APOBEC3F

Summary

APOBEC3F (apolipoprotein B mRNA editing enzyme catalytic subunit 3F, HGNC:17356) is a protein-coding gene on chromosome 22q13.1, encoding DNA dC->dU-editing enzyme APOBEC-3F (Q8IUX4). DNA deaminase (cytidine deaminase) which acts as an inhibitor of retrovirus replication and retrotransposon mobility via deaminase-dependent and -independent mechanisms.

This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified.

Source: NCBI Gene 200316 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 84 total
• GTEx eGene: eQTL in 27 tissues, sQTL in 13 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.01 (unconstrained)
• MANE Select transcript: NM_145298
• Notable: 84 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17356
Approved symbol	APOBEC3F
Name	apolipoprotein B mRNA editing enzyme catalytic subunit 3F
Location	22q13.1
Locus type	gene with protein product
Status	Approved
Aliases	ARP8, BK150C2.4.MRNA, KA6
Ensembl gene	ENSG00000128394
Ensembl biotype	protein_coding
OMIM	608993
Entrez	200316

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 5 protein_coding, 3 nonsense_mediated_decay, 1 retained_intron, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000308521

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 3: 1, TSL 4: 1

ENST00000308521, ENST00000381565, ENST00000476513, ENST00000491387, ENST00000911511, ENST00000989291, ENST00001076871, ENST00001076872, ENST00001076873, ENST00001131845

RefSeq mRNA: 2 — MANE Select: NM_145298 NM_001006666, NM_145298

CCDS: CCDS33648, CCDS33649

Canonical transcript exons

ENST00000308521 — 7 exons

Exon	Start	End
ENSE00001378753	39052577	39055972
ENSE00001609243	39045428	39045542
ENSE00001768852	39052074	39052353
ENSE00001791788	39044941	39045220
ENSE00001896979	39040864	39040977
ENSE00003536480	39049425	39049581
ENSE00003633993	39042937	39043090

Expression profiles

Bgee: expression breadth ubiquitous, 178 present calls, max score 88.82.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 2.5056 / max 19.3955, expressed in 1292 samples.

Highest expression (Bgee): granulocyte, leukocyte, monocyte, mononuclear cell, spleen.

Genetic regulation across tissues (GTEx eQTL / sQTL)

APOBEC3F is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 27 tissues and its splicing (sQTL) in 13 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 40 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Nerve Tibial	eqtl	4.4e-34	+0.32	22:39033204:A:G
Artery Tibial	eqtl	2.0e-12	+0.18	22:39034262:A:G
Cells Cultured fibroblasts	eqtl	5.2e-11	+0.45	22:39045883:ACAAGGCCGACAGCCAGAAGCTTTGAGCAACATCCTT:A
Testis	eqtl	2.8e-09	-0.23	22:39041586:G:T
Esophagus Mucosa	eqtl	4.1e-08	+0.22	22:39098082:T:C
Pituitary	eqtl	4.2e-07	+0.30	22:39047162:A:C
Adipose Subcutaneous	eqtl	2.3e-06	+0.13	22:39041405:G:C
Cells EBV-transformed lymphocytes	eqtl	7.5e-05	+0.71	22:39045883:ACAAGGCCGACAGCCAGAAGCTTTGAGCAACATCCTT:A
Artery Tibial	sqtl	1.2e-04	-0.32	22:39029932:G:C
Artery Aorta	eqtl	6.9e-04	+0.55	22:39045883:ACAAGGCCGACAGCCAGAAGCTTTGAGCAACATCCTT:A
Nerve Tibial	sqtl	1.7e-03	-0.28	22:39045091:G:T
Colon Transverse	sqtl	1.8e-03	+0.36	22:39029932:G:C
Cells EBV-transformed lymphocytes	sqtl	2.7e-03	+0.32	22:39062160:G:A
Heart Left Ventricle	eqtl	3.0e-03	+0.43	22:39045883:ACAAGGCCGACAGCCAGAAGCTTTGAGCAACATCCTT:A
Whole Blood	eqtl	3.3e-03	+0.22	22:39041460:C:CGT
Skin Sun Exposed Lower leg	eqtl	3.3e-03	+0.11	22:39033658:A:G
Lung	sqtl	4.4e-03	+0.28	22:39033658:A:G
Adipose Visceral Omentum	sqtl	4.8e-03	-0.31	22:39073257:C:T
Heart Atrial Appendage	eqtl	5.1e-03	+0.74	22:39174314:C:A
Thyroid	eqtl	5.5e-03	+0.37	22:39041460:C:CGT

