AMACR

Summary

AMACR (alpha-methylacyl-CoA racemase, HGNC:451) is a protein-coding gene on chromosome 5p13.2, encoding Alpha-methylacyl-CoA racemase (Q9UHK6). Catalyzes the interconversion of (R)- and (S)-stereoisomers of alpha-methyl-branched-chain fatty acyl-CoA esters.

This gene encodes a racemase. The encoded enzyme interconverts pristanoyl-CoA and C27-bile acylCoAs between their (R)- and (S)-stereoisomers. The conversion to the (S)-stereoisomers is necessary for degradation of these substrates by peroxisomal beta-oxidation. Encoded proteins from this locus localize to both mitochondria and peroxisomes. Mutations in this gene may be associated with adult-onset sensorimotor neuropathy, pigmentary retinopathy, and adrenomyeloneuropathy due to defects in bile acid synthesis. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the upstream neighboring C1QTNF3 (C1q and tumor necrosis factor related protein 3) gene.

Source: NCBI Gene 23600 — RefSeq curated summary.

At a glance

• Gene–disease (curated): alpha-methylacyl-CoA racemase deficiency (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 1
• Clinical variants (ClinVar): 328 total — 2 pathogenic, 3 likely-pathogenic (top 10% of genes corpus-wide)
• GTEx eGene: eQTL in 47 tissues, sQTL in 50 (q < 0.05)
• Phenotypes (HPO): 59
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.24 (unconstrained)
• MANE Select transcript: NM_014324

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:451
Approved symbol	AMACR
Name	alpha-methylacyl-CoA racemase
Location	5p13.2
Locus type	gene with protein product
Status	Approved
Aliases	RACE, P504S
Ensembl gene	ENSG00000242110
Ensembl biotype	protein_coding
OMIM	604489
Entrez	23600

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 8 protein_coding, 3 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000335606

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 5, TSL 5: 1

ENST00000335606, ENST00000382072, ENST00000382085, ENST00000502637, ENST00000506639, ENST00000514195, ENST00000926930, ENST00000993570, ENST00000993571, ENST00001013205, ENST00001106474, ENST00001132080

RefSeq mRNA: 3 — MANE Select: NM_014324 NM_001167595, NM_014324, NM_203382

CCDS: CCDS3902, CCDS3903, CCDS54836

Canonical transcript exons

ENST00000335606 — 5 exons

Exon	Start	End
ENSE00001816051	33986165	33989502
ENSE00001953485	34007773	34008050
ENSE00004810585	34005756	34005899
ENSE00004810587	33998641	33998827
ENSE00004810593	34004574	34004734

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 94.88.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 7.7445 / max 491.4051, expressed in 1695 samples.

Highest expression (Bgee): adult mammalian kidney, rectum, kidney, liver, mucosa of transverse colon.

Genetic regulation across tissues (GTEx eQTL / sQTL)

AMACR is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 47 tissues and its splicing (sQTL) in 50 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 97 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Muscle Skeletal	eqtl	1.2e-218	+0.78	5:34008101:CCGGCGCCACGCCCCCAGCCG:C
Cells Cultured fibroblasts	eqtl	1.2e-152	+0.88	5:34008101:CCGGCGCCACGCCCCCAGCCG:C
Artery Tibial	sqtl	2.2e-135	-2.69	5:33994077:T:C
Artery Tibial	eqtl	3.3e-117	+0.76	5:34005309:C:CT
Nerve Tibial	eqtl	3.5e-117	+0.73	5:34004602:C:T
Adipose Subcutaneous	eqtl	2.8e-112	+0.69	5:34008101:CCGGCGCCACGCCCCCAGCCG:C
Cells Cultured fibroblasts	sqtl	3.0e-107	-2.75	5:33994077:T:C
Thyroid	sqtl	7.9e-96	-2.39	5:33994077:T:C
Whole Blood	eqtl	2.8e-94	+1.02	5:34001220:G:A
Esophagus Muscularis	eqtl	1.4e-91	+0.61	5:34008101:CCGGCGCCACGCCCCCAGCCG:C
Adipose Subcutaneous	sqtl	7.6e-87	-2.41	5:33994077:T:C
Skin Sun Exposed Lower leg	sqtl	3.0e-86	-2.50	5:33994077:T:C
Esophagus Muscularis	sqtl	3.6e-86	-2.64	5:33994077:T:C
Testis	sqtl	6.7e-81	-1.19	5:34004602:C:T
Thyroid	eqtl	3.9e-78	+0.54	5:33996349:C:T
Esophagus Mucosa	sqtl	6.5e-78	-2.63	5:33994077:T:C
Heart Left Ventricle	eqtl	2.0e-76	+0.70	5:34007995:C:T
Brain Cerebellar Hemisphere	eqtl	2.4e-71	+0.88	5:34007995:C:T
Heart Atrial Appendage	eqtl	3.1e-71	+0.63	5:34004602:C:T
Nerve Tibial	sqtl	1.8e-70	-2.19	5:33994077:T:C

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
61232	5.4118	1609
61233	2.1548	1310
61231	0.1778	45

Top tissues by expression

showing 100 of 134 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
adult mammalian kidney	UBERON:0000082	94.88	gold quality
rectum	UBERON:0001052	93.87	gold quality
kidney	UBERON:0002113	92.22	gold quality
liver	UBERON:0002107	92.18	gold quality
mucosa of transverse colon	UBERON:0004991	91.75	gold quality
right lobe of liver	UBERON:0001114	91.09	gold quality
islet of Langerhans	UBERON:0000006	90.16	gold quality
calcaneal tendon	UBERON:0003701	89.16	gold quality
fundus of stomach	UBERON:0001160	87.86	gold quality
cortex of kidney	UBERON:0001225	87.75	gold quality
gall bladder	UBERON:0002110	87.65	gold quality
body of stomach	UBERON:0001161	87.47	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	87.25	gold quality
duodenum	UBERON:0002114	87.15	gold quality
metanephros cortex	UBERON:0010533	85.95	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	85.83	gold quality
right adrenal gland cortex	UBERON:0035827	85.44	gold quality
stomach	UBERON:0000945	85.38	gold quality
transverse colon	UBERON:0001157	85.08	gold quality
right adrenal gland	UBERON:0001233	84.38	gold quality
hindlimb stylopod muscle	UBERON:0004252	84.11	gold quality
left adrenal gland	UBERON:0001234	83.53	gold quality
left adrenal gland cortex	UBERON:0035825	82.93	gold quality
adrenal gland	UBERON:0002369	82.58	gold quality
adrenal tissue	UBERON:0018303	81.84	gold quality
endometrium	UBERON:0001295	81.83	gold quality
esophagus mucosa	UBERON:0002469	81.52	gold quality
pancreas	UBERON:0001264	81.41	gold quality
cortical plate	UBERON:0005343	81.29	gold quality
colon	UBERON:0001155	81.06	gold quality
prefrontal cortex	UBERON:0000451	80.59	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	80.48	gold quality
lower esophagus mucosa	UBERON:0035834	80.43	gold quality
muscle of leg	UBERON:0001383	80.39	gold quality
Brodmann (1909) area 9	UBERON:0013540	80.38	gold quality
placenta	UBERON:0001987	80.15	gold quality
intestine	UBERON:0000160	79.97	gold quality
hypothalamus	UBERON:0001898	79.94	gold quality
stromal cell of endometrium	CL:0002255	79.81	gold quality
smooth muscle tissue	UBERON:0001135	79.76	gold quality
superior frontal gyrus	UBERON:0002661	79.59	gold quality
muscle tissue	UBERON:0002385	79.53	gold quality
frontal cortex	UBERON:0001870	79.19	gold quality
esophagus	UBERON:0001043	79.13	gold quality
cerebral cortex	UBERON:0000956	79.02	gold quality
gastrocnemius	UBERON:0001388	78.94	gold quality
anterior cingulate cortex	UBERON:0009835	78.92	gold quality
nucleus accumbens	UBERON:0001882	78.81	gold quality
skeletal muscle tissue	UBERON:0001134	78.67	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	78.17	gold quality
caudate nucleus	UBERON:0001873	77.70	gold quality
descending thoracic aorta	UBERON:0002345	77.70	gold quality
temporal lobe	UBERON:0001871	77.61	gold quality
amygdala	UBERON:0001876	77.57	gold quality
body of pancreas	UBERON:0001150	77.50	gold quality
brain	UBERON:0000955	77.47	gold quality
corpus callosum	UBERON:0002336	77.37	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	77.35	gold quality
urinary bladder	UBERON:0001255	77.12	gold quality
putamen	UBERON:0001874	77.07	gold quality
right coronary artery	UBERON:0001625	76.84	gold quality
vagina	UBERON:0000996	76.75	gold quality
right frontal lobe	UBERON:0002810	76.73	gold quality
lower esophagus	UBERON:0013473	76.68	gold quality
ventricular zone	UBERON:0003053	76.62	gold quality
lower esophagus muscularis layer	UBERON:0035833	76.62	gold quality
right atrium auricular region	UBERON:0006631	76.61	gold quality
muscle layer of sigmoid colon	UBERON:0035805	76.47	gold quality
Ammon’s horn	UBERON:0001954	76.07	gold quality
substantia nigra	UBERON:0002038	75.88	gold quality
multicellular organism	UBERON:0000468	75.86	gold quality
small intestine	UBERON:0002108	75.82	gold quality
thoracic aorta	UBERON:0001515	75.81	gold quality
mucosa of stomach	UBERON:0001199	75.58	gold quality
primary visual cortex	UBERON:0002436	75.56	gold quality
ascending aorta	UBERON:0001496	75.55	gold quality
ganglionic eminence	UBERON:0004023	75.51	gold quality
small intestine Peyer’s patch	UBERON:0003454	75.42	gold quality
heart	UBERON:0000948	75.40	gold quality
saliva-secreting gland	UBERON:0001044	75.39	gold quality
prostate gland	UBERON:0002367	75.33	gold quality
popliteal artery	UBERON:0002250	75.23	gold quality
tibial artery	UBERON:0007610	75.22	gold quality
left coronary artery	UBERON:0001626	75.08	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	75.08	gold quality
tonsil	UBERON:0002372	75.06	gold quality
cerebellar cortex	UBERON:0002129	74.86	gold quality
cerebellum	UBERON:0002037	74.84	gold quality
cerebellar hemisphere	UBERON:0002245	74.78	gold quality
right hemisphere of cerebellum	UBERON:0014890	74.64	gold quality
ectocervix	UBERON:0012249	74.39	gold quality
heart left ventricle	UBERON:0002084	74.38	gold quality
minor salivary gland	UBERON:0001830	73.87	gold quality
vermiform appendix	UBERON:0001154	73.83	gold quality
blood	UBERON:0000178	73.80	gold quality
fallopian tube	UBERON:0003889	72.96	gold quality
adenohypophysis	UBERON:0002196	72.92	gold quality
leukocyte	CL:0000738	72.59	gold quality
pituitary gland	UBERON:0000007	72.57	gold quality
lymph node	UBERON:0000029	72.57	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 4.

Experiment	Marker?	Max mean expression
E-CURD-114	yes	352.42
E-MTAB-8495	yes	117.99
E-HCAD-10	yes	32.93
E-ANND-3	yes	4.46

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 71 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Liver	tissue	167.6	medium
Kidney	tissue	124.7	high
Salivary gland	tissue	56.3	low
Rectum	tissue	39.8	medium
Colon	tissue	36.5	medium
Prostate	tissue	35.7	low
Gallbladder	tissue	19.3	low
Skeletal muscle	tissue	17.2	not detected
Duodenum	tissue	16.2	low
Stomach 1	tissue	14.3	low
Esophagus	tissue	14.3	not detected
Small intestine	tissue	14.3	low
Adrenal gland	tissue	14.1	low
Tongue	tissue	12.9
Pancreas	tissue	12.8	low
Parathyroid gland	tissue	12.1	not detected
Seminal vesicle	tissue	11.7	not detected
Retina	tissue	10.6
Locus coeruleus	tissue	9.8
Heart muscle	tissue	9.3	not detected
Spinal cord	tissue	8.9
Epididymis	tissue	8.8	low
Ovary	tissue	8.5	not detected
Lung	tissue	8.3	not detected
Urinary bladder	tissue	8.2	not detected
Medulla oblongata	tissue	7.9
Vagina	tissue	7.7	not detected
Thyroid gland	tissue	7.7	not detected
Cerebellum	tissue	7.4	medium
Placenta	tissue	7.2	not detected
Nucleus accumbens	tissue	7.0
Adipose tissue	tissue	6.9	not detected
Amygdala	tissue	6.9
Basal ganglia	tissue	6.7	not detected
Postcentral gyrus	tissue	6.7
Septum	tissue	6.7
Cerebral cortex	tissue	6.6	low
Frontal cortex	tissue	6.6
Hippocampal formation	tissue	6.5
Ventral forebrain	tissue	6.4
Entorhinal cortex	tissue	6.3
Somatosensory cortex	tissue	6.3
Retrosplenial and cingulate cortex	tissue	6.2
Occipital cortex	tissue	6.1
Olfactory bulb	tissue	6.0
Cervix	tissue	5.9	low
Smooth muscle	tissue	5.9	not detected
Choroid plexus	tissue	5.8
Hypothalamus	tissue	5.8
Pons	tissue	5.7
Substantia nigra	tissue	5.7
Thalamus	tissue	5.6
Breast	tissue	5.5	not detected
Pituitary gland	tissue	5.3
Fallopian tube	tissue	5.3	low
Putamen	tissue	5.2
Corpus callosum	tissue	5.1
Tonsil	tissue	5.1	not detected
Spleen	tissue	5.0	not detected
Caudate putamen	tissue	5.0

Brain sub-regions (HPA Brain Atlas): detected in 186; highest nTPM — Lateral hypothalamic area (12.4), Ventromedial nucleus (11.6), Dorsomedial nucleus (9.5), Lateral funiculus (white matter) (9.2), Arcuate nucleus (8.9).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NR3C1, SP1, ZNF202

miRNA regulators (miRDB)

Targeting AMACR by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 76 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-335-3P	99.93	73.36	4958
HSA-MIR-218-5P	99.93	72.22	2103
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-10523-5P	99.91	69.22	2038
HSA-MIR-1305	99.91	71.43	3443
HSA-MIR-627-3P	99.90	71.42	3316
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-605-3P	99.88	69.22	1833
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-548AR-3P	99.85	71.26	3889
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-498-5P	99.76	69.64	1807
HSA-MIR-4802-3P	99.72	70.13	1273
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-3714	99.71	70.74	2671
HSA-MIR-1197	99.70	67.75	1027
HSA-MIR-646	99.68	67.84	1645
HSA-MIR-1303	99.65	69.77	1662
HSA-MIR-6126	99.62	68.09	996

Functional genomics

gnomAD constraint: pLI 1.02e-05, LOEUF 1.24, missense Z -0.146 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000335606 — one region, missense o/e 1.02.

Literature-anchored findings (GeneRIF, showing 40)

• AMACR was shown to be overexpressed in prostate cancer (PMID:11926890)
• AMACR expression may be a marker of tumor differentiation (PMID:12213712)
• expression in evolving carcinomas within benign prostatic hyperplasia and in cancers of the transition zone (PMID:12673556)
• AMACR was overexpressed in prostate cancer. One AMACR probeset from an alternatively spliced exon had 88% identity to a 521-bp sequence spanning 4 exons of fumarate hydratase. The predicted sequence revealed a new GLGELIL peptide shared by both proteins. (PMID:12810662)
• Data suggest that AMACR is essential for optimal growth of prostate cancer cells in vitro and that this enzyme has the potential to be a complementary target with androgen ablation in PCa treatment. (PMID:14612535)
• AMACR (P504S) has been proven to be one of the few biomarkers that can help distinguish cancer from benign cells, with high sensitivity and specificity for prostate carcinoma (PMID:15323145)
• Results demonstrated the promising features of AMACR as a biomarker for prostate cancer in this large series and the potential to develop automated quantitative diagnostic tests. (PMID:15330799)
• Novel variant of AMACR identified; real time PCR demonstrates that this splice variant is expressed in tumor, normal prostate tissue, and PC3 cell lines (PMID:15880524)
• AMACR protein is expressed in normal breast and its expression seems to increase in invasive carcinomas (PMID:15941950)
• AMACR expression is significantly associated with prostate cancer progression and suggests that not all surrogate end points may be optimal to define biomarkers of aggressive prostate cancer (PMID:15941951)
• AMACR immunoreactivity may be useful in differentiating papillary renal cell carcinoma from metanephric adenoma. (PMID:16424894)
• expression of PSGR and PSGR2 relative to AMACR in prostate cancer; AMACR was the most overexpressed, but in some cases expression of AMACR was not significantly elevated while PSGR and/or PSGR2 were substantially elevated (PMID:16491480)
• Moderate to strong P504S expression in high-grade prostatic intraepithelial neoplasia of biopsy specimens is indicative of an associated adenocarcinoma. (PMID:16506014)
• AMACR immunohistochemical staining has shown the ability to improve detection of small focal prostatic carcinoma that could be missed by conventional histological examination. (PMID:16681682)
• Increase in AMACR expression is associated with prostate cancer (PMID:17067752)
• Expression in prostatic cancer shows a correlation with Gleason severity score. (PMID:17222253)
• AMACR overexpression in colorectal carcinoma is correlated with tumor differentiation. (PMID:17525630)
• AMACR gene variants were unrelated to prostate cancer overall in this study. (PMID:17680641)
• Our results confirm an initial report of association between the AMACR gene and the risk of familial prostate cancer. (PMID:17683075)
• Variants in AMACR associated with advanced distal colorectal adenoma were identified and pointed to potential interactions with iburpofen use. (PMID:17684125)
• Sequence analysis of AMACR cDNA identified a homozygous point mutation (c154T>C). This case adds to the phenotypic variation seen in this peroxisomal disorder. (PMID:18032455)
• promoter function of AMACR is independent of androgen receptor-mediated signaling (PMID:18080842)
• Review about the role of AMACR in the branched-chain fatty amino acids metabolism and its link with cancer. (PMID:18279392)
• AMACR expression may be a new diagnostic marker for dysplasia carcinoma sequence in Barrett’s low-grade neoplastic lesions. (PMID:18500268)
• In a relatively genetically homogenous Tasmanian population, there is evidence for a significant association between variants within the AMACR gene and prostate cancer risk. (PMID:18537123)
• Increased AMACR expression and its association with tumor venous invasion suggest that alpha-Methylacyl-CoA racemase may play a role in hepatocellular carcinoma development and progression. (PMID:18577240)
• Overexpression of alpha-methylacyl-CoA racemase ia a useful parameter for identifying dysplasia in Barrett esophagus. (PMID:18665038)
• AMACR expression in colorectal cancer was significantly associated with tumor grade, stage, non-mucinous phenotype, and left-sided tumor localization. AMACR staining results were unrelated to clinical outcome. (PMID:18712414)
• The high level expression of AMACR in high-grade dysplasia and carcinoma suggests that it may be a useful biomarker in distinguishing high-grade dysplasia and carcinoma from low-grade dysplasia. (PMID:18785113)
• The immunohistochemical profile of clear cell carcinomas of the urinary tract…is positive for P504S (PMID:18788852)
• combined alpha-methylacyl coenzyme A racemase/p53 analysis may represent a helpful tool to confirm dysplasia in inflammatory bowel disease. (PMID:18835622)
• Immunohistochemistry with anti-AMACR/TO63 is useful for detecting prostate cancer in the full range of prostate specimens encountered in needle biopsies. (PMID:19068396)
• deregulation of Alpha-methylacyl-coenzyme A racemase during colon carcinogenesis involves two nonrandom events, resulting in the mutually exclusive existence of double-deletion at CG3 and CG10 and deletion of CG12-16 in a newly identified CpG island (PMID:19148275)
• AMACR immunostaining does not seem to be a useful marker in distinguishing nephrogenic adenoma from prostatic adenocarcinoma (PMID:19384190)
• P504S/AMACR staining might be of great value in cytodiagnosis of prostate lesions (PMID:19459159)
• AMACR showed diffuse or focal positivity in cancer, high-grade prostatic intraepithelial neoplasia, and atypia (PMID:19605815)
• The expression of AMACR is increased in benign sebaceous glands and sebaceous hyperplasia; with decreasing AMACR expression in tumors with less sebaceous differentiation (PMID:19638170)
• marker of differential diagnosis of kidney cancer (PMID:20102405)
• Our study showed that 34betaE12 is the most appropriate negative marker to combine with AMACR as a positive marker for the diagnosis of prostate adenocarcinoma. (PMID:20189848)
• study showed that 34betaE12 is the most appropriate negative marker to combine with alpha-methylacyl coenzyme A racemase as a positive marker for the diagnosis of prostate adenocarcinoma[34betaE12] (PMID:20189848)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	amacr	ENSDARG00000057435
mus_musculus	Amacr	ENSMUSG00000022244
rattus_norvegicus	Amacr	ENSRNOG00000018662
drosophila_melanogaster	Amacr	FBGN0032881
caenorhabditis_elegans		WBGENE00014128
caenorhabditis_elegans		WBGENE00016034

Paralogs (1): SUGCT (ENSG00000175600)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1098273) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 11 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal circulating cholesterol level	1
enlarged liver	1
hepatic necrosis	1
increased circulating alkaline phosphatase level	1
abnormal bile composition	1
increased fatty acids level	1
decreased fatty acids level	1
decreased triglyceride level	1
increased susceptibility to induced morbidity/mortality	1
decreased total body fat amount	1
increased susceptibility to weight loss	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Acetobacter aceti	A9X6P9	66.1%	Diamond
Escherichia coli K-12	P76518	65.4%	Diamond
Hapsidospora chrysogena	Q8J0F0	54.4%	Diamond
Mycobacterium tuberculosis H37Rv	O06543	50.5%	Diamond
Fusarium pseudograminearum CS3096	K3VD64	45.7%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
C1QTNF3-AMACR	ncRNA	100534612
C1QTNF3	protein-coding	114899
SLC45A2	protein-coding	51151
RXFP3	protein-coding	51289
ADAMTS12	protein-coding	81792

Protein

Protein identifiers

Alpha-methylacyl-CoA racemase — Q9UHK6 (reviewed: Q9UHK6)

Alternative names: 2-methylacyl-CoA racemase

All UniProt accessions (2): D6RB81, Q9UHK6

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the interconversion of (R)- and (S)-stereoisomers of alpha-methyl-branched-chain fatty acyl-CoA esters. Acts only on coenzyme A thioesters, not on free fatty acids, and accepts as substrates a wide range of alpha-methylacyl-CoAs, including pristanoyl-CoA, trihydroxycoprostanoyl-CoA (an intermediate in bile acid synthesis), and arylpropionic acids like the anti-inflammatory drug ibuprofen (2-(4-isobutylphenyl)propionic acid) but neither 3-methyl-branched nor linear-chain acyl-CoAs.

Subunit / interactions. Monomer.

Subcellular location. Peroxisome. Mitochondrion.

Disease relevance. Alpha-methylacyl-CoA racemase deficiency (AMACRD) [MIM:614307] A rare autosomal recessive peroxisomal disorder characterized by elevated plasma concentrations of pristanic acid C27-bile-acid intermediates, and adult onset of variable neurodegenerative symptoms affecting the central and peripheral nervous systems. Features may include seizures, visual failure, sensorimotor neuropathy, spasticity, migraine, and white matter hyperintensities on brain imaging. The disease is caused by variants affecting the gene represented in this entry. Congenital bile acid synthesis defect 4 (CBAS4) [MIM:214950] A disorder characterized by the presence of trihydroxycoprostanic acid in the bile and absence of cholic acid. Patients manifest neonatal jaundice, intrahepatic cholestasis and bile duct deficiency. The disease is caused by variants affecting the gene represented in this entry.

Pathway. Lipid metabolism; bile acid biosynthesis. Lipid metabolism; fatty acid metabolism.

Miscellaneous. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay. Expression is elevated in prostate cancer.

Similarity. Belongs to the CoA-transferase III family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q9UHK6-1	1	yes
Q9UHK6-2	2, IBLi
Q9UHK6-4	3
Q9UHK6-5	4

RefSeq proteins (3): NP_001161067, NP_055139, NP_976316 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003673	CoA-Trfase_fam_III	Family
IPR023606	CoA-Trfase_III_dom_1_sf	Homologous_superfamily
IPR044855	CoA-Trfase_III_dom3_sf	Homologous_superfamily
IPR050509	CoA-transferase_III	Family

Pfam: PF02515

Enzyme classification (BRENDA)

• EC 5.1.99.4 — alpha-methylacyl-CoA racemase (BRENDA: 5 organisms, 65 substrates, 143 inhibitors, 18 Km, 12 kcat entries)

Substrate kinetics (BRENDA)

11 substrates with measured Km, best-characterized 11. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
(2R)-IBUPROFENOYL-COA	0.048–0.071	2
(2S)-IBUPROFENOYL-COA	0.086–0.087	2
(R)-2-METHYLDECANOYL-COA	0.277–1.2	2
(S)-2-METHYLDECANOYL-COA	0.614–1.2	2
PRISTANOYL-COA	0.076–0.172	2
TRIHYDROXYCOPROSTANOYL-COA	0.0316–0.06	2
(2S)-2-METHYLDECANOYL-COA	0.277	1
(R)-PRISTANOYL-COA	0.041	1
(S)-KETOPROFENOYL-COA	0.052	1
(S)-NAPROXENOYL-COA	0.068	1
3-FLUORO-2-METHYLDECANOYL-COA	0.021	1

Catalyzed reactions (Rhea)

• a (2S)-2-methylacyl-CoA = a (2R)-2-methylacyl-CoA (RHEA:12657)
• (2R)-pristanoyl-CoA = (2S)-pristanoyl-CoA (RHEA:40447)
• (25R)-3alpha,7alpha,12alpha-trihydroxy-5beta-cholestan-26-oyl-CoA = (25S)-3alpha,7alpha,12alpha-trihydroxy-5beta-cholestan-26-oyl-CoA (RHEA:40455)
• (2R,6)-dimethylheptanoyl-CoA = (2S,6)-dimethylheptanoyl-CoA (RHEA:46732)

UniProt features (34 total): sequence variant 11, sequence conflict 7, splice variant 5, modified residue 4, binding site 3, active site 2, chain 1, short sequence motif 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9UHK6-F1	95.79	0.95

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Isomerase, Metabolic proteins, Predicted intracellular proteins, Plasma proteins, Disease related genes, Potential drug targets, Human disease related genes, Congenital disorders of metabolism, Congenital disorders of lipid/glycolipid metabolism

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): peroxisomes; vesicles; cytosol; plasma membrane

Antibody reliability (HPA): IH enhanced · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2)

Position	Role
122	proton acceptor
152	proton donor

Ligand- & substrate-binding residues (3)

Position	Role
36	substrate
55–58	substrate
121–126	substrate

Post-translational modifications (4)

Type	Positions
N6-succinyllysine	268, 87
N6-acetyllysine	58, 87

Function

Pathways and Gene Ontology

Reactome pathways

3 curated (TAS) of 12; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

12 pathways:

ID	Pathway	Evidence
R-HSA-389887	Beta-oxidation of pristanoyl-CoA	curated
R-HSA-193775	Synthesis of bile acids and bile salts via 24-hydroxycholesterol	curated
R-HSA-193368	Synthesis of bile acids and bile salts via 7alpha-hydroxycholesterol	curated
R-HSA-194068	Bile acid and bile salt metabolism	—
R-HSA-8978868	Fatty acid metabolism	—
R-HSA-1430728	Metabolism	—
R-HSA-556833	Metabolism of lipids	—
R-HSA-8957322	Metabolism of steroids	—
R-HSA-390918	Peroxisomal lipid metabolism	—
R-HSA-9033241	Peroxisomal protein import	electronic
R-HSA-9609507	Protein localization	—
R-HSA-192105	Synthesis of bile acids and bile salts	—

MSigDB gene sets: 321 (showing top): GOBP_LIPID_MODIFICATION, GOBP_FATTY_ACID_CATABOLIC_PROCESS, DACOSTA_UV_RESPONSE_VIA_ERCC3_UP, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_BIOSYNTHETIC_PROCESS, GOBP_BILE_ACID_BIOSYNTHETIC_PROCESS, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, GOBP_FATTY_ACID_BETA_OXIDATION_USING_ACYL_COA_OXIDASE, GARGALOVIC_RESPONSE_TO_OXIDIZED_PHOSPHOLIPIDS_BLUE_DN, GOBP_ORGANIC_ACID_CATABOLIC_PROCESS, TGTGTGA_MIR377, GOBP_MONOCARBOXYLIC_ACID_BIOSYNTHETIC_PROCESS, GOBP_LIPID_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_METABOLIC_PROCESS, GOBP_SMALL_MOLECULE_CATABOLIC_PROCESS

GO Biological Process (4): bile acid biosynthetic process (GO:0006699), bile acid metabolic process (GO:0008206), fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540), fatty acid metabolic process (GO:0006631)

GO Molecular Function (4): signaling receptor binding (GO:0005102), alpha-methylacyl-CoA racemase activity (GO:0008111), catalytic activity (GO:0003824), isomerase activity (GO:0016853)

GO Cellular Component (5): cytoplasm (GO:0005737), mitochondrion (GO:0005739), peroxisome (GO:0005777), peroxisomal matrix (GO:0005782), cytosol (GO:0005829)

Reactome top-level categories

8 top-level categories:

Category	Pathways
Synthesis of bile acids and bile salts	2
Metabolism of lipids	2
Peroxisomal lipid metabolism	1
Protein localization	1
Bile acid and bile salt metabolism	1
Metabolism of steroids	1
Fatty acid metabolism	1
Metabolism	1

GO top-level categories

17 GO namespaces:

Category	Terms
monocarboxylic acid metabolic process	2
cellular anatomical structure	2
cytoplasm	2
bile acid metabolic process	1
monocarboxylic acid biosynthetic process	1
steroid metabolic process	1
fatty acid beta-oxidation	1
lipid metabolic process	1
protein binding	1
racemase and epimerase activity	1
molecular_function	1
catalytic activity	1
intracellular anatomical structure	1
intracellular membrane-bounded organelle	1
microbody	1
peroxisome	1
microbody lumen	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 6 of 13 annotations. The rest are phylogenetic / computational / electronic (IEA).

6 experimentally-supported GO terms:

GO term	NS	Evidence
bile acid metabolic process	BP	direct assay
cytoplasm	CC	direct assay
mitochondrion	CC	direct assay
peroxisome	CC	direct assay
alpha-methylacyl-CoA racemase activity	MF	direct assay
signaling receptor binding	MF	physical interaction

Protein interactions and networks

STRING

showing 15 of 1,231 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
AMACR	OR51E2	Q9H255	899
AMACR	OR51E1	Q8TCB6	843
AMACR	HSD3B7	Q9H2F3	840
AMACR	AKR1D1	P51857	810
AMACR	KLK3	P07288	798
AMACR	KRT7	P08729	793
AMACR	HPN	P05981	726
AMACR	PAX8	Q06710	718
AMACR	MME	P08473	718
AMACR	TMPRSS2	O15393	712
AMACR	KRT20	P35900	702
AMACR	ACOX2	Q99424	702
AMACR	LIAT1	Q6ZQX7	679
AMACR	SLC45A3	Q96JT2	678
AMACR	CA9	Q16790	678

IntAct

Human interaction partners of AMACR in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

2 partners by confidence:

Partner	Interaction type	MIscore	Records
FKBP5	association	0.350	1
VWA8	association	0.350	1

BioGRID (77 interactions; top human partners by supporting records): FKBP5 (Affinity Capture-MS; 2 records), HSP90AA5P (Affinity Capture-MS; 2 records), PSMG3 (Affinity Capture-MS; 2 records), PSMG4 (Affinity Capture-MS; 2 records), AARS2 (Affinity Capture-MS), ACSF2 (Affinity Capture-MS), ACSF3 (Affinity Capture-MS), ADCK4 (Affinity Capture-MS), ALDH18A1 (Affinity Capture-MS), APEX1 (Affinity Capture-RNA), BCKDHA (Affinity Capture-MS), BCKDK (Affinity Capture-MS), CDK5RAP1 (Affinity Capture-MS), CECR5 (Affinity Capture-MS), CLPX (Affinity Capture-MS)

Disease & clinical

Genetic variants

Variant evidence for AMACR: 328 ClinVar records (5 pathogenic / likely pathogenic); 1 GWAS association. Per-variant detail is on Sugi Variant.

ClinVar

328 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	3
Uncertain significance	166
Likely benign	112
Benign	11

Top pathogenic / likely-pathogenic (5)

Showing all 5 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
3534565	NM_014324.6(AMACR):c.643_644insC (p.Gly215fs)	Likely pathogenic	criteria provided, single submitter	1
4541037	NM_014324.6(AMACR):c.740-12_740-2delinsTGGACTTGGACTT	Likely pathogenic	criteria provided, single submitter	1
4969806	NM_014324.6(AMACR):c.247G>A (p.Gly83Ser)	Likely pathogenic	criteria provided, single submitter	1
1460218	NC_000005.9:g.(?33982368)(33991527_?)del	Pathogenic	criteria provided, single submitter	1
3062849	GRCh37/hg19 5p13.2(chr5:33955464-34058555)x1	Pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore AMACR’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 23 predictions of 329):

Position(s)	Effect	Δscore	Sites
5:33989503–33989504	acceptor_loss	1.0000	4
5:33998640	donor_loss	1.0000
5:33998828–33998829	acceptor_loss	1.0000	5
5:33998829–33998830	acceptor_gain	1.0000	2
5:34005754–34005755	donor_loss	1.0000	5
5:34007742	donor_gain	1.0000
5:34007772	donor_loss	1.0000	2
5:33989504	acceptor_loss	0.9900
5:33998640	donor_loss	0.9900
5:33998840	acceptor_gain	0.9900

AlphaMissense

836 missense substitutions predicted likely pathogenic (of 2,486 scored), across 229 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D123	8	0.976	0.995
D152	8	0.970	0.987
H122	8	0.948	0.975
D26	8	0.910	0.962
D214	8	0.891	0.951
F287	8	0.871	0.936
D74	8	0.811	0.913
D181	8	0.740	0.820
F240	7	0.962	0.992
C293	7	0.944	0.988
F110	7	0.931	0.989
F80	7	0.930	0.976
E237	7	0.929	0.973
W283	7	0.927	0.990
W264	7	0.902	0.968
N125	7	0.892	0.990
F219	7	0.884	0.984
F275	7	0.881	0.968
F153	7	0.880	0.966
F315	7	0.849	0.965

HPA cancer prognostics

RNA cancer specificity: Group enriched (Kidney Renal Papillary Cell Carcinoma, Prostate Adenocarcinoma)

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Pancreatic Adenocarcinoma (TCGA)	favorable	0.000156
Kidney Chromophobe (TCGA)	unfavorable	0.000685

Disease associations

OMIM: gene MIM:604489 | disease phenotypes: MIM:214950, MIM:614307

GenCC curated gene-disease

2 curated gene-disease records:

Disease	Classification	Inheritance	Records
alpha-methylacyl-CoA racemase deficiency	Definitive	Autosomal recessive	4
congenital bile acid synthesis defect 4	Strong	Autosomal recessive	2

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

1 validity classifications:

Disease	Classification	Inheritance
alpha-methylacyl-CoA racemase deficiency	Definitive	AR

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (13 panels, 9 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

13 panels:

Panel	Rating
Cholestasis	green
Fetal anomalies	green
Hereditary neuropathy or pain disorder	green
Hypotonic infant	green
Leukodystrophy, childhood onset	green
Likely inborn error of metabolism	green
Peroxisomal disorders	green
Retinal disorders	green
Undiagnosed metabolic disorders	green
Early onset or syndromic epilepsy	amber
Neonatal cholestasis	amber
Paediatric disorders	amber
Unexplained death in infancy and sudden unexplained death in childhood	amber

Mondo (2): congenital bile acid synthesis defect 4 (MONDO:0008967), alpha-methylacyl-CoA racemase deficiency (MONDO:0013681)

Orphanet (1): Congenital bile acid synthesis defect type 4 (Orphanet:79095)

HPO phenotypes

59 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000135	Hypogonadism
HP:0000505	Visual impairment
HP:0000510	Rod-cone dystrophy
HP:0000518	Cataract
HP:0000580	Pigmentary retinopathy
HP:0000716	Depression
HP:0000763	Sensory neuropathy
HP:0000815	Hypergonadotropic hypogonadism
HP:0001081	Cholelithiasis
HP:0001133	Constriction of peripheral visual field
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001257	Spasticity
HP:0001260	Dysarthria
HP:0001268	Mental deterioration
HP:0001269	Hemiparesis
HP:0001298	Encephalopathy
HP:0001328	Specific learning disability
HP:0001337	Tremor
HP:0001347	Hyperreflexia
HP:0001392	Abnormality of the liver
HP:0001399	Hepatic failure
HP:0001406	Intrahepatic cholestasis
HP:0001508	Failure to thrive
HP:0002076	Migraine
HP:0002080	Intention tremor
HP:0002133	Status epilepticus
HP:0002240	Hepatomegaly
HP:0002354	Memory impairment
HP:0002401	Stroke-like episode
HP:0002573	Hematochezia
HP:0002611	Cholestatic liver disease
HP:0002630	Fat malabsorption
HP:0002904	Hyperbilirubinemia
HP:0002910	Elevated circulating hepatic transaminase concentration
HP:0003201	Rhabdomyolysis
HP:0003236	Elevated circulating creatine kinase activity
HP:0003623	Neonatal onset
HP:0003645	Prolonged partial thromboplastin time
HP:0005978	Type II diabetes mellitus
HP:0006579	Prolonged neonatal jaundice
HP:0007141	Sensorimotor neuropathy
HP:0007359	Focal-onset seizure
HP:0008151	Prolonged prothrombin time
HP:0010571	Elevated circulating phytanic acid concentration
HP:0011462	Young adult onset
HP:0011892	Decreased circulating vitamin K concentration
HP:0012053	Decreased circulating calcifediol concentration
HP:0012379	Abnormal circulating enzyme concentration or activity
HP:0030516	Homonymous hemianopia
HP:0030985	Decreased serum bile acid concentration
HP:0031956	Elevated circulating aspartate aminotransferase concentration
HP:0033643	Increased circulating very long-chain fatty acid concentration
HP:0034449	Increased phytanic acid:pristanic acid ratio
HP:0100513	Decreased circulating vitamin E concentration
HP:0100753	Schizophrenia
HP:0200084	Giant cell hepatitis
HP:6000134	Reduced alpha-methylacyl-CoA racemase activity in cultured fibroblasts

GWAS associations

1 associations:

Study	Trait	p-value
GCST007344_77	Estimated glomerular filtration rate	7e-11

MeSH disease descriptors

2 disease descriptors:

Descriptor	Name	Tree numbers
C565768	Alpha-Methylacyl-CoA Racemase Deficiency *(supp.)*
C535444	Bile acid synthesis defect, congenital, 4 *(supp.)*

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

48 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects cotreatment, affects expression, decreases expression, increases expression	4
Cyclosporine	decreases expression	3
sodium arsenite	decreases expression, affects cotreatment, increases abundance	2
Ibuprofen	increases activity, increases metabolic processing, affects response to substance	2
Testosterone	affects cotreatment, increases expression, decreases expression	2
Valproic Acid	decreases expression, affects expression	2
bisphenol F	affects cotreatment, increases methylation	1
methylmercuric chloride	decreases expression	1
bisphenol A	increases expression	1
trichostatin A	decreases expression	1
beta-lapachone	decreases expression	1
cobaltous chloride	decreases expression	1
butyraldehyde	decreases expression	1
manganese chloride	increases abundance, affects cotreatment, decreases expression	1
bleomycetin	decreases expression	1
1,2,5,6-dibenzanthracene	affects cotreatment, affects expression	1
1-methylphenanthrene	affects cotreatment, affects expression	1
dibenzo(a,l)pyrene	affects cotreatment, affects expression	1
bicalutamide	decreases expression	1
pterostilbene	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
jinfukang	affects cotreatment, increases expression	1
(+)-JQ1 compound	increases expression	1
Arsenic Trioxide	decreases expression	1
Fulvestrant	increases methylation, affects cotreatment	1
Silybin	decreases expression	1
Acetylcysteine	affects expression, decreases reaction	1
Amphotericin B	decreases expression	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 80 trials:

NCT	Phase	Status	Title
NCT00417066	Phase 4	COMPLETED	Flexible GnRH Antagonist vs Flare up GnRH Agonist Protocol in Poor Responders
NCT00732693	Phase 4	COMPLETED	Evaluation of Physiologic and Standard Sex Steroid Replacement Regimens in Women With Premature Ovarian Failure
NCT00837616	Phase 4	COMPLETED	Estrogen Dosing in Turner Syndrome: Pharmacology and Metabolism
NCT01853501	Phase 4	UNKNOWN	Effects of ADSC Therapy in Women With POF
NCT02783937	Phase 4	COMPLETED	Filgrastim for Premature Ovarian Insufficiency
NCT03535480	Phase 4	UNKNOWN	Autologous Bone Marrow Stem Cell Ovarian Transplantation to Restore Ovarian Function in Premature Ovarian Failure
NCT05162768	Phase 3	COMPLETED	Study to Evaluate Efficacy and Safety of Elamipretide in Subjects With Primary Mitochondrial Disease From Nuclear DNA Mutations (nPMD)
NCT00140998	Phase 3	COMPLETED	Estrogen Treatment (Oral vs. Patches) in Turner Syndrome
NCT00001951	Phase 2	COMPLETED	Hormone Replacement in Young Women With Premature Ovarian Failure
NCT00370019	Phase 2	WITHDRAWN	Effects of an Estrogen Replacement Therapy Skin Patch on Ovulation in Women With Premature Ovarian Failure
NCT00429494	Phase 2	COMPLETED	GnRH Analogue for Ovarian Function Preservation in Hematopoietic Stem Cell Transplantation Patients
NCT03816852	Phase 2	SUSPENDED	The Safety and Efficiency Study of Mesenchymal Stem Cell (19#iSCLife®-POI) in Premature Ovarian Insufficiency
NCT04536467	Phase 2	UNKNOWN	Prevention of Chemotherapy-Induced Ovarian Failure With Goserelin in Premenopausal Lymphoma Patients
NCT06117982	Phase 2	COMPLETED	The Impact of Granulocyte Colony Stimulating Factor on Premature Ovarian Insufficiency
NCT02912104	Phase 1	COMPLETED	A Therapeutic Trial of Human Amniotic Epithelial Cells Transplantation for Primary Ovarian Failure
NCT03178695	Phase 1	COMPLETED	Inovium Ovarian Rejuvenation Trials
NCT04815213	Phase 1	ACTIVE_NOT_RECRUITING	The Use of Expandeded Mesenchymal Stromal Cells (MSC) in Premature Ovarian Failure (POF) in Adult Humans
NCT05138367	Phase 1	COMPLETED	Effects of UCA-PSCs in Women With POF
NCT06132542	Phase 1	UNKNOWN	Autologous ADMSC Transplantation in Patients With POI
NCT01668186	Not specified	RECRUITING	Longitudinal Natural History Study of Patients With Peroxisome Biogenesis Disorders (PBD)
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT04297891	Not specified	UNKNOWN	Phenotypes, Biomarkers and Pathophysiology in Spastic Ataxias
NCT07798674	Not specified	RECRUITING	TreatHSP Platform: Adaptive Natural History Platform for Ataxias, HSPs, and Spastic Ataxias
NCT00948857	Phase 2/3	TERMINATED	Dehydroepiandrosterone (DHEA) Treatment and Premature Ovarian Failure (POF)
NCT04031456	Phase 2/3	RECRUITING	Autologous PRP Infusion May Restore Ovarian Function and May Promote Folliculogenesis in POI Patients
NCT02043743	Phase 1/2	UNKNOWN	Autologous Stem Cells Transplantation in Patients With Idiopathic and Drug Induced Premature Ovarian Failure
NCT02062931	Phase 1/2	UNKNOWN	Autologous Mesenchymal Stem Cells Transplantation In Women With Premature Ovarian Failure
NCT02151890	Phase 1/2	COMPLETED	Pregnancy After Stem Cell Transplantation in Premature Ovarian Failure
NCT02372474	Phase 1/2	COMPLETED	It is a Real The First Baby Of Autologous Stem Cell Therapy in Premature Ovarian Failure
NCT02603744	Phase 1/2	UNKNOWN	Autologous Adipose Derived Mesenchymal Stromal Cells Transplantation in Women With Premature Ovarian Failure (POF)
NCT02644447	Phase 1/2	COMPLETED	Transplantation of HUC-MSCs With Injectable Collagen Scaffold for POF
NCT03069209	Phase 1/2	UNKNOWN	Autologous Bone Marrow-Derived Stem Cell Transplantation in Patients With Premature Ovarian Failure (POF)
NCT03985462	Phase 1/2	WITHDRAWN	Very Small Embryonic-like Stem Cells for Ovary
NCT04009473	Phase 1/2	UNKNOWN	Stem Cell Therapy and Growth Factor Ovarian in Vitro Activation
NCT04071574	Phase 1/2	COMPLETED	Comparative Study on the Efficacy of Ovarian Stimulation Protocols on the Success Rate of ICSI in Female Infertility
NCT04922398	Phase 1/2	UNKNOWN	Ovarian Injection of PRP (Platelet -Rich Plasma) Vs Normal Saline in Premature Ovarian Insufficiency
NCT05462379	Phase 1/2	ACTIVE_NOT_RECRUITING	Autologous Heterotopic Fresh Ovarian Graft in Woman With LACC Eligible for Pelvic Radiotherapy Treatment.
NCT06202547	Phase 1/2	COMPLETED	Intra-ovarian Injection of MSC-EVs in Idiopathic Premature Ovarian Failure
NCT01129947	Early Phase 1	WITHDRAWN	The Use of DHEA in Women With Premature Ovarian Failure
NCT05522634	Early Phase 1	UNKNOWN	A Clinical Study of Chinese Herbal Compound TJAOA101 in the Treatment of Premature Ovarian Insufficiency
NCT07308327	Early Phase 1	ACTIVE_NOT_RECRUITING	The Influence of Gut Microbiota on Ovarian Function: A Single-center, Randomized,Double Blind, Parallel-controlled, Exploratory Clinical Trial
NCT00001275	Not specified	COMPLETED	Ovarian Follicle Function in Patients With Primary Ovarian Failure
NCT00001306	Not specified	COMPLETED	Steroid Therapy in Autoimmune Premature Ovarian Failure
NCT00006156	Not specified	COMPLETED	Feasibility Study for Development of an Early Test for Ovarian Failure
NCT00119925	Not specified	UNKNOWN	‘SPRING’-Study: Subfertility Guidelines: Patient Related Implementation in the Netherlands Among Gynaecologists
NCT00295087	Not specified	COMPLETED	X-Chromosome Inactivation Status and Premature Ovarian Failure
NCT00417157	Not specified	COMPLETED	Modified Natural Cycle Offers a Chance of Pregnancy in Patients With Poor Response and High Basal FSH
NCT00619333	Not specified	UNKNOWN	Inactive FSH in Galactosemia
NCT00780897	Not specified	UNKNOWN	Premature Ovarian Failure (Genetic and Physiopathologic Analysis)
NCT01187524	Not specified	TERMINATED	The Natural History of Reproductive and Overall Health in Girls and Women With a Pre-Mutation in the FMR1 Gene; Creation of a Patient Registry
NCT01411644	Not specified	UNKNOWN	Pheno- & Genotyping POF (WHO III)
NCT02086318	Not specified	UNKNOWN	A New Algorithm to Predict Ovarian Age
NCT02467231	Not specified	ACTIVE_NOT_RECRUITING	Ovarian Reserve After Cancer: Longitudinal Effects
NCT02696889	Not specified	COMPLETED	Rejuvenation of Premature Ovarian Failure With Stem Cells
NCT02779374	Not specified	TERMINATED	Autologous Bone Marrow Transplantation for Premature Ovarian Insufficiency
NCT03207412	Not specified	UNKNOWN	Human Amniotic Epithelial Cells Treatment for Ovarian Insufficiency
NCT03381300	Not specified	ACTIVE_NOT_RECRUITING	Preservation of Ovarian Cortex Tissue in Girls With Turner Syndrome
NCT03412487	Not specified	UNKNOWN	Ovarian Histopathology and Laparoscopic Assessment of Premature Ovarian Failure
NCT03474120	Not specified	UNKNOWN	Prospective Genetic Study in Patients With Ovarian Insufficiency
NCT03480412	Not specified	UNKNOWN	Second Step Protocol in Poor Ovarian Responder (POR)