APLF

Summary

APLF (aprataxin and PNKP like factor, HGNC:28724) is a protein-coding gene on chromosome 2p13.3, encoding Aprataxin and PNK-like factor (Q8IW19). Histone chaperone involved in single-strand and double-strand DNA break repair.

Enables several functions, including nuclease activity; poly-ADP-D-ribose binding activity; and protein folding chaperone. Involved in DNA repair; DNA repair-dependent chromatin remodeling; and protein localization to chromatin. Located in nucleoplasm. Is active in site of double-strand break.

Source: NCBI Gene 200558 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 90 total — 1 likely-pathogenic
• GTEx eGene: eQTL in 25 tissues, sQTL in 1 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.45 (unconstrained)
• MANE Select transcript: NM_173545
• Notable: 90 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28724
Approved symbol	APLF
Name	aprataxin and PNKP like factor
Location	2p13.3
Locus type	gene with protein product
Status	Approved
Aliases	MGC47799, Xip1, ZCCHH1
Ensembl gene	ENSG00000169621
Ensembl biotype	protein_coding
OMIM	611035
Entrez	200558

Gene structure

Transcript identifiers

Ensembl transcripts: 20 — 10 protein_coding, 7 nonsense_mediated_decay, 3 protein_coding_CDS_not_defined

MANE Select: ENST00000303795

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 2: 1, TSL 5: 3

ENST00000303795, ENST00000445692, ENST00000471727, ENST00000488585, ENST00000529851, ENST00000627740, ENST00000905978, ENST00000963710, ENST00000963711, ENST00000991796, ENST00000991797, ENST00000991798, ENST00000991799, ENST00001032630, ENST00001032631, ENST00001058344, ENST00001095901, ENST00001121074, ENST00001121075, ENST00001144349

RefSeq mRNA: 1 — MANE Select: NM_173545 NM_173545

CCDS: CCDS1888

Canonical transcript exons

ENST00000303795 — 10 exons

Exon	Start	End
ENSE00001305069	68502731	68502903
ENSE00001309418	68513548	68513680
ENSE00001321156	68490190	68490261
ENSE00001326939	68513080	68513227
ENSE00001757289	68467585	68467827
ENSE00003526042	68526061	68526242
ENSE00003543596	68567341	68567387
ENSE00003586373	68537872	68538227
ENSE00003619655	68545187	68545312
ENSE00003670255	68577820	68580162

Expression profiles

Bgee: expression breadth ubiquitous, 168 present calls, max score 89.97.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 4.5072 / max 69.9609, expressed in 1558 samples.

Highest expression (Bgee): calcaneal tendon, male germ line stem cell (sensu Vertebrata) in testis, buccal mucosa cell, tendon, sperm.

Genetic regulation across tissues (GTEx eQTL / sQTL)

APLF is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 25 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 26 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Cells Cultured fibroblasts	eqtl	8.4e-13	+0.34	2:68511279:G:A
Artery Tibial	eqtl	7.8e-12	+0.39	2:68608064:A:G
Adipose Subcutaneous	eqtl	4.1e-10	+0.43	2:68558139:A:T
Esophagus Mucosa	eqtl	5.3e-07	+0.46	2:68538605:T:TTTAGGTGTCTTTTCTTTATATTTTTGTAATGGTGCTTTGAATCATCATGGTACCCTGTA
Adipose Visceral Omentum	eqtl	1.0e-06	+0.36	2:68522716:T:C
Colon Sigmoid	eqtl	1.3e-06	+0.32	2:68523971:CT:C
Thyroid	eqtl	6.3e-06	+0.43	2:68565322:A:G
Nerve Tibial	eqtl	3.0e-05	+0.31	2:68493967:G:A
Breast Mammary Tissue	eqtl	4.3e-05	+0.36	2:68511279:G:A
Brain Cortex	eqtl	1.7e-04	+0.71	2:68493967:G:A
Esophagus Muscularis	eqtl	2.4e-04	+0.29	2:68511279:G:A
Cells EBV-transformed lymphocytes	eqtl	4.6e-04	+0.40	2:68520708:C:T
Skin Not Sun Exposed Suprapubic	eqtl	5.5e-04	+0.26	2:68515361:G:A
Esophagus Gastroesophageal Junction	eqtl	9.8e-04	+0.39	2:68484301:A:G
Esophagus Gastroesophageal Junction	sqtl	1.0e-03	+1.21	2:67950262:G:A
Brain Caudate basal ganglia	eqtl	2.6e-03	+0.76	2:68504055:C:T
Skin Sun Exposed Lower leg	eqtl	4.0e-03	+0.20	2:68549480:A:C
Muscle Skeletal	eqtl	4.1e-03	+0.26	2:68490010:T:A
Adrenal Gland	eqtl	5.0e-03	+0.39	2:68583452:G:A
Artery Aorta	eqtl	5.4e-03	+0.42	2:68490010:T:A

