMID:30924770)
• Afadin binding with interaction partners in adipocytes, among which HDAC6 preferentially interacts with phosphorylated Afadin and acts as a key intermediate to suppress insulin receptor protein levels. (PMID:31264358)
• Afadin (AF6) in cancer progression: A multidomain scaffold protein with complex and contradictory roles. (PMID:33165933)
• Proximity proteomics identifies PAK4 as a component of Afadin-Nectin junctions. (PMID:34493720)
• [Clinical characteristics and prognosis of MLL-AF6 positive patients with acute myeloid leukemia]. (PMID:34650294)
• Damaging Mutations in AFDN Contribute to Risk of Nonsyndromic Cleft Lip With or Without Cleft Palate. (PMID:36384317)
• This paper deals with AF-6 in mouse, rat, and cow. (PMID:9722616)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	afdna	ENSDARG00000029472
mus_musculus	Afdn	ENSMUSG00000068036
rattus_norvegicus	Afdn	ENSRNOG00000023753
drosophila_melanogaster	cno	FBGN0259212
caenorhabditis_elegans	afd-1	WBGENE00021009

Protein

Protein identifiers

Afadin — P55196 (reviewed: P55196)

Alternative names: ALL1-fused gene from chromosome 6 protein, Afadin adherens junction formation factor

All UniProt accessions (13): P55196, A0A804HJ20, A8MQ02, E9PFY5, F8W9I4, H0Y7R8, H0Y8L4, H0Y8U8, H0Y948, H0Y9I0, H0YA98, J3KN01, Q5TIG5

UniProt curated annotations — full annotation on UniProt →

Function. Belongs to an adhesion system, probably together with the E-cadherin-catenin system, which plays a role in the organization of homotypic, interneuronal and heterotypic cell-cell adherens junctions (AJs). Nectin- and actin-filament-binding protein that connects nectin to the actin cytoskeleton. May play a key role in the organization of epithelial structures of the embryonic ectoderm. Essential for the organization of adherens junctions.

Subunit / interactions. Homodimer. Interacts with F-actin, nectin and NECTIN3. Essential for the association of nectin and E-cadherin. Isoform 1/s-afadin does not interact with F-actin. Interacts with ZO-1 and occludin, but probably in an indirect manner. Interacts with RIT1 and RIT2. Interacts with NRXN1 and BCR. Interacts with ADAM10; the interaction locks ADAM10 at adherens junctions following ADAM10 recruitment to adherens junctions by TSPAN33.

Subcellular location. Cell junction. Adherens junction.

Disease relevance. A chromosomal aberration involving AFDN is associated with acute leukemias. Translocation t(6;11)(q27;q23) with KMT2A/MLL1. The result is a rogue activator protein.

Domain organisation. The PDZ/DHR domain interacts with the C-terminus of nectin and the Pro-rich C-terminal domain interacts with F-actin.

Miscellaneous. May be due to intron retention. May be due to intron retention.

Isoforms (6)

UniProt ID	Names	Canonical?
P55196-4	4	yes
P55196-2	1, s-afadin
P55196-1	2, l-afadin
P55196-3	3
P55196-6	6
P55196-5	5

RefSeq proteins (8): NP_001035089, NP_001193937, NP_001278893, NP_001353248, NP_001353249, NP_001353250, NP_001373817, NP_001397880 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000159	RA_dom	Domain
IPR000253	FHA_dom	Domain
IPR001478	PDZ	Domain
IPR002710	Dilute_dom	Domain
IPR008984	SMAD_FHA_dom_sf	Homologous_superfamily
IPR028842	Afadin	Family
IPR029071	Ubiquitin-like_domsf	Homologous_superfamily
IPR036034	PDZ_sf	Homologous_superfamily
IPR037977	CBD_Afadin	Domain

Pfam: PF00498, PF00595, PF00788, PF01843

UniProt features (97 total): modified residue 33, compositionally biased region 21, splice variant 11, strand 8, region of interest 7, domain 5, coiled-coil region 3, sequence conflict 3, helix 2, turn 2, chain 1, site 1

Structure

Experimental structures (PDB)

6 structures.

PDB	Method	Resolution (Å)
7QCR	X-RAY DIFFRACTION	2.28
5A6C	X-RAY DIFFRACTION	2.9
1T2M	SOLUTION NMR
1XZ9	SOLUTION NMR
2AIN	SOLUTION NMR
2EXG	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P55196-F1	63.69	0.25

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 26 (breakpoint for translocation to form kmt2a/mll1-afdn)

Post-translational modifications (33): 216, 246, 256, 391, 424, 512, 557, 562, 589, 655, 1083, 1107, 1126, 1140, 1143, 1172, 1173, 1182, 1199, 1211 …

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-418990	Adherens junctions interactions

MSigDB gene sets: 256 (showing top): PID_SHP2_PATHWAY, GSE45365_NK_CELL_VS_BCELL_DN, GOBP_ENDOTHELIAL_CELL_DEVELOPMENT, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_EPITHELIAL_CELL_DEVELOPMENT, GOBP_ESTABLISHMENT_OF_ENDOTHELIAL_INTESTINAL_BARRIER, GOBP_REGULATION_OF_CELL_CELL_ADHESION_MEDIATED_BY_CADHERIN, GOBP_APICAL_JUNCTION_ASSEMBLY, KEGG_TIGHT_JUNCTION, GOMF_GTPASE_BINDING, GOBP_CELL_CELL_SIGNALING, GOBP_POSITIVE_REGULATION_OF_CELL_ADHESION, REACTOME_ADHERENS_JUNCTIONS_INTERACTIONS, GOBP_CELL_CELL_ADHESION, WANG_ESOPHAGUS_CANCER_VS_NORMAL_DN

GO Biological Process (15): cell adhesion (GO:0007155), signal transduction (GO:0007165), cell-cell signaling (GO:0007267), positive regulation of gene expression (GO:0010628), positive regulation of cell-cell adhesion (GO:0022409), negative regulation of cell migration (GO:0030336), regulation of protein localization (GO:0032880), cell-cell adhesion mediated by cadherin (GO:0044331), pore complex assembly (GO:0046931), establishment of protein localization to plasma membrane (GO:0061951), bicellular tight junction assembly (GO:0070830), establishment of endothelial intestinal barrier (GO:0090557), positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049), cell differentiation (GO:0030154), cell junction organization (GO:0034330)

GO Molecular Function (5): small GTPase binding (GO:0031267), cadherin binding (GO:0045296), cell adhesion molecule binding (GO:0050839), actin filament binding (GO:0051015), protein binding (GO:0005515)

GO Cellular Component (12): nucleoplasm (GO:0005654), cytosol (GO:0005829), plasma membrane (GO:0005886), cell-cell junction (GO:0005911), adherens junction (GO:0005912), nuclear speck (GO:0016607), cell junction (GO:0030054), cell-cell contact zone (GO:0044291), pore complex (GO:0046930), tight junction (GO:0070160), cytoplasm (GO:0005737), anchoring junction (GO:0070161)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Cell-cell junction organization	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
cell-cell junction	3
cellular process	2
cell communication	2
signaling	2
cell-cell adhesion	2
regulation of cellular process	1
cellular response to stimulus	1
gene expression	1
regulation of gene expression	1
positive regulation of macromolecule biosynthetic process	1
regulation of cell-cell adhesion	1
positive regulation of cell adhesion	1
cell migration	1
regulation of cell migration	1
negative regulation of cell motility	1
intracellular protein localization	1
regulation of localization	1
protein-containing complex assembly	1
establishment of protein localization to membrane	1
apical junction assembly	1
tight junction assembly	1
establishment of endothelial barrier	1
positive regulation of cell-cell adhesion	1
cell-cell adhesion mediated by cadherin	1
regulation of cell-cell adhesion mediated by cadherin	1
cellular developmental process	1
cellular component organization	1
GTPase binding	1
cell adhesion molecule binding	1
protein binding	1
actin binding	1
protein-containing complex binding	1
binding	1
nuclear lumen	1
cytoplasm	1
membrane	1
cell periphery	1
anchoring junction	1
nuclear ribonucleoprotein granule	1

Protein interactions and networks

STRING

2030 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
AFDN	NECTIN1	Q15223	999
AFDN	TJP1	Q07157	995
AFDN	NECTIN3	Q9NQS3	994
AFDN	TJP2	Q9UDY2	992
AFDN	CTNND1	O60716	986
AFDN	NECTIN2	Q92692	982
AFDN	CGN	Q9P2M7	975
AFDN	F11R	Q9Y624	971
AFDN	OCLN	Q16625	969
AFDN	NECTIN4	Q96NY8	967
AFDN	SORBS1	Q9BX66	944
AFDN	TJP3	O95049	931
AFDN	MLLT10	P55197	898
AFDN	MLLT1	Q03111	874
AFDN	CDH17	Q12864	871

IntAct

196 interactions, top by confidence:

A	B	Type	Score
YWHAG	AFDN	psi-mi:“MI:0915”(physical association)	0.830
YWHAH	ABLIM1	psi-mi:“MI:0914”(association)	0.800
AFDN	YWHAH	psi-mi:“MI:0914”(association)	0.740
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
AFDN	YWHAB	psi-mi:“MI:0915”(physical association)	0.690
HRAS	RGL2	psi-mi:“MI:0914”(association)	0.660
SRC	AFDN	psi-mi:“MI:0407”(direct interaction)	0.650
AFDN	SRC	psi-mi:“MI:0915”(physical association)	0.650
SRC	AFDN	psi-mi:“MI:0403”(colocalization)	0.650
AFDN	NECTIN3	psi-mi:“MI:0915”(physical association)	0.650
YWHAG	BLTP3B	psi-mi:“MI:2364”(proximity)	0.640
NCK2	SH3PXD2B	psi-mi:“MI:0914”(association)	0.640
YWHAH	PLEKHG3	psi-mi:“MI:0914”(association)	0.610
YWHAB	BLTP3B	psi-mi:“MI:2364”(proximity)	0.610
AFDN	E	psi-mi:“MI:0915”(physical association)	0.590
E	AFDN	psi-mi:“MI:0915”(physical association)	0.590
NECTIN2	AFDN	psi-mi:“MI:0407”(direct interaction)	0.590
NECTIN2	AFDN	psi-mi:“MI:0915”(physical association)	0.590
YWHAH	BLTP3B	psi-mi:“MI:2364”(proximity)	0.570

BioGRID (415): RAP1GAP (Two-hybrid), PVRL1 (Two-hybrid), PFN1 (Two-hybrid), MLLT4 (Affinity Capture-MS), MLLT4 (Affinity Capture-MS), MLLT4 (Affinity Capture-MS), PARK2 (Reconstituted Complex), MLLT4 (Affinity Capture-Western), USP9X (Affinity Capture-Western), MLLT4 (Affinity Capture-MS), MLLT4 (Affinity Capture-MS), MLLT4 (Affinity Capture-MS), MLLT4 (Co-fractionation), MLLT4 (Co-fractionation), NR2C2 (Co-fractionation)

ESM2 similar proteins: A2A8Z1, A8Y5H7, D2KC46, D3YXJ0, D3ZY60, E9PUQ8, F1M386, F1MS15, F1MSG6, F1PBJ0, O35889, O80866, O94512, O94830, P16258, P22059, P36583, P55196, Q0IJ05, Q15057, Q3B7Z2, Q3UYK3, Q5FVC7, Q5QNQ6, Q5R9W4, Q64398, Q6IVG4, Q6ZQK5, Q6ZT07, Q80W71, Q80Y98, Q86XP1, Q8BXR9, Q8CHG7, Q8CI95, Q8K4M9, Q8L751, Q91XL9, Q92503, Q93Y40

Diamond homologs: A0A140LI67, A5PKA5, A7UA95, E1JIT7, O14910, O15018, O19132, O35274, O35867, O35889, O62666, O62674, O62675, O62676, O62677, O62678, O88951, O88952, P11434, P29475, P29476, P31016, P51140, P55196, P57105, P78352, Q07436, Q0P5F3, Q12923, Q14005, Q29498, Q2KIB6, Q32LM6, Q3T0C9, Q3UHD6, Q4KL35, Q5F425, Q5RAA5, Q62108, Q64512

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
AFDN	“up-regulates activity”	RIT1	binding
AFDN	“up-regulates activity”	RIN1	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 160 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex	8	46.7×	1e-09
Activation of BAD and translocation to mitochondria	7	46.3×	1e-08
SARS-CoV-1 targets host intracellular signalling and regulatory pathways	7	40.9×	1e-08
DCC mediated attractive signaling	5	31.0×	1e-05
Activation of BH3-only proteins	7	30.2×	9e-08
Signaling by high-kinase activity BRAF mutants	9	24.8×	1e-08
Ephrin signaling	5	24.8×	3e-05
RAF activation	8	23.4×	6e-08

GO biological processes:

GO term	Partners	Fold	FDR
ephrin receptor signaling pathway	7	16.8×	7e-05
protein targeting	6	15.4×	5e-04
Ras protein signal transduction	9	12.9×	4e-05
substrate adhesion-dependent cell spreading	5	12.0×	7e-03
intracellular protein localization	10	7.3×	4e-04
homophilic cell-cell adhesion	7	6.9×	7e-03
actin cytoskeleton organization	11	6.1×	5e-04

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: loss-of-function (tumor-suppressor-like) across 2 cancer types — BRCA, COADREAD.

Clinical variants and AI predictions

ClinVar

108 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	23
Likely pathogenic	2
Uncertain significance	18
Likely benign	4
Benign	6

Top pathogenic / likely-pathogenic (25)

Variant ID	HGVS	Classification
1340090	GRCh37/hg19 6q27(chr6:168051206-170919482)x1	Pathogenic
146089	GRCh38/hg38 6q27(chr6:164790270-170612001)x1	Pathogenic
148449	GRCh38/hg38 6q27(chr6:167145050-170714507)x1	Pathogenic
150838	GRCh38/hg38 6q25.3-27(chr6:159915390-170714507)x1	Pathogenic
155515	GRCh38/hg38 6q27(chr6:167760366-170610394)x1	Pathogenic
1706509	GRCh37/hg19 6q27(chr6:167770398-170919482)x1	Pathogenic
3024639	GRCh37/hg19 6q26-27(chr6:162124972-170893669)x1	Pathogenic
3062910	GRCh37/hg19 6q26-27(chr6:162079329-170919482)x1	Pathogenic
442252	GRCh37/hg19 6q27(chr6:166110423-170919482)x1	Pathogenic
442494	GRCh37/hg19 6q26-27(chr6:164276935-170919482)x1	Pathogenic
563255	GRCh37/hg19 6q27(chr6:165190527-170919482)x1	Pathogenic
563258	GRCh37/hg19 6q27(chr6:167388817-170919482)x1	Pathogenic
58456	GRCh38/hg38 6q25.3-27(chr6:159825913-170612001)x1	Pathogenic
58458	GRCh38/hg38 6q25.3-27(chr6:160359686-170608818)x1	Pathogenic
58469	GRCh38/hg38 6q26-27(chr6:162789915-170602152)x1	Pathogenic
58470	GRCh38/hg38 6q26-27(chr6:163420224-170608818)x1	Pathogenic
58472	GRCh38/hg38 6q27(chr6:166370159-170602152)x1	Pathogenic
58474	GRCh38/hg38 6q27(chr6:167924952-170602152)x1	Pathogenic
625656	GRCh37/hg19 6q27(chr6:166517762-170919470)	Pathogenic
625666	GRCh37/hg19 6q27(chr6:168311806-170881789)	Pathogenic
814897	GRCh37/hg19 6q26-27(chr6:162452035-170919482)x1	Pathogenic
814901	GRCh37/hg19 6q26-27(chr6:162661108-170919482)x1	Pathogenic
814905	GRCh37/hg19 6q27(chr6:167440417-170919482)x1	Pathogenic
626287	Single allele	Likely pathogenic
979597	GRCh37/hg19 6q27(chr6:166083476-170919482)x3	Likely pathogenic

SpliceAI

6476 predictions. Top by Δscore:

Variant	Effect	Δscore
6:167827235:GAG:G	donor_gain	1.0000
6:167827237:GGT:G	donor_loss	1.0000
6:167827238:G:GG	donor_gain	1.0000
6:167827238:GT:G	donor_loss	1.0000
6:167827239:T:A	donor_loss	1.0000
6:167864546:TTTA:T	acceptor_loss	1.0000
6:167864547:TTAG:T	acceptor_loss	1.0000
6:167864715:G:GG	donor_gain	1.0000
6:167864728:G:GT	donor_gain	1.0000
6:167864761:G:GT	donor_gain	1.0000
6:167870367:A:AG	acceptor_gain	1.0000
6:167870368:T:G	acceptor_gain	1.0000
6:167870372:A:AG	acceptor_gain	1.0000
6:167870372:AT:A	acceptor_gain	1.0000
6:167870373:T:TA	acceptor_gain	1.0000
6:167870378:T:TA	acceptor_gain	1.0000
6:167870381:A:AG	acceptor_gain	1.0000
6:167870382:G:GG	acceptor_gain	1.0000
6:167870382:GAA:G	acceptor_gain	1.0000
6:167870494:CTAAG:C	donor_loss	1.0000
6:167870495:TAAG:T	donor_loss	1.0000
6:167870496:AAG:A	donor_loss	1.0000
6:167870499:GTAG:G	donor_loss	1.0000
6:167870500:T:A	donor_loss	1.0000
6:167872378:G:GG	donor_gain	1.0000
6:167875331:A:AG	acceptor_gain	1.0000
6:167875331:ACAGT:A	acceptor_gain	1.0000
6:167875332:C:G	acceptor_gain	1.0000
6:167875333:A:AG	acceptor_gain	1.0000
6:167875333:AGT:A	acceptor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000041615 (6:167906587 A>G), RS1000044961 (6:167924402 C>G,T), RS1000055332 (6:167921245 G>A,T), RS1000068522 (6:167908615 A>G), RS1000073971 (6:167906308 A>G,T), RS1000074459 (6:167924172 A>C), RS1000135240 (6:167864246 T>C), RS1000147441 (6:167958989 G>C), RS1000148429 (6:167955783 C>A), RS1000173567 (6:167828154 T>C), RS1000205399 (6:167918764 T>C), RS1000217515 (6:167879756 T>C), RS1000225515 (6:167826852 CGCGCACGGCGGCGGGCGGG>C,CGCGCACGGCGGCGGGCGGGGCGCACGGCGGCGGGCGGG), RS1000244454 (6:167952595 C>T), RS1000246787 (6:167930922 C>A,T)

Disease associations

OMIM: gene MIM:159559 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
cleft lip/palate	Limited	Autosomal dominant

Mondo (2): primary ovarian failure (MONDO:0005387), cleft lip/palate (MONDO:0016044)

Orphanet (1): NON RARE IN EUROPE: Primary ovarian failure (Orphanet:619)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST001820_2	Metabolite levels (5-HIAA)	6.000000e-06
GCST005990_58	Non-albumin protein levels	8.000000e-09
GCST008447_1	Number of alcoholic drinks required to feel an effect (long-term average)	2.000000e-07
GCST90002387_297	Immature fraction of reticulocytes	2.000000e-13
GCST90002396_378	Mean reticulocyte volume	7.000000e-09
GCST90002403_189	Red blood cell count	4.000000e-12
GCST90002404_276	Red cell distribution width	2.000000e-10

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0005132	5-HIAA measurement
EFO:0010701	mean reticulocyte volume
EFO:0004305	erythrocyte count
EFO:0009188	Red cell distribution width

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D016649	Primary Ovarian Insufficiency	C12.050.351.500.056.630.750; C12.100.250.056.630.750; C19.391.630.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

57 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
trichostatin A	affects cotreatment, decreases expression, increases expression	4
bisphenol A	decreases expression, increases expression	3
Air Pollutants	decreases expression, affects cotreatment, increases abundance, increases oxidation, increases expression	3
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	2
entinostat	decreases expression, affects cotreatment	2
Arsenic	affects methylation, affects cotreatment, increases abundance, increases expression	2
Benzo(a)pyrene	affects methylation, decreases methylation, increases expression	2
Tobacco Smoke Pollution	decreases expression, increases expression	2
Valproic Acid	decreases expression, decreases methylation	2
aristolochic acid I	decreases expression	1
FR900359	affects phosphorylation	1
2,4,6-tribromophenol	decreases expression	1
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
decabromobiphenyl ether	decreases expression	1
arsenite	affects binding, decreases reaction	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
tetrabromobisphenol A	decreases expression	1
manganese chloride	decreases expression, increases abundance	1
methacrylaldehyde	affects cotreatment, increases oxidation, increases abundance	1
di-n-butylphosphoric acid	affects expression	1
2,3,5-(triglutathion-S-yl)hydroquinone	decreases ADP-ribosylation	1
rofecoxib	affects expression	1
K 7174	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
asparanin A	decreases expression	1
(+)-JQ1 compound	increases expression	1

Cellosaurus cell lines

12 cell lines: 12 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_1418	ML-2	Cancer cell line	Male
CVCL_1619	OCI-AML-2	Cancer cell line	Male
CVCL_2191	SHI-1	Cancer cell line	Male
CVCL_8391	OU-AML-1	Cancer cell line	Male
CVCL_8392	OU-AML-2	Cancer cell line	Male
CVCL_8393	OU-AML-3	Cancer cell line	Male
CVCL_8394	OU-AML-4	Cancer cell line	Male
CVCL_8395	OU-AML-5	Cancer cell line	Male
CVCL_8396	OU-AML-6	Cancer cell line	Male
CVCL_8397	OU-AML-7	Cancer cell line	Male

Clinical trials (associated diseases)

155 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04234971	PHASE4	RECRUITING	Cost Effectiveness in Alveolar Bone Grafting in Patients With Cleft Lip and Palate
NCT04771156	PHASE4	RECRUITING	Ketorolac in Palatoplasty
NCT00417066	PHASE4	COMPLETED	Flexible GnRH Antagonist vs Flare up GnRH Agonist Protocol in Poor Responders
NCT00732693	PHASE4	COMPLETED	Evaluation of Physiologic and Standard Sex Steroid Replacement Regimens in Women With Premature Ovarian Failure
NCT00837616	PHASE4	COMPLETED	Estrogen Dosing in Turner Syndrome: Pharmacology and Metabolism
NCT01853501	PHASE4	UNKNOWN	Effects of ADSC Therapy in Women With POF
NCT02783937	PHASE4	COMPLETED	Filgrastim for Premature Ovarian Insufficiency
NCT03535480	PHASE4	UNKNOWN	Autologous Bone Marrow Stem Cell Ovarian Transplantation to Restore Ovarian Function in Premature Ovarian Failure
NCT03766217	PHASE3	COMPLETED	Bone Tissue Engineering With Dental Pulp Stem Cells for Alveolar Cleft Repair
NCT06284434	PHASE3	RECRUITING	Liposomal Bupivacaine Use in Alveolar Bone Graft Patients
NCT00140998	PHASE3	COMPLETED	Estrogen Treatment (Oral vs. Patches) in Turner Syndrome
NCT00930124	PHASE2	COMPLETED	Cleft Orthognathic Surgery Versus Distraction Osteogenesis - Which is Better?
NCT00001951	PHASE2	COMPLETED	Hormone Replacement in Young Women With Premature Ovarian Failure
NCT00370019	PHASE2	WITHDRAWN	Effects of an Estrogen Replacement Therapy Skin Patch on Ovulation in Women With Premature Ovarian Failure
NCT00429494	PHASE2	COMPLETED	GnRH Analogue for Ovarian Function Preservation in Hematopoietic Stem Cell Transplantation Patients
NCT03816852	PHASE2	SUSPENDED	The Safety and Efficiency Study of Mesenchymal Stem Cell (19#iSCLife®-POI) in Premature Ovarian Insufficiency
NCT04536467	PHASE2	UNKNOWN	Prevention of Chemotherapy-Induced Ovarian Failure With Goserelin in Premenopausal Lymphoma Patients
NCT06117982	PHASE2	COMPLETED	The Impact of Granulocyte Colony Stimulating Factor on Premature Ovarian Insufficiency
NCT02912104	PHASE1	COMPLETED	A Therapeutic Trial of Human Amniotic Epithelial Cells Transplantation for Primary Ovarian Failure
NCT03178695	PHASE1	COMPLETED	Inovium Ovarian Rejuvenation Trials
NCT04815213	PHASE1	ACTIVE_NOT_RECRUITING	The Use of Expandeded Mesenchymal Stromal Cells (MSC) in Premature Ovarian Failure (POF) in Adult Humans
NCT05138367	PHASE1	COMPLETED	Effects of UCA-PSCs in Women With POF
NCT06132542	PHASE1	UNKNOWN	Autologous ADMSC Transplantation in Patients With POI
NCT06408337	PHASE1/PHASE2	RECRUITING	Phase I-IIa, to Evaluate the Safety, Feasibility, and Efficacy of the Use of BIOCLEFT in the Treatment of Cleft Palate.
NCT00070811	Not specified	COMPLETED	Assessing the Results of Lip Surgery in Patients With Cleft Lip and Palate
NCT00156442	Not specified	COMPLETED	A Study to Examine the Relationship Between Sleep Apnea and Cleft Lip/Palate
NCT01601171	Not specified	RECRUITING	Genetics of Reproductive Disorders (Including Kallmann Syndrome) and Cleft Lip and/or Palate
NCT01871623	Not specified	UNKNOWN	One-Piece Le Fort I Osteotomy Versus Segmental Le Fort I Osteotomy
NCT01932164	Not specified	COMPLETED	Use of Mesenchymal Stem Cells for Alveolar Bone Tissue Engineering for Cleft Lip and Palate Patients
NCT02702869	Not specified	ENROLLING_BY_INVITATION	Allied Cleft & Craniofacial Quality-Improvement and Research Network (ACCQUIREnet)
NCT02789787	Not specified	COMPLETED	Clinical Effectiveness of Late Maxillary Protraction for Cleft Lip and Palate
NCT02845193	Not specified	COMPLETED	Effect of Novel Nasoalveolar Molding Techniques on Parents’ Satisfaction and Short Term Treatment Outcomes in Unilateral Cleft Lip and Palate Infants: A Randomized Controlled Trial
NCT02881606	Not specified	COMPLETED	Evaluation of the Clinical Effectiveness of Naso-alveolar Molding (NAM) Versus Computer Aided Design NAM (CAD/NAM) in Infants With Bilateral Cleft Lip and Palate: A Randomized Clinical Trial
NCT03011489	Not specified	UNKNOWN	Parent’s Satisfaction and Evaluation of Postsurgical Outcomes in Unilateral Cleft Lip / Palate Newly Born Infants With / Without Vacuum Formed Nasoalveolar Molding Aligners : A Controlled Clinical Trial
NCT03065686	Not specified	RECRUITING	Identification of Genetic Factors Implicated in Orofacial Cleft Using Whole Exome Sequencing
NCT03165331	Not specified	UNKNOWN	Online Psychosocial Support for Young People With a Visible Difference: A Randomised Control Study
NCT03217890	Not specified	UNKNOWN	the Relationship Between Cleft Lip and / or Palate (Different Types) and ABO Blood Groups.
NCT03308266	Not specified	COMPLETED	Electromyographic Analysis of the Masticatory Muscles in Cleft Lip and Palate Children With Temporomandibular Disorders
NCT03395015	Not specified	COMPLETED	Efficacy of Maxillo-facial Treatment on Cleft Lip and Palate Patients Faces: Aesthetic Considerations
NCT03514563	Not specified	TERMINATED	Three Dimensional Facial Growth Analysis