AKR1E2

Summary

AKR1E2 (aldo-keto reductase family 1 member E2, HGNC:23437) is a protein-coding gene on chromosome 10p15.1, encoding 1,5-anhydro-D-fructose reductase (Q96JD6). Catalyzes the NADPH-dependent reduction of 1,5-anhydro-D-fructose (AF) to 1,5-anhydro-D-glucitol.

The protein encoded by this gene is a member of the aldo-keto reductase superfamily. Members in this family are characterized by their structure (evolutionarily highly conserved TIM barrel) and function (NAD(P)H-dependent oxido-reduction of carbonyl groups). Transcripts of this gene have been reported in specimens of human testis. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 83592 — RefSeq curated summary.

At a glance

• Gene–disease (curated): cataract (Limited, GenCC)
• GWAS associations: 14
• Clinical variants (ClinVar): 176 total — 1 pathogenic
• MANE Select transcript: NM_001040177

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:23437
Approved symbol	AKR1E2
Name	aldo-keto reductase family 1 member E2
Location	10p15.1
Locus type	gene with protein product
Status	Approved
Aliases	MGC10612, HTSP1, htAKR
Ensembl gene	ENSG00000165568
Ensembl biotype	protein_coding
OMIM	617451
Entrez	83592

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 7 protein_coding, 4 protein_coding_CDS_not_defined, 3 nonsense_mediated_decay

ENST00000298375, ENST00000334019, ENST00000345253, ENST00000441590, ENST00000462718, ENST00000463345, ENST00000474119, ENST00000487985, ENST00000525281, ENST00000525572, ENST00000525627, ENST00000532248, ENST00000533295, ENST00000953208

RefSeq mRNA: 3 — MANE Select: NM_001040177 NM_001040177, NM_001271021, NM_001271025

CCDS: CCDS31134, CCDS59209, CCDS59210

Canonical transcript exons

ENST00000298375 — 10 exons

Exon	Start	End
ENSE00001297552	4847148	4847230
ENSE00002184920	4826207	4826363
ENSE00003467052	4841785	4841857
ENSE00003474783	4833350	4833466
ENSE00003520950	4830675	4830842
ENSE00003524393	4847488	4848062
ENSE00003573287	4835675	4835809
ENSE00003591753	4842421	4842504
ENSE00003606022	4839729	4839826
ENSE00003612499	4837459	4837581

Expression profiles

Bgee: expression breadth ubiquitous, 184 present calls, max score 97.84.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 3.6177 / max 153.1154, expressed in 1097 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
103599	1.7636	773
103598	0.8147	431
103601	0.3958	206
103600	0.2565	114
103597	0.2523	113
103596	0.0828	9
103594	0.0389	9
103593	0.0090	3
103595	0.0040	3

Top tissues by expression

238 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
kidney epithelium	UBERON:0004819	97.84	gold quality
cardiac muscle of right atrium	UBERON:0003379	96.31	gold quality
left ventricle myocardium	UBERON:0006566	95.75	gold quality
left testis	UBERON:0004533	92.72	gold quality
right testis	UBERON:0004534	92.37	gold quality
upper arm skin	UBERON:0004263	91.95	gold quality
epithelial cell of pancreas	CL:0000083	91.74	gold quality
testis	UBERON:0000473	90.75	gold quality
myocardium	UBERON:0002349	90.30	gold quality
sperm	CL:0000019	88.45	gold quality
calcaneal tendon	UBERON:0003701	86.78	gold quality
nasal cavity epithelium	UBERON:0005384	86.05	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	85.34	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	84.57	gold quality
cardia of stomach	UBERON:0001162	84.14	silver quality
vena cava	UBERON:0004087	83.70	gold quality
colonic epithelium	UBERON:0000397	83.53	gold quality
vastus lateralis	UBERON:0001379	82.53	gold quality
ventral tegmental area	UBERON:0002691	81.96	gold quality
quadriceps femoris	UBERON:0001377	81.79	gold quality
cerebellar vermis	UBERON:0004720	81.51	silver quality
epithelium of nasopharynx	UBERON:0001951	81.35	gold quality
tendon	UBERON:0000043	81.03	gold quality
epithelium of mammary gland	UBERON:0003244	80.93	silver quality
mammary duct	UBERON:0001765	80.80	silver quality
superficial temporal artery	UBERON:0001614	80.63	gold quality
pons	UBERON:0000988	80.51	silver quality
pharyngeal mucosa	UBERON:0000355	80.41	gold quality
superior vestibular nucleus	UBERON:0007227	79.65	silver quality
corpus callosum	UBERON:0002336	79.56	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.70

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 1)

• results indicate that the expression of human testis aldo-keto reductase, down-regulated in the testicular tumour, is possibly controlled by mitogenic and hormonal signals (PMID:15118078)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
mus_musculus	Akr1e1	ENSMUSG00000045410
rattus_norvegicus	Akr1e2	ENSRNOG00000017165
drosophila_melanogaster	Akr1B	FBGN0086254
caenorhabditis_elegans		WBGENE00009980
caenorhabditis_elegans		WBGENE00009981
caenorhabditis_elegans		WBGENE00012722
caenorhabditis_elegans		WBGENE00012723
caenorhabditis_elegans		WBGENE00015307

Paralogs (16): AKR7A2 (ENSG00000053371), KCNAB2 (ENSG00000069424), AKR1B1 (ENSG00000085662), AKR1A1 (ENSG00000117448), AKR1D1 (ENSG00000122787), AKR1C2 (ENSG00000151632), AKR7A3 (ENSG00000162482), KCNAB1 (ENSG00000169282), KCNAB3 (ENSG00000170049), AKR1C1 (ENSG00000187134), AKR1C3 (ENSG00000196139), AKR1B10 (ENSG00000198074), AKR1C4 (ENSG00000198610), AKR7L (ENSG00000211454), AKR1B15 (ENSG00000227471), AKR1C8 (ENSG00000264006)

Protein

Protein identifiers

1,5-anhydro-D-fructose reductase — Q96JD6 (reviewed: Q96JD6)

Alternative names: Aldo-keto reductase family 1 member C-like protein 2, Aldo-keto reductase family 1 member E2, LoopADR, Testis aldo-keto reductase, Testis-specific protein

All UniProt accessions (5): E9PK93, G3V1C1, H0YCI2, H0YDE8, Q96JD6

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the NADPH-dependent reduction of 1,5-anhydro-D-fructose (AF) to 1,5-anhydro-D-glucitol. Has low NADPH-dependent reductase activity towards 9,10-phenanthrenequinone (in vitro).

Subunit / interactions. Monomer.

Subcellular location. Cytoplasm.

Tissue specificity. Specifically expressed in testis. Expressed in testicular germ cells and testis interstitial cells.

Activity regulation. Inhibited by p-chloromercuribenzoic acid and alkyliodines.

Similarity. Belongs to the aldo/keto reductase family.

Isoforms (5)

UniProt ID	Names	Canonical?
Q96JD6-1	1	yes
Q96JD6-2	2, HTSP2, htAKR2
Q96JD6-3	3, HTSP1, htAKR1
Q96JD6-4	4, HTSP4, htAKR4
Q96JD6-5	5, HTSP3, htAKR3

RefSeq proteins (3): NP_001035267, NP_001257950, NP_001257954 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR018170	Aldo/ket_reductase_CS	Conserved_site
IPR020471	AKR	Family
IPR023210	NADP_OxRdtase_dom	Domain
IPR036812	NAD(P)_OxRdtase_dom_sf	Homologous_superfamily
IPR044484	AKR1E2	Family

Pfam: PF00248

Catalyzed reactions (Rhea), 1 shown:

• 1,5-anhydro-D-glucitol + NADP(+) = 1,5-anhydro-D-fructose + NADPH + H(+) (RHEA:20665)

UniProt features (14 total): splice variant 4, binding site 4, sequence variant 2, chain 1, active site 1, sequence conflict 1, site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96JD6-F1	93.51	0.89

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 40 (proton donor); 69 (lowers pka of active site tyr)

Ligand- & substrate-binding residues (4): 35; 102; 194; 265–277

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-70221	Glycogen breakdown (glycogenolysis)

MSigDB gene sets: 92 (showing top): GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_GENERATION_OF_PRECURSOR_METABOLITES_AND_ENERGY, GOBP_POLYSACCHARIDE_CATABOLIC_PROCESS, SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM5, GOBP_CARBOHYDRATE_METABOLIC_PROCESS, GOBP_CARBOHYDRATE_CATABOLIC_PROCESS, COATES_MACROPHAGE_M1_VS_M2_DN, GOMF_OXIDOREDUCTASE_ACTIVITY_ACTING_ON_CH_OH_GROUP_OF_DONORS, chr10p15, REACTOME_METABOLISM_OF_CARBOHYDRATES_AND_CARBOHYDRATE_DERIVATIVES, GOBP_ENERGY_RESERVE_METABOLIC_PROCESS, REACTOME_GLYCOGEN_BREAKDOWN_GLYCOGENOLYSIS, MIKKELSEN_ES_ICP_WITH_H3K4ME3, MIKKELSEN_NPC_ICP_WITH_H3K4ME3

GO Biological Process (1): glycogen catabolic process (GO:0005980)

GO Molecular Function (3): aldose reductase (NADPH) activity (GO:0004032), oxidoreductase activity (GO:0016491), 1,5-anhydro-D-fructose reductase activity (GO:0050571)

GO Cellular Component (2): cytosol (GO:0005829), cytoplasm (GO:0005737)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Glycogen metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
glycogen metabolic process	1
glucan catabolic process	1
alcohol dehydrogenase (NADP+) activity	1
catalytic activity	1
oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor	1
cytoplasm	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

1012 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
AKR1E2	WDR87	Q6ZQQ6	596
AKR1E2	FAM162B	Q5T6X4	508
AKR1E2	MFSD6L	Q8IWD5	499
AKR1E2	RNLS	Q5VYX0	492
AKR1E2	ZPLD1	Q8TCW7	491
AKR1E2	GALNTL6	Q49A17	479
AKR1E2	DMRT3	Q9NQL9	478
AKR1E2	KCNAB3	O43448	462
AKR1E2	AKR7A3	O95154	462
AKR1E2	HS6ST3	Q8IZP7	462
AKR1E2	AKR7A2	O43488	438
AKR1E2	EDC4	Q6P2E9	437
AKR1E2	SORCS1	Q8WY21	433
AKR1E2	ANO2	Q9NQ90	430
AKR1E2	DUOX2	Q9NRD8	416

IntAct

0 interactions, top by confidence:

BioGRID (1): AKR1E2 (Affinity Capture-MS)

ESM2 similar proteins: C9JRZ8, M9PF61, O08782, O14088, O60218, O70473, O80944, P02532, P07943, P0DXG9, P14550, P15121, P15122, P16116, P17264, P21300, P28475, P31210, P45376, P45377, P47137, P50578, P51635, P51857, P80276, P82125, Q0PGJ6, Q28FD1, Q3L181, Q3ZCJ2, Q4DJ07, Q4R802, Q54NZ7, Q568L5, Q5R5D5, Q5RJP0, Q5U1Y4, Q5ZK84, Q6AZW2, Q6GMC7

Diamond homologs: A0PQ11, A0QJ99, A0QL30, A0QV09, A0QV10, A1KMW6, A1T726, A1UEC5, A1UEC6, A2Q8B5, A3PXS9, A3PXT0, A4TE41, A5U6Y1, B2HIJ9, B8N195, B8ZS00, C5FFQ7, D3ZF77, H9JTG9, M9PF61, O32210, O34678, O42888, O69462, O70473, O80944, P05980, P06632, P07943, P14065, P14550, P15121, P15122, P15339, P16116, P22045, P23901, P27800, P28475

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

176 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	67
Likely benign	14
Benign	79

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
253524	GRCh37/hg19 10p15.3-14(chr10:2593113-8484746)x1	Pathogenic

SpliceAI

1830 predictions. Top by Δscore:

Variant	Effect	Δscore
10:4826384:G:T	donor_gain	1.0000
10:4830670:TGCA:T	acceptor_loss	1.0000
10:4830672:CA:C	acceptor_loss	1.0000
10:4830673:A:AG	acceptor_gain	1.0000
10:4830673:A:G	acceptor_loss	1.0000
10:4830673:AG:A	acceptor_gain	1.0000
10:4830674:G:GT	acceptor_gain	1.0000
10:4830674:GG:G	acceptor_gain	1.0000
10:4830801:G:GT	donor_gain	1.0000
10:4830839:TAAGG:T	donor_loss	1.0000
10:4830841:AGGT:A	donor_loss	1.0000
10:4830843:G:GA	donor_loss	1.0000
10:4833349:GCT:G	acceptor_gain	1.0000
10:4833477:G:GG	donor_gain	1.0000
10:4835650:A:AG	acceptor_gain	1.0000
10:4835651:C:G	acceptor_gain	1.0000
10:4842418:CA:C	acceptor_loss	1.0000
10:4842419:A:AC	acceptor_loss	1.0000
10:4842419:A:AG	acceptor_gain	1.0000
10:4842420:G:GT	acceptor_gain	1.0000
10:4842420:GA:G	acceptor_gain	1.0000
10:4842420:GAT:G	acceptor_gain	1.0000
10:4842420:GATT:G	acceptor_gain	1.0000
10:4842420:GATTT:G	acceptor_gain	1.0000
10:4842502:CAGG:C	donor_loss	1.0000
10:4842504:GGTA:G	donor_loss	1.0000
10:4842505:GTA:G	donor_loss	1.0000
10:4826360:G:GT	donor_gain	0.9900
10:4826361:A:T	donor_gain	0.9900
10:4826383:G:GT	donor_gain	0.9900

AlphaMissense

2142 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:4837513:T:C	F172L	0.977
10:4837515:C:A	F172L	0.977
10:4837515:C:G	F172L	0.977
10:4835804:T:A	W152R	0.964
10:4835804:T:C	W152R	0.964
10:4830828:T:C	F65L	0.955
10:4830830:C:A	F65L	0.955
10:4830830:C:G	F65L	0.955
10:4847164:T:C	L285S	0.954
10:4847513:T:C	F316L	0.951
10:4847515:C:A	F316L	0.951
10:4847515:C:G	F316L	0.951
10:4835806:G:C	W152C	0.950
10:4835806:G:T	W152C	0.950
10:4830711:G:C	A26P	0.948
10:4842433:T:C	F256L	0.946
10:4842435:T:A	F256L	0.946
10:4842435:T:G	F256L	0.946
10:4842431:G:C	R255P	0.937
10:4830730:G:C	R32P	0.933
10:4837529:T:C	L177P	0.933
10:4837507:T:C	S170P	0.932
10:4833401:A:C	S87R	0.930
10:4833403:T:A	S87R	0.930
10:4833403:T:G	S87R	0.930
10:4839735:T:C	C197R	0.925
10:4839776:C:G	C210W	0.923
10:4833453:C:A	P104H	0.919
10:4839771:T:C	F209L	0.919
10:4839773:T:A	F209L	0.919

dbSNP variants (sampled 300 via entrez): RS1000069193 (10:4840644 A>G), RS1000103750 (10:4850900 T>C), RS1000123739 (10:4845238 C>A,G), RS1000201327 (10:4830188 A>G), RS1000201710 (10:4860185 T>A), RS1000231821 (10:4867825 C>G), RS1000272290 (10:4841513 G>A), RS1000311747 (10:4824450 A>T), RS1000322991 (10:4845803 CCATCCTCAGGCAGTGAGACAGGA>C), RS1000411800 (10:4845102 G>A), RS1000421131 (10:4829936 A>G), RS1000461909 (10:4872254 C>A,T), RS1000496397 (10:4848386 T>C), RS1000509617 (10:4846474 G>T), RS1000575564 (10:4845683 G>A)

Disease associations

OMIM: gene MIM:617451 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
cataract	Limited	Autosomal recessive

Mondo (1): cataract (MONDO:0005129)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

14 associations (top):

Study	Trait	p-value
GCST000738_3	Neonatal lupus	7.000000e-06
GCST002435_2	Body mass index	3.000000e-06
GCST002550_13	Allergic rhinitis	5.000000e-09
GCST002550_14	Allergic rhinitis	1.000000e-06
GCST012228_388	Waist-hip index	4.000000e-12
GCST012228_389	Waist-hip index	2.000000e-08
GCST012228_390	Waist-hip index	1.000000e-12
GCST012228_391	Waist-hip index	4.000000e-10
GCST012229_76	Hip index	7.000000e-09
GCST012229_77	Hip index	4.000000e-10
GCST012229_78	Hip index	6.000000e-10
GCST012230_66	Waist-to-hip ratio adjusted for BMI	1.000000e-10
GCST012230_67	Waist-to-hip ratio adjusted for BMI	7.000000e-12
GCST012230_68	Waist-to-hip ratio adjusted for BMI	4.000000e-09

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008039	BMI-adjusted hip circumference

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D002386	Cataract	C11.510.245

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

Binding affinities (BindingDB)

69 measured of 69 human assays (69 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
(R)-2-(4-(6-fluoronaphthalen-2-yl)-2-methylphenyl)-4,4-dimethyl-1-((1-(1-methylcyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	25.1 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-2-(3-fluoro-4’-(1-methyl-1H-pyrazol-4-yl)-[1,1’-biphenyl]-4-yl)-4,4-dimethyl-1-((1-(1-methylcyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	41.7 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(isoquinolin-6-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	47.9 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
2-(4-(6-fluoronaphthalen-2-yl)-2-methylphenyl)-4,4-dimethyl-1-((1-(1-methylcyclopropanecarbonyl)azetidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	50.1 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(6-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	52.5 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(8-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	53.7 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-4,4-dimethyl-2-(3-methyl-4’-(1-methyl-1H-pyrazol-4-yl)-[1,1’-biphenyl]-4-yl)-1-((1-(1-methylcyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	53.7 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
3-[[(3R)-1-(cyclopropanecarbonyl)pyrrolidin-3-yl]methyl]-5,5-dimethyl-2-(4-quinolin-7-ylphenyl)imidazol-4-one	IC50	56.2 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
2-(2-fluoro-4-(6-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1-((1-(1-methylcyclopropanecarbonyl)azetidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	58.9 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(quinolin-7-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	63.1 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(4-(6-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	67.6 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-2-(2-fluoro-4-(1-methyl-1H-indazol-5-yl)phenyl)-4,4-dimethyl-1-((1-(1-methylcyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	67.6 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(1H-indol-3-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	69.2 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(4-(isoquinolin-6-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	72.4 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(4-(8-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	74.1 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
4,4-dimethyl-2-(3-methyl-4’-(1-methyl-1H-pyrazol-4-yl)-[1,1’-biphenyl]-4-yl)-1-((1-(1-methylcyclopropanecarbonyl)azetidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	87.1 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(3-fluoro-4’-(1-methyl-1H-pyrazol-4-yl)-[1,1’-biphenyl]-4-yl)-4,4-dimethyl-1H-imidazol-5 (4H)-one	IC50	107 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-4,4-dimethyl-2-(2-methyl-4-(1-methyl-1H-indazol-5-yl)phenyl)-1-((1-(1-methylcyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	110 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(3-fluoro-4-(1-methyl-1H-pyrazol-4-yl)-[1,1’-biphenyl]-4-yl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	112 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
2-(2-fluoro-4-(6-fluoronaphthalen-2-yl)phenyl)-1-((1-(1-hydroxycyclopropanecarbonyl)azetidin-3-yl)methyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	120 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(3-fluoro-4’-(pyridin-4-yl)-[1,1’-biphenyl]-4-yl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	126 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(4RS)-2-(4-(1H-Indol-5-yl)phenyl)-1-(((R)-1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4-methyl-4-phenyl-1H-imidazol-5(4H)-one	IC50	129 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
3-[[(3R)-1-(cyclopropanecarbonyl)pyrrolidin-3-yl]methyl]-2-[4-(1H-indol-5-yl)phenyl]-5,5-dimethylimidazol-4-one	IC50	138 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(2-fluoro-4-(quinolin-7-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	155 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-4,4-dimethyl-2-(2-methyl-4-(1-methyl-1H-benzo[d]imidazol-5-yl)phenyl)-1-((1-(1-methylcyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	158 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
4,4-dimethyl-2-(2-methyl-4-(1-methyl-1H-benzo[d]imidazol-5-yl)phenyl)-1-((1-(1-methylcyclopropanecarbonyl)azetidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	174 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4,4-dimethyl-2-(4’-(pyridin-4-yl)-[1,1’-biphenyl]-4-yl)-1H-imidazol-5(4H)-one	IC50	178 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(quinazolin-7-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	224 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(4-(6-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	240 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(2-fluoro-4-(8-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	251 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(3-fluoro-4’-(pyridin-4-yl)-[1,1’-biphenyl]-4-yl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	269 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(2-fluoro-4-(6-fluoronaphthalen-2-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	282 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(quinolin-5-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	302 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
3-[[(3R)-1-(cyclopropanecarbonyl)pyrrolidin-3-yl]methyl]-2-[2-fluoro-4-(1-methylindazol-5-yl)phenyl]-5,5-dimethylimidazol-4-one	IC50	324 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-2-(2-fluoro-4-(1H-indazol-3-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	331 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
3-[[1-(cyclopropanecarbonyl)azetidin-3-yl]methyl]-2-[4-(8-fluoronaphthalen-2-yl)phenyl]-5,5-dimethylimidazol-4-one	IC50	347 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-4,4-dimethyl-2-(4-(quinolin-7-yl)phenyl)-1H-imidazol-5(4H)-one	IC50	355 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-2-(4-(benzo[d]thiazol-2-yl)-2-fluorophenyl)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	355 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
4,4-dimethyl-2-(2-methyl-4-(1-methyl-1H-indazol-5-yl)phenyl)-1-((1-(1-methylcyclopropanecarbonyl)azetidin-3-yl)methyl)-1H-imidazol-5(4H)-one	IC50	363 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(4RS)-2-(4-(Benzofuran-5-yl)phenyl)-1-(((R)-1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4-(methoxymethyl)-4-methyl-1H-imidazol-5(4H)-one	IC50	389 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(4-(isoquinolin-6-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	389 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(4RS)-1-(((R)-1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4-methyl-2-(4-(1-methyl-1H-indazol-5-yl)phenyl)-4-phenyl-1H-imidazol-5(4H)-one	IC50	417 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(3-fluoro-4’-(1-methyl-1H-pyrazol-4-yl)-[1,1’-biphenyl]-4-yl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	417 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-2-(4-(benzo[d]oxazol-2-yl)-2-fluorophenyl)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	437 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-2-(4-(benzofuran-5-yl)phenyl)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	468 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4,4-dimethyl-2-(4-(quinolin-5-yl)phenyl)-1H-imidazol-5(4H)-one	IC50	468 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(2-fluoro-4-(isoquinolin-6-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	468 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(R)-1-((1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4,4-dimethyl-2-(4-(quinazolin-7-yl)phenyl)-1H-imidazol-5(4H)-one	IC50	479 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
(4RS)-2-(4-(Benzofuran-5-yl)phenyl)-1-(((R)-1-(cyclopropanecarbonyl)pyrrolidin-3-yl)methyl)-4-methyl-4-phenyl-1H-imidazol-5(4H)-one	IC50	537 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer
1-((1-(cyclopropanecarbonyl)azetidin-3-yl)methyl)-2-(2-fluoro-4-(1H-indol-3-yl)phenyl)-4,4-dimethyl-1H-imidazol-5(4H)-one	IC50	550 nM	US-9718813: Imidazolin-5-one derivative useful as FASN inhibitors for the treatment of cancer

CTD chemical–gene interactions

18 total (human), top 18 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, increases methylation	4
triphenyl phosphate	affects expression	1
bisphenol A	increases expression	1
beta-lapachone	decreases expression, increases expression	1
nickel sulfate	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
abrine	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
jinfukang	increases expression	1
Arsenic	affects methylation	1
Benzo(a)pyrene	affects methylation, decreases methylation	1
Diethylhexyl Phthalate	increases expression	1
Malathion	decreases expression	1
Ozone	decreases expression, increases abundance	1
Tobacco Smoke Pollution	increases expression	1
Urethane	decreases expression	1
Particulate Matter	decreases expression	1
Soot	increases abundance, decreases expression	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00273221	PHASE4	UNKNOWN	Combined Phacotube vs Phacotrabeculectomy:A Randomized Controlled Trial
NCT00312299	PHASE4	COMPLETED	Posterior Capsule Opacification Study
NCT00345046	PHASE4	COMPLETED	A Comparison of Three Different Formulations of Prednisolone Acetate 1%
NCT00347243	PHASE4	COMPLETED	Wavefront Analisys and Contrast Sensitivity of Spherical and Aspherical Intraocular Lenses
NCT00347503	PHASE4	COMPLETED	Aqueous Concentrations and PGE2 Inhibition of Ketorolac 0.4% vs. Bromfenac 0.09% in Cataract Patients
NCT00348244	PHASE4	COMPLETED	Ketorolac vs. Steroid in the Prevention of CME
NCT00348270	PHASE4	COMPLETED	Comparison of the Quality of Vision Provided by AMO Tecnis Z9000 and Alcon Laboratories MA60 Acrysof Posterior Chamber Intraocular Lenses
NCT00348582	PHASE4	COMPLETED	Acular LS vs. Nevanac in Post op Inflammation Following Cataract Surgery
NCT00348621	PHASE4	COMPLETED	A Study of Interventions to Reduce Disability From Visual Loss in Nursing Home Residents
NCT00349583	PHASE4	COMPLETED	Efficacy of Topical Cyclosporine Versus Tears for Improving Visual Outcomes Following Multifocal IOL Implantation
NCT00355446	PHASE4	COMPLETED	Bioavailability of Bimatoprost Ophthalmic Solution in Human Aqueous.
NCT00386438	PHASE4	COMPLETED	Efficacy of Honan Balloon in Intraocular Pressure Reduction Before Phacoemulsification
NCT00392275	PHASE4	COMPLETED	Penetrance of Third Generation Fluoroquinolones in Eyes With Functioning Filtering Blebs
NCT00428363	PHASE4	COMPLETED	Effect of Optic Edge Design in a Silicone Intraocular Lens on Posterior Capsule Opacification
NCT00449267	PHASE4	COMPLETED	Aurolab Hydrophobic Foldable Intraocular Lens Study
NCT00459303	PHASE4	COMPLETED	Comparison of Functional Vision Provided by AMO Tecnis Z9000 and Alcon SA60AT Acrysof
NCT00469690	PHASE4	COMPLETED	Aqueous Concentrations and PGE2 Inhibition of Ketorolac 0.4% vs. Bromfenac 0.09% in Cataract Patients: Trough Drug Effects
NCT00576485	PHASE4	COMPLETED	Spherical Aberration and Contrast Sensitivity in IOLs
NCT00612729	PHASE4	COMPLETED	Light Filters in Intraocular Lenses (IOLs) and Its Influence on Colour and Contrast Vision.
NCT00612781	PHASE4	COMPLETED	Yellow Versus White Study
NCT00630019	PHASE4	COMPLETED	Ocular Tissue Levels of 1.5% Levofloxacin Ophthalmic Solution Compared to an Active Comparator
NCT00673803	PHASE4	COMPLETED	Influence of Two Different Preloaded Intraocular Lens (IOLs) on Posterior Capsule Opacification
NCT00684138	PHASE4	COMPLETED	ACRYSOF® ReSTOR® Aspheric +3.0 D Add Power Intraocular Lens (IOL)
NCT00698724	PHASE4	COMPLETED	Comparing Optical Coherence Tomography (OCT) and Visual Acuity Outcomes in Subjects Undergoing Cataract Surgery, Who Receive Xibrom Ophthalmic Solution and Standard Presurgical Care vs. Xibrom Ophthalmic Solution Plus Prednisolone Acetate 1% and Standard Presurgical Care
NCT00710905	PHASE4	TERMINATED	Visual Function With Contralateral AcrySof® ReSTOR® Aspheric SN6AD1 and SN6AD3
NCT00710931	PHASE4	COMPLETED	Visual Function With Bilateral AcrySof® ReSTOR® Aspheric SN6AD1
NCT00711347	PHASE4	COMPLETED	Intraoperative Floppy Iris Syndrome
NCT00712244	PHASE4	COMPLETED	DisCoVisc Versus DuoVisc, Healon5 and AmVisc Plus
NCT00717080	PHASE4	COMPLETED	The Role of Capsular Tension Ring (CTR) in Anterior Capsular Contraction
NCT00719732	PHASE4	COMPLETED	Visual Function After Implantation of Bilateral AcrySof ReSTOR Aspheric +3
NCT00721253	PHASE4	COMPLETED	Visual Outcomes of Subjects Bilaterally Implanted With ReSTOR Aspheric +4 vs. Tecnis or Acri.LISA
NCT00731640	PHASE4	COMPLETED	Contralateral ReSTOR / Monofocal or Phakic Eye
NCT00732030	PHASE4	COMPLETED	Low Cylinder Toric
NCT00758199	PHASE4	COMPLETED	Determination of Optimum Duration of Treatment With Bromfenac (Xibrom) Eyedrops Following Cataract Surgery
NCT00760058	PHASE4	WITHDRAWN	Visual Outcome and Visual Quality After Bilateral Implantation of the AcrySof® IQ IOL Compared to MI60® and Tecnis® IOL
NCT00760487	PHASE4	COMPLETED	Visual Function After Implantation of Bilateral AcrySof® Toric Natural Intraocular Lens
NCT00761488	PHASE4	WITHDRAWN	Recommendations for Monitoring Clinical Experience Following Implantation of the AcrySof® Toric
NCT00763360	PHASE4	COMPLETED	To Compare the Ability of DiscoVisc® OVD to Protect the Corneal Endothelium and Maintain Anterior Chamber Space With Healon® and Amvisc® PLUS During Cataract Surgery.
NCT00786370	PHASE4	COMPLETED	Dexmedetomidine vs. Propofol for Cataract Surgery
NCT00786565	PHASE4	COMPLETED	Clinical Evaluation of a New Aspheric Intraocular Lens.