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
20707	3.2514	1437
20708	1.2558	755

Top tissues by expression

showing 100 of 250 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
calcaneal tendon	UBERON:0003701	89.97	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	81.88	gold quality
buccal mucosa cell	CL:0002336	81.17	silver quality
tendon	UBERON:0000043	79.32	gold quality
sperm	CL:0000019	78.46	silver quality
sural nerve	UBERON:0015488	75.85	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	75.42	gold quality
colonic epithelium	UBERON:0000397	75.29	gold quality
bone marrow cell	CL:0002092	75.15	gold quality
corpus callosum	UBERON:0002336	74.41	gold quality
left testis	UBERON:0004533	74.30	gold quality
right testis	UBERON:0004534	74.07	gold quality
stromal cell of endometrium	CL:0002255	74.04	gold quality
testis	UBERON:0000473	73.45	gold quality
skin of abdomen	UBERON:0001416	72.10	gold quality
cardiac muscle of right atrium	UBERON:0003379	71.64	gold quality
lower esophagus mucosa	UBERON:0035834	71.57	gold quality
left ventricle myocardium	UBERON:0006566	71.55	gold quality
epithelial cell of pancreas	CL:0000083	71.41	gold quality
skin of leg	UBERON:0001511	71.17	gold quality
muscle of leg	UBERON:0001383	70.30	gold quality
zone of skin	UBERON:0000014	69.96	gold quality
gastrocnemius	UBERON:0001388	69.73	gold quality
vagina	UBERON:0000996	69.58	gold quality
hindlimb stylopod muscle	UBERON:0004252	69.40	gold quality
smooth muscle tissue	UBERON:0001135	69.27	gold quality
esophagus mucosa	UBERON:0002469	68.98	gold quality
quadriceps femoris	UBERON:0001377	68.69	gold quality
tibial artery	UBERON:0007610	68.41	gold quality
popliteal artery	UBERON:0002250	68.39	gold quality
leukocyte	CL:0000738	68.38	gold quality
monocyte	CL:0000576	68.31	gold quality
tonsil	UBERON:0002372	68.30	gold quality
esophagus	UBERON:0001043	68.28	gold quality
vastus lateralis	UBERON:0001379	68.04	gold quality
muscle layer of sigmoid colon	UBERON:0035805	68.03	gold quality
right coronary artery	UBERON:0001625	67.99	gold quality
uterine cervix	UBERON:0000002	67.92	gold quality
lower lobe of lung	UBERON:0008949	67.77	silver quality
islet of Langerhans	UBERON:0000006	67.51	gold quality
minor salivary gland	UBERON:0001830	67.27	gold quality
deltoid	UBERON:0001476	67.16	silver quality
lower esophagus	UBERON:0013473	67.13	gold quality
ectocervix	UBERON:0012249	67.11	gold quality
lower esophagus muscularis layer	UBERON:0035833	67.09	gold quality
superficial temporal artery	UBERON:0001614	67.07	gold quality
muscle tissue	UBERON:0002385	66.97	gold quality
aorta	UBERON:0000947	66.67	gold quality
right adrenal gland cortex	UBERON:0035827	66.65	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	66.55	gold quality
kidney epithelium	UBERON:0004819	66.47	gold quality
myocardium	UBERON:0002349	66.40	gold quality
mucosa of stomach	UBERON:0001199	66.28	gold quality
omental fat pad	UBERON:0010414	66.24	gold quality
peritoneum	UBERON:0002358	66.20	gold quality
skeletal muscle tissue	UBERON:0001134	66.17	gold quality
left coronary artery	UBERON:0001626	66.11	gold quality
mouth mucosa	UBERON:0003729	65.97	gold quality
body of uterus	UBERON:0009853	65.92	gold quality
granulocyte	CL:0000094	65.91	gold quality
subcutaneous adipose tissue	UBERON:0002190	65.82	gold quality
adrenal tissue	UBERON:0018303	65.73	gold quality
coronary artery	UBERON:0001621	65.53	gold quality
endocervix	UBERON:0000458	65.37	gold quality
right adrenal gland	UBERON:0001233	65.30	gold quality
ventricular zone	UBERON:0003053	65.11	gold quality
tibial nerve	UBERON:0001323	65.10	gold quality
adipose tissue of abdominal region	UBERON:0007808	65.01	gold quality
germinal epithelium of ovary	UBERON:0001304	64.83	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	64.76	gold quality
ascending aorta	UBERON:0001496	64.61	gold quality
pancreas	UBERON:0001264	64.55	gold quality
thoracic aorta	UBERON:0001515	64.55	gold quality
upper arm skin	UBERON:0004263	64.24	gold quality
adrenal gland	UBERON:0002369	64.14	gold quality
saliva-secreting gland	UBERON:0001044	64.09	gold quality
left adrenal gland	UBERON:0001234	64.05	gold quality
descending thoracic aorta	UBERON:0002345	63.90	gold quality
lymph node	UBERON:0000029	63.82	gold quality
epithelium of nasopharynx	UBERON:0001951	63.82	gold quality
heart	UBERON:0000948	63.74	gold quality
uterus	UBERON:0000995	63.64	gold quality
female reproductive system	UBERON:0000474	63.63	gold quality
right lung	UBERON:0002167	63.61	gold quality
cardiac atrium	UBERON:0002081	63.56	gold quality
bone marrow	UBERON:0002371	63.39	gold quality
ovary	UBERON:0000992	63.37	gold quality
left adrenal gland cortex	UBERON:0035825	63.37	gold quality
body of pancreas	UBERON:0001150	63.33	gold quality
adrenal cortex	UBERON:0001235	63.29	gold quality
oviduct epithelium	UBERON:0004804	63.29	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	63.28	gold quality
right atrium auricular region	UBERON:0006631	63.25	gold quality
colon	UBERON:0001155	63.16	gold quality
metanephros cortex	UBERON:0010533	63.03	gold quality
gall bladder	UBERON:0002110	62.97	gold quality
adipose tissue	UBERON:0001013	62.95	gold quality
urinary bladder	UBERON:0001255	62.88	gold quality
endometrium	UBERON:0001295	62.87	gold quality
right ovary	UBERON:0002118	62.86	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	6.04

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Corpus callosum	tissue	23.2
Periaqueductal gray	tissue	15.7
Spinal cord	tissue	15.5
Substantia nigra	tissue	15.2
Putamen	tissue	15.0
Midbrain	tissue	15.0
Ventral forebrain	tissue	14.8
Septum	tissue	14.6
Thalamus	tissue	14.4
Hypothalamus	tissue	14.4
Medulla oblongata	tissue	13.9
Pons	tissue	13.8
Amygdala	tissue	12.9
Superior colliculi	tissue	12.8
Hippocampal formation	tissue	12.4
Basal ganglia	tissue	11.3	not detected
Cerebral cortex	tissue	10.9	not detected
Retrosplenial cortex	tissue	10.9
Motor cortex	tissue	10.8
Prefrontal cortex	tissue	10.7
Olfactory bulb	tissue	10.6
Insular cortex	tissue	10.6
Entorhinal cortex	tissue	10.5
Retrosplenial and cingulate cortex	tissue	10.1
Occipital cortex	tissue	10.0
Somatosensory cortex	tissue	9.9
Temporal cortex	tissue	9.6
Hippocampus	tissue	9.2	not detected
Nucleus accumbens	tissue	8.9
Cerebellum	tissue	8.8	not detected
Postcentral gyrus	tissue	5.7
Locus coeruleus	tissue	4.1
Caudate putamen	tissue	3.8
Frontal cortex	tissue	3.4
Skin 1	tissue	2.2	not detected
Placenta	tissue	1.7	not detected
Choroid plexus	tissue	1.5
Esophagus	tissue	1.4	not detected
Liver	tissue	1.4	not detected
Breast	tissue	1.3	not detected
Vagina	tissue	1.3	not detected
Seminal vesicle	tissue	1.2	not detected
Adipose tissue	tissue	1.2	not detected
Endometrium 1	tissue	1.2	not detected
Tongue	tissue	1.2
Cervix	tissue	1.1	not detected
Lymph node	tissue	1.1	not detected
Thyroid gland	tissue	1.1	not detected
Tonsil	tissue	1.1	not detected
Skeletal muscle	tissue	1.0	not detected
Smooth muscle	tissue	1.0	not detected
Epididymis	tissue	1.0	not detected
Prostate	tissue	1.0	not detected
Testis	tissue	0.9	not detected
Urinary bladder	tissue	0.9	not detected
Gallbladder	tissue	0.9	not detected
Adrenal gland	tissue	0.9	not detected
Heart muscle	tissue	0.8	not detected
Ovary	tissue	0.8	not detected
Parathyroid gland	tissue	0.8	not detected

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — White matter (23.2), Ventral spinal cord (15.5), Dorsal spinal cord (14.6), Dorsal hippocampus (12.4), Subiculum (12.1).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): ATM

miRNA regulators (miRDB)

Targeting APLF by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 133 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-33A-5P	99.99	68.62	1055
HSA-MIR-33B-5P	99.99	68.58	1062
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-485-3P	99.98	70.68	1585
HSA-MIR-539-3P	99.98	70.74	1616
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-6888-3P	99.97	65.95	1170
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-548AB	99.95	71.31	3488
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-548A-5P	99.94	71.27	3482
HSA-MIR-548AD-5P	99.94	71.23	3502
HSA-MIR-548AE-5P	99.94	71.23	3502
HSA-MIR-548AK	99.94	71.24	3488
HSA-MIR-548AM-5P	99.94	71.24	3488
HSA-MIR-548AP-5P	99.94	71.14	3489
HSA-MIR-548AQ-5P	99.94	71.34	3426

Functional genomics

gnomAD constraint: pLI 2.54e-21, LOEUF 1.45, missense Z -0.0107 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000303795 — one region, missense o/e 1.01.

Literature-anchored findings (GeneRIF, showing 17)

• These data identify APLF as a novel component of the cellular response to DNA strand breaks in human cells. (PMID:17353262)
• PALF is novel human AP endonuclease with conserved zinc-finger-like motifs involved in DNA strand break responses. (PMID:17396150)
• APLF is an ATM target that is involved in nonhomologous end-joining and facilitates double-strand break repair, likely via interactions with Ku and XRCC4-DNA ligase IV. (PMID:18077224)
• interaction of poly(ADP-ribose) with a PBZ motif in two representative human proteins, APLF (aprataxin PNK-like factor) and CHFR (checkpoint protein with FHA and RING domains) (PMID:18172500)
• Study concludes that APLF can accumulate at sites of chromosomal damage via zinc finger-mediated binding to poly(ADP-ribose) and is a novel component of poly(ADP-ribose) signaling in mammalian cells. (PMID:18474613)
• The authors present solution structures of the two poly(ADP-ribose)-binding zinc finger modules of aprataxin and PNK-like factor (APLF), revealing a novel type of zinc finger. (PMID:20098424)
• APLF has a role in chromosomal DNA double-strand break repair. (PMID:21211721)
• The poly(ADP-ribose)-regulated protein APLF as a DNA-damage-specific histone chaperone. (PMID:21211722)
• only a positive association (OR=1.58, 95% CI 1.05-2.46, P=0.027) was obtained for XRCC1 (Arg280His (PMID:21414327)
• Polynucleotide kinase and aprataxin-like forkhead-associated protein (PALF) acts as both a single-stranded DNA endonuclease and a single-stranded DNA 3’ exonuclease and can participate in DNA end joining in a biochemical system. (PMID:21885877)
• APLF promotes the assembly and activity of multi-protein Ku-DNA complexes containing all of the Non-homologous end joining (NHEJ) factors required for DNA ligation. (PMID:23178593)
• These data suggest functional requirements for Ku and XRCC4 in APLF-dependent NHEJ and a unique role for Ku as a factor required to facilitate the nuclear retention of APLF. (PMID:23689425)
• characterization of the interaction of the APLF FHA domain with phosphorylated XRCC1 peptides (PMID:29059378)
• Data provided novel evidence for enrichment of APLF in breast tumors, which could regulate metastasis-associated epithelial-to-mesenchymal transition in invasive breast cancer. (PMID:29580241)
• The acidic domain of APLF is a histone chaperone that can bind both the histone H2A-H2B dimer and H3-H4 tetramer. (PMID:29905837)
• The crystal structures of the Ku-binding motifs (KBM) of the non-homologous end joining (NHEJ) proteins APLF (A-KBM) and XLF (X-KBM) bound to a Ku-DNA complex are discussed. (PMID:30291363)
• MIR888-dependent inhibition of APLF by E2F1 was demonstrated using overexpression and knockdown experiments, in combination with luciferase assays. (PMID:31287003)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	aplf	ENSDARG00000096566
mus_musculus	Aplf	ENSMUSG00000030051
rattus_norvegicus	Aplf	ENSRNOG00000043059
drosophila_melanogaster	CG6171	FBGN0026737

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1919353) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 2 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal class switch recombination	1
abnormal DNA repair	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	A0JNH9	69.7%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
PROKR1	protein-coding	10887
FBXO48	protein-coding	554251
ARHGAP25	protein-coding	9938
LINC01890	ncRNA	105374791
LINC01888	ncRNA	107985893
PLEK	protein-coding	5341

Protein

Protein identifiers

Aprataxin and PNK-like factor — Q8IW19 (reviewed: Q8IW19)

Alternative names: Apurinic-apyrimidinic endonuclease APLF, PNK and APTX-like FHA domain-containing protein, XRCC1-interacting protein 1

All UniProt accessions (3): Q8IW19, E9PRH6, F8WET0

UniProt curated annotations — full annotation on UniProt →

Function. Histone chaperone involved in single-strand and double-strand DNA break repair. Recruited to sites of DNA damage through interaction with branched poly-ADP-ribose chains, a polymeric post-translational modification synthesized transiently at sites of chromosomal damage to accelerate DNA strand break repair reactions. Following recruitment to DNA damage sites, acts as a histone chaperone that mediates histone eviction during DNA repair and promotes recruitment of histone variant MACROH2A1. Also has a nuclease activity: displays apurinic-apyrimidinic (AP) endonuclease and 3’-5’ exonuclease activities in vitro. Also able to introduce nicks at hydroxyuracil and other types of pyrimidine base damage. Together with PARP3, promotes the retention of the LIG4-XRCC4 complex on chromatin and accelerate DNA ligation during non-homologous end-joining (NHEJ). Also acts as a negative regulator of cell pluripotency by promoting histone exchange. Required for the embryo implantation during the epithelial to mesenchymal transition in females.

Subunit / interactions. Interacts with LIG4. Interacts with PARP1. Interacts with XRCC4. Interacts (via KBM motif) with XRCC5 and XRCC6; promoting recruitment to DNA damage sites. Interacts with XRCC1. Interacts (via C-terminal disordered region) with histones; interacts with histone H2A, H2B and H3-H4.

Subcellular location. Nucleus. Chromosome. Cytoplasm. Cytosol.

Post-translational modifications. Poly-ADP-ribosylated. In addition to binding non covalently poly-ADP-ribose via its PBZ-type zinc fingers, the protein is also covalently poly-ADP-ribosylated by PARP1. Phosphorylated in an ATM-dependent manner upon double-strand DNA break.

Domain organisation. The PBZ-type zinc fingers (also named CYR) mediate non-covalent poly-ADP-ribose-binding. Specifically recognizes branched poly-ADP-ribose chains generated by PARP2. Poly-ADP-ribose-binding is dependent on the presence of zinc and promotes its recruitment to DNA damage sites. The KBM (Ku-binding motif) mediates interaction with XRCC5/Ku80 and XRCC6/Ku70 and recruitment to DNA damage sites. The FHA-like domain mediates interaction with XRCC1 and XRCC4. The NAP1L motif is required for the histone chaperone activity.

Similarity. Belongs to the APLF family.

RefSeq proteins (1): NP_775816* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR008984	SMAD_FHA_dom_sf	Homologous_superfamily
IPR019406	APLF_PBZ	Domain
IPR039253	APLF	Family
IPR041388	FHA_2	Domain

Pfam: PF10283, PF17913

UniProt features (65 total): mutagenesis site 16, strand 11, binding site 7, compositionally biased region 6, helix 6, sequence variant 3, region of interest 3, turn 3, zinc finger region 2, modified residue 2, short sequence motif 2, chain 1, domain 1, sequence conflict 1, coiled-coil region 1

Structure

Experimental structures (PDB)

14 structures by resolution:

PDB	Title	Method	Resolution (Å)
5W7W	Crystal Structure of FHA domain of human APLF	X-RAY DIFFRACTION	1.35
5E50	APLF/XRCC4 complex	X-RAY DIFFRACTION	1.38
6TYZ	Structure of Ku80 von Willebrand domain complexed with APLF Ku Binding Motif	X-RAY DIFFRACTION	1.51
6TYW	Structure of Ku80 von Willebrand domain S229A mutant complexed with APLF Ku Binding Motif	X-RAY DIFFRACTION	1.7
5W7X	Crystal Structure of FHA domain of human APLF in complex with XRCC1 bisphospho peptide	X-RAY DIFFRACTION	2
5W7Y	Crystal Structure of FHA domain of human APLF in complex with XRCC1 monophosphorylated …	X-RAY DIFFRACTION	2.1
6YN1	Crystal structure of histone chaperone APLF acidic domain bound to the histone …	X-RAY DIFFRACTION	2.35
6TYT	Structure of Ku80 von Willebrand domain S229A mutant complexed with APLF and XLF Ku …	X-RAY DIFFRACTION	2.4
6ERF	Complex of APLF factor and Ku heterodimer bound to DNA	X-RAY DIFFRACTION	3.01
2KQB	First PBZ domain of human APLF protein	SOLUTION NMR
2KQC	Second PBZ domain of human APLF protein	SOLUTION NMR
2KQD	First PBZ domain of human APLF protein in complex with ribofuranosyladenosine	SOLUTION NMR
2KQE	Second PBZ domain of human APLF protein in complex with ribofuranosyladenosine	SOLUTION NMR
2KUO	Structure and identification of ADP-ribose recognition motifs of APLF and role in the DNA …	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8IW19-F1	62.42	0.23

Human Protein Atlas

Protein class: Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm

Antibody reliability (HPA): IH uncertain · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (7)

Position	Role
376	a glycoprotein
381	a glycoprotein
386	a glycoprotein
387	a glycoprotein
423	a glycoprotein
428	a glycoprotein
429	a glycoprotein

Post-translational modifications (2)

Type	Positions
Phosphoserine	116, 149

Mutagenesis-validated functional residues (16)

Position	Phenotype
27	does not affect interaction with xrcc5 and xrcc6; decreased ability to promote non-homologous end-joining (nhej).
116	decreases phosphorylation by atm.
182–184	abolished interaction with xrcc5 and xrcc6.
182	reduced interaction with xrcc5 and xrcc6; impaired localization to the nucleus.
184	abolished interaction with xrcc5 and xrcc6; impaired localization to the nucleus.
189–191	abolished interaction with xrcc5 and xrcc6.
189	abolished interaction with xrcc5 and xrcc6; impaired localization to the nucleus; decreased ability to promote non-homologous end-joining …
190	reduced interaction with xrcc5 and xrcc6.
191	does not affect interaction with xrcc5 and xrcc6.
376	abolishes poly(adp-ribose)-binding and poly-adp-ribosylation by parp1; when associated with a-421 and a-427. does not affect histone …
379	abolishes poly(adp-ribose)-binding and poly-adp-ribosylation by parp1; when associated with a-385; a-421 and a-427. does not affect histone …
385	abolishes poly(adp-ribose)-binding and poly-adp-ribosylation by parp1; when associated with a-379; a-421 and a-427. does not affect histone …
421	abolishes poly(adp-ribose)-binding and poly-adp-ribosylation by parp1; when associated with a-379; a-385 and a-427. abolishes …
427	abolishes poly(adp-ribose)-binding and poly-adp-ribosylation by parp1; when associated with a-379; a-385 and a-421. abolishes …
477	impaired binding to histones and ability to mediate histone chaperone activity.
485	impaired binding to histones and ability to mediate histone chaperone activity.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 146 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_DN, GSE45365_HEALTHY_VS_MCMV_INFECTION_CD8_TCELL_IFNAR_KO_DN, GOBP_REGULATION_OF_CELL_ACTIVATION, GOBP_REGULATION_OF_DNA_RECOMBINATION, GOMF_ENDONUCLEASE_ACTIVITY, GOBP_B_CELL_ACTIVATION, GOMF_NUCLEASE_ACTIVITY, GOBP_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, GOBP_REGULATION_OF_DNA_REPAIR, GOBP_LEUKOCYTE_MEDIATED_IMMUNITY, GOBP_B_CELL_MEDIATED_IMMUNITY, GOBP_CELL_ACTIVATION_INVOLVED_IN_IMMUNE_RESPONSE, GOBP_REGULATION_OF_IMMUNOGLOBULIN_PRODUCTION, GOBP_REGULATION_OF_IMMUNE_RESPONSE, GOBP_PROTEIN_MATURATION

GO Biological Process (11): single strand break repair (GO:0000012), DNA repair (GO:0006281), regulation of DNA repair (GO:0006282), double-strand break repair (GO:0006302), double-strand break repair via nonhomologous end joining (GO:0006303), DNA damage response (GO:0006974), embryo implantation (GO:0007566), regulation of epithelial to mesenchymal transition (GO:0010717), protein localization to chromatin (GO:0071168), DNA repair-dependent chromatin remodeling (GO:0140861), protein folding (GO:0006457)

GO Molecular Function (13): nucleotide binding (GO:0000166), DNA-(apurinic or apyrimidinic site) endonuclease activity (GO:0003906), DNA endonuclease activity (GO:0004520), zinc ion binding (GO:0008270), 3’-5’ exonuclease activity (GO:0008408), histone binding (GO:0042393), protein folding chaperone (GO:0044183), poly-ADP-D-ribose binding (GO:0072572), histone chaperone activity (GO:0140713), ADP-D-ribose modification-dependent protein binding (GO:0160002), protein binding (GO:0005515), hydrolase activity (GO:0016787), metal ion binding (GO:0046872)

GO Cellular Component (6): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytosol (GO:0005829), site of double-strand break (GO:0035861), site of DNA damage (GO:0090734), chromosome (GO:0005694)

GO top-level categories

40 GO namespaces:

Category	Terms
DNA repair	3
cellular anatomical structure	3
DNA damage response	2
DNA metabolic process	1
regulation of DNA metabolic process	1
regulation of cellular response to stress	1
double-strand break repair	1
cellular response to stress	1
multicellular organism development	1
female pregnancy	1
reproductive process	1
epithelial to mesenchymal transition	1
regulation of cell differentiation	1
protein localization to chromosome	1
chromatin remodeling	1
cellular process	1
protein maturation	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
DNA endonuclease activity	1
endonuclease activity	1
DNA nuclease activity	1
transition metal ion binding	1
exonuclease activity	1
protein binding	1
molecular_function	1
protein folding	1
carbohydrate derivative binding	1
histone binding	1
protein carrier activity	1
modification-dependent protein binding	1
binding	1
catalytic activity	1
cation binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cytoplasm	1
site of DNA damage	1
chromosome	1
intracellular membraneless organelle	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 20 of 30 annotations. The rest are phylogenetic / computational / electronic (IEA).

20 experimentally-supported GO terms:

GO term	NS	Evidence
DNA damage response	BP	direct assay
DNA repair	BP	direct assay
DNA repair-dependent chromatin remodeling	BP	direct assay
double-strand break repair	BP	mutant phenotype
double-strand break repair via nonhomologous end joining	BP	mutant phenotype
protein localization to chromatin	BP	direct assay
single strand break repair	BP	mutant phenotype
nucleoplasm	CC	direct assay
nucleus	CC	direct assay
site of DNA damage	CC	direct assay
site of double-strand break	CC	direct assay
3’-5’ exonuclease activity	MF	direct assay
ADP-D-ribose modification-dependent protein binding	MF	direct assay
DNA endonuclease activity	MF	direct assay
DNA-(apurinic or apyrimidinic site) endonuclease activity	MF	direct assay
histone binding	MF	direct assay
histone chaperone activity	MF	direct assay
nucleotide binding	MF	direct assay
poly-ADP-D-ribose binding	MF	direct assay
protein folding chaperone	MF	experiment

Protein interactions and networks

STRING

showing 15 of 596 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
APLF	CHFR	Q96EP1	977
APLF	APTX	Q7Z2E3	952
APLF	XRCC4	Q13426	884
APLF	XRCC1	P18887	880
APLF	LIG3	P49916	865
APLF	PNKP	Q96T60	815
APLF	PAXX	Q9BUH6	757
APLF	NHEJ1	Q9H9Q4	723
APLF	PARP3	Q9Y6F1	697
APLF	XRCC6	P12956	676
APLF	PARG	Q86W56	656
APLF	PRKDC	P78527	649
APLF	XRCC5	P13010	645
APLF	RNF146	Q9NTX7	628
APLF	LIG4	P49917	623

IntAct

Human interaction partners of APLF in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

10 partners by confidence:

Partner	Interaction type	MIscore	Records
XRCC1	physical association	0.920	9
XRCC5	direct interaction	0.900	8
XRCC4	physical association	0.880	3
PARP1	association	0.870	7
XRCC6	physical association	0.830	3
LIG4	physical association	0.820	2
PARP2	adp ribosylation reaction	0.690	1
FLJ13057	physical association	0.560	3
MACROH2A1	association	0.350	2
TNKS	association	0.350	1

BioGRID (112 interactions; top human partners by supporting records): PARP1 (Affinity Capture-MS; 8 records), XRCC1 (Affinity Capture-MS; 6 records), CHD1L (Affinity Capture-MS; 5 records), H2AFY (Affinity Capture-MS; 4 records), LIG4 (Affinity Capture-MS; 4 records), XRCC5 (Affinity Capture-MS; 4 records), XRCC6 (Affinity Capture-MS; 4 records), CETN2 (Affinity Capture-MS; 3 records), CST4 (Affinity Capture-MS; 3 records), H2AFY2 (Affinity Capture-MS; 3 records), HIST1H2AG (Affinity Capture-MS; 3 records), HIST1H2BA (Affinity Capture-MS; 3 records), HIST2H3PS2 (Affinity Capture-MS; 3 records), HLTF (Affinity Capture-MS; 3 records), LIG3 (Affinity Capture-MS; 3 records)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
ATM	“up-regulates activity”	APLF	phosphorylation

Disease & clinical

Genetic variants

Variant evidence for APLF: 90 ClinVar records (1 pathogenic / likely pathogenic); 1 PharmGKB clinical annotation; 3 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

90 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	1
Uncertain significance	70
Likely benign	4
Benign	0

Top pathogenic / likely-pathogenic (1)

Showing all 1 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
524189	Single allele	Likely pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore APLF’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 40 predictions of 1,130):

Position(s)	Effect	Δscore	Sites
2:68513078–68513079	acceptor_loss	1.0000	4
2:68513681	donor_loss	1.0000	2
2:68526051	acceptor_gain	1.0000
2:68526059–68526060	acceptor_loss	1.0000	4
2:68526243–68526244	donor_loss	1.0000	5
2:68537870–68537871	acceptor_loss	1.0000	5
2:68577818–68577819	acceptor_loss	1.0000	6
2:68502904–68502905	donor_loss	0.9900	5
2:68513078–68513079	acceptor_loss	0.9900	2
2:68513546–68513547	acceptor_loss	0.9900	6

AlphaMissense

485 missense substitutions predicted likely pathogenic (of 3,390 scored), across 115 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
H434	8	0.958	0.986
H392	8	0.940	0.989
H398	8	0.938	0.992
H42	8	0.917	0.958
H440	8	0.899	0.966
N389	8	0.880	0.981
H58	8	0.860	0.949
D35	8	0.854	0.944
N431	8	0.840	0.971
D401	8	0.800	0.884
C379	7	0.979	0.989
C427	7	0.978	0.989
C421	7	0.976	0.995
C385	7	0.975	0.985
W189	7	0.954	0.988
F98	7	0.950	0.986
R387	7	0.942	0.995
R429	7	0.916	0.992
F63	7	0.913	0.982
F393	7	0.861	0.947

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	0.000316

Disease associations

OMIM: gene MIM:611035 | disease phenotypes:

GWAS associations

3 associations:

Study	Trait	p-value
GCST005042_4	Restless legs syndrome	1e-58
GCST001341_19	Multiple sclerosis	2e-7
GCST002830_34	Urate levels in lean individuals	1e-6

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0004531	urate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB clinical annotations

1 annotations by evidence level (1 strongest → 4):

Variant	Association	Level	Drugs	Phenotypes
rs3213239	Efficacy	3	Platinum compounds	Non-Small Cell Lung Carcinoma

PharmGKB variants

1 variants:

Variant	Genes	Level	Score	#Clin annots	Drugs
rs3213239	APLF, PINLYP, XRCC1	3	2.50	1	Platinum compounds

PharmGKB variant annotations

Per-publication pharmacogenomic findings for this gene (significant associations).

1 published findings:

Variant	Drug(s)	Category	Finding	PMID
rs3213239	Platinum compounds	Efficacy	Genotypes CCGG/CCGG + CCGG/del is associated with decreased overall survival and progression-free survival when treated with Platinum compounds in people with Carcinoma, Non-Small-Cell Lung as compared to genotype del/del.	PMID:25069034

CTD chemical–gene interactions

33 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
trichostatin A	affects expression, increases expression	2
sodium arsenite	decreases expression, increases abundance, increases expression	2
perfluorooctanoic acid	increases expression	2
perfluorooctane sulfonic acid	increases expression	2
Air Pollutants	increases abundance, increases expression, decreases expression	2
Arsenic	affects methylation, increases abundance, increases expression	2
Smoke	decreases expression, increases abundance	2
GSK-J4	decreases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	increases activity, affects binding, decreases expression	1
arsenite	decreases reaction, increases expression	1
acetochlor	affects response to substance	1
perfluoro-n-nonanoic acid	increases expression	1
perfluorohexanesulfonic acid	increases expression	1
clothianidin	increases expression	1
abrine	increases expression	1
jinfukang	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Fulvestrant	decreases reaction, increases expression	1
Cadmium	decreases reaction, increases expression, decreases expression	1
Cisplatin	affects cotreatment, increases expression	1
Coal	decreases expression, increases abundance	1
Doxorubicin	decreases expression	1
Estradiol	decreases expression	1
Ethyl Methanesulfonate	increases expression	1
Folic Acid	decreases expression	1
Malathion	decreases expression	1
Methyl Methanesulfonate	increases expression	1
Tretinoin	decreases expression	1
Valproic Acid	decreases methylation	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.