FANTOM5 promoters

1 alternative TSS:

Promoter ID	TPM avg	Samples expressed
192306	2.5056	1292

Top tissues by expression

showing 100 of 276 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	88.82	gold quality
leukocyte	CL:0000738	81.17	gold quality
monocyte	CL:0000576	80.98	gold quality
mononuclear cell	CL:0000842	80.70	gold quality
spleen	UBERON:0002106	80.47	gold quality
right ovary	UBERON:0002118	79.62	gold quality
left ovary	UBERON:0002119	78.92	gold quality
right uterine tube	UBERON:0001302	78.80	gold quality
lymph node	UBERON:0000029	78.68	gold quality
right adrenal gland	UBERON:0001233	78.54	gold quality
left adrenal gland cortex	UBERON:0035825	78.27	gold quality
left adrenal gland	UBERON:0001234	78.11	gold quality
right adrenal gland cortex	UBERON:0035827	77.54	gold quality
sural nerve	UBERON:0015488	76.98	gold quality
apex of heart	UBERON:0002098	76.84	gold quality
stromal cell of endometrium	CL:0002255	76.79	gold quality
right testis	UBERON:0004534	76.67	gold quality
tendon of biceps brachii	UBERON:0008188	76.56	silver quality
left testis	UBERON:0004533	76.25	gold quality
ovary	UBERON:0000992	76.24	gold quality
vermiform appendix	UBERON:0001154	75.81	gold quality
right atrium auricular region	UBERON:0006631	75.79	gold quality
adrenal gland	UBERON:0002369	75.75	gold quality
adrenal cortex	UBERON:0001235	75.49	gold quality
buccal mucosa cell	CL:0002336	75.33	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	75.22	gold quality
body of uterus	UBERON:0009853	75.15	gold quality
endocervix	UBERON:0000458	75.05	gold quality
testis	UBERON:0000473	74.85	gold quality
left uterine tube	UBERON:0001303	74.74	gold quality
islet of Langerhans	UBERON:0000006	74.68	gold quality
mucosa of transverse colon	UBERON:0004991	74.46	gold quality
blood	UBERON:0000178	73.82	gold quality
small intestine Peyer’s patch	UBERON:0003454	73.66	gold quality
cardiac atrium	UBERON:0002081	73.64	gold quality
mucosa of stomach	UBERON:0001199	73.62	gold quality
ectocervix	UBERON:0012249	73.30	gold quality
gall bladder	UBERON:0002110	73.28	gold quality
muscle layer of sigmoid colon	UBERON:0035805	73.18	gold quality
bone marrow cell	CL:0002092	73.04	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	72.76	gold quality
cartilage tissue	UBERON:0002418	72.15	silver quality
descending thoracic aorta	UBERON:0002345	72.11	gold quality
minor salivary gland	UBERON:0001830	71.97	gold quality
smooth muscle tissue	UBERON:0001135	71.90	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	71.84	gold quality
small intestine	UBERON:0002108	71.70	gold quality
right coronary artery	UBERON:0001625	71.68	gold quality
sigmoid colon	UBERON:0001159	71.48	gold quality
lower esophagus muscularis layer	UBERON:0035833	71.48	gold quality
left coronary artery	UBERON:0001626	71.45	gold quality
lower esophagus	UBERON:0013473	71.44	gold quality
prostate gland	UBERON:0002367	71.37	gold quality
heart	UBERON:0000948	71.36	gold quality
thoracic aorta	UBERON:0001515	71.23	gold quality
ascending aorta	UBERON:0001496	71.20	gold quality
heart left ventricle	UBERON:0002084	71.18	gold quality
right lobe of thyroid gland	UBERON:0001119	71.04	gold quality
transverse colon	UBERON:0001157	71.04	gold quality
saliva-secreting gland	UBERON:0001044	71.03	gold quality
body of stomach	UBERON:0001161	70.91	gold quality
tonsil	UBERON:0002372	70.87	gold quality
cardiac ventricle	UBERON:0002082	70.75	gold quality
left lobe of thyroid gland	UBERON:0001120	70.49	gold quality
colon	UBERON:0001155	70.40	gold quality
esophagus	UBERON:0001043	70.20	gold quality
intestine	UBERON:0000160	70.19	gold quality
adenohypophysis	UBERON:0002196	70.19	gold quality
metanephros cortex	UBERON:0010533	70.19	gold quality
tibial nerve	UBERON:0001323	70.18	gold quality
coronary artery	UBERON:0001621	70.13	gold quality
mouth mucosa	UBERON:0003729	70.10	gold quality
caecum	UBERON:0001153	70.02	gold quality
vagina	UBERON:0000996	69.98	gold quality
large intestine	UBERON:0000059	69.95	gold quality
rectum	UBERON:0001052	69.93	gold quality
upper lobe of left lung	UBERON:0008952	69.89	gold quality
thyroid gland	UBERON:0002046	69.78	gold quality
right lobe of liver	UBERON:0001114	69.69	gold quality
stomach	UBERON:0000945	69.52	gold quality
esophagus mucosa	UBERON:0002469	69.27	gold quality
pancreas	UBERON:0001264	69.21	gold quality
aorta	UBERON:0000947	69.17	gold quality
omental fat pad	UBERON:0010414	69.07	gold quality
peritoneum	UBERON:0002358	69.03	gold quality
adrenal tissue	UBERON:0018303	68.93	gold quality
pituitary gland	UBERON:0000007	68.89	gold quality
adipose tissue of abdominal region	UBERON:0007808	68.67	gold quality
colonic epithelium	UBERON:0000397	68.62	gold quality
female reproductive system	UBERON:0000474	68.57	gold quality
upper lobe of lung	UBERON:0008948	68.55	gold quality
palpebral conjunctiva	UBERON:0001812	68.49	gold quality
right lung	UBERON:0002167	68.11	gold quality
urinary bladder	UBERON:0001255	67.93	gold quality
popliteal artery	UBERON:0002250	67.87	gold quality
tibial artery	UBERON:0007610	67.87	gold quality
bone marrow	UBERON:0002371	67.61	gold quality
body of pancreas	UBERON:0001150	67.28	gold quality
heart right ventricle	UBERON:0002080	67.07	gold quality
endometrium epithelium	UBERON:0004811	66.70	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	8.47
E-GEOD-106540	no	120.08

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 61 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Lymph node	tissue	14.6
Tonsil	tissue	13.5
Spleen	tissue	11.2
Appendix	tissue	8.6
Ovary	tissue	8.4
Choroid plexus	tissue	8.1
Fallopian tube	tissue	7.8
Medulla oblongata	tissue	7.5
Midbrain	tissue	6.6
Thalamus	tissue	6.5
Pons	tissue	6.4
Epididymis	tissue	5.9
Hypothalamus	tissue	5.9
Spinal cord	tissue	5.9
Testis	tissue	5.8
Amygdala	tissue	5.5
Cerebellum	tissue	5.4
Cerebral cortex	tissue	5.3
Basal ganglia	tissue	5.3
Substantia nigra	tissue	5.2
Heart muscle	tissue	5.1
Putamen	tissue	5.1
Hippocampal formation	tissue	5.1
Thymus	tissue	5.0
Parathyroid gland	tissue	4.9
Hippocampus	tissue	4.9
Seminal vesicle	tissue	4.8
Nucleus accumbens	tissue	4.7
Locus coeruleus	tissue	4.7
Salivary gland	tissue	4.6
Stomach 1	tissue	4.5
Smooth muscle	tissue	4.2
Urinary bladder	tissue	4.2
Retrosplenial cortex	tissue	4.2
Adrenal gland	tissue	4.1
Endometrium 1	tissue	3.8
Prostate	tissue	3.8
Occipital cortex	tissue	3.7
Postcentral gyrus	tissue	3.5
Duodenum	tissue	3.4
Cervix	tissue	3.3
Vagina	tissue	3.3
Gallbladder	tissue	3.3
Pituitary gland	tissue	3.2
Lung	tissue	3.2
Small intestine	tissue	3.1
Bone marrow	tissue	3.0
Colon	tissue	2.8
Pancreas	tissue	2.8
Thyroid gland	tissue	2.8
Liver	tissue	2.7
Rectum	tissue	2.6
Breast	tissue	2.3
Esophagus	tissue	2.1
Adipose tissue	tissue	2.0
Placenta	tissue	2.0
Skin 1	tissue	1.5
Kidney	tissue	1.5
Tongue	tissue	1.2
Retina	tissue	1.0

Brain sub-regions (HPA Brain Atlas): detected in 185; highest nTPM — Area postrema (7.5), Nucleus gracilis (7.2), Nucleus tractus solitarii (7.2), Lateral funiculus (white matter) (7.0), White matter (7.0).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting APOBEC3F by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 116 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-3120-5P	100.00	65.56	965
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-450A-1-3P	100.00	69.33	1837
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-4525	99.94	64.38	675
HSA-MIR-5010-5P	99.94	64.11	705
HSA-MIR-9983-3P	99.94	71.48	3631
HSA-MIR-6499-3P	99.90	66.38	1212
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-383-3P	99.85	65.84	1359
HSA-MIR-6079	99.84	68.54	1170
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-3913-5P	99.78	67.26	968
HSA-MIR-577	99.78	69.13	2479

Functional genomics

gnomAD constraint: pLI 4.47e-10, LOEUF 1.01, missense Z 0.285 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000308521 — one region, missense o/e 0.97.

Literature-anchored findings (GeneRIF, showing 40)

• only the C-terminal domain of APOBEC3F and -3G dictates the retroviral minus strand 5’-TC and 5’-CC dinucleotide hypermutation preferences. (PMID:15647250)
• APOBEC3F was less potent than APOBEC3G in inhibitinhg HIV-1; Vif proteins appeared more potent & specific when APOBEC3G is the target rather than APOBEC3F (PMID:16460778)
• The fact that several highly conserved tryphtophan residues in Vif are specifically required for the suppression of APOBEC3F (A3F) but not that of APOBEC3G (A3G) suggests a critical role for A3F in the restriction of HIV-1 in vivo. (PMID:16501124)
• APOBEC3B and APOBEC3F have roles in inhibiting L1 retrotransposition by a DNA deamination-independent mechanism (PMID:16648136)
• novel link between innate immunity against retroviruses and P-bodies suggesting that APOBEC3G and APOBEC3F could function in the context of P-bodies to restrict HIV-1 replication. (PMID:16699599)
• The Chinese population had a higher frequency of small alleles and showed a difference in allelic structure and frequency distribution in apolipoprotein B from European and American in this populations. (PMID:16767679)
• separation of function of the cytidine deaminase domains is maintained in hA3B and hA3F, but roles of the two domains are reversed in mouse A3 (PMID:17020885)
• APOBEC3F and APOBEC3G complexes undergo dynamic conversion during HIV-1 infection (PMID:17142455)
• Findings highlight a role for APOBEC3G/3F in explaining the resistance of most dendritic cells to HIV-1 infection, as well as the susceptibility of a fraction of immature dendritic cells. (PMID:17145955)
• Results reveal two distinct Vif determinants, amino acids Y(40)RHHY(44) and D(14)RMR(17), which are essential for binding to APOBEC3G and APOBEC3F, respectively. (PMID:17522216)
• Vif binding to RNA and DNA offers several non-exclusive ways to counteract APOBEC3G/3F factors, in addition to the well documented Vif-induced degradation by the proteasome and to the Vif-mediated repression of translation of these antiviral factors (PMID:17609216)
• Studies focused mainly on APOBEC3F imply that it occurs associated with mRNA-PABP1 in translationally active polysomes and to a lesser extent in mRNA processing bodies (P-bodies). (PMID:17977970)
• define a number of subtle differences between the ribonucleoprotein complexes associated with APOBEC3F and APOBEC3G and speculate (PMID:18367521)
• results here have indicated that at least two distinct regions in the N-terminal half of HIV-1 Vif are critical for binding and exclusion of APOBEC3G/F (PMID:18603011)
• A VxIPLx(4-5)LxPhix(2)YWxL motif in HIV-1 Vif is identified, which is required for efficient interaction between Vif and APOBEC3G (A3G), Vif-mediated A3G degradation and virion exclusion, and functional suppression of the A3G antiviral activity. (PMID:18619467)
• The APOBEC3F domain that interacts with the Vif DRMR region was located between amino acids 283 and 300 of A3F. (PMID:19036809)
• Distinct determinants in HIV-1 Vif and human APOBEC3 proteins are required for the suppression of diverse host anti-viral proteins. (PMID:19088851)
• analysis of genetic editing of HBV DNA by monodomain human APOBEC3G and F cytidine deaminases (PMID:19169351)
• relationship between the human immunodeficiency virus type 1 viral infectivity factor (Vif) and the human APOBEC-3G and APOBEC-3F restriction factors [Review] (PMID:19487726)
• Thus, (21)WxSLVK(26) is a novel functional domain that regulates Vif activity toward both APOBEC3F and APOBEC3G and is a potential drug target to inhibit Vif activity and block HIV-1 replication. (PMID:19535447)
• When recognition loop of 9-11 amino acids is grafted from the donor APOBEC3F or 3G proteins into the acceptor scaffold of AID, the mutational signature of AID changes toward that of the donor proteins. (PMID:19561087)
• APOBEC3G and APOBEC3F gene expression in immune system and hematopoietic system cells (PMID:19587057)
• exosomes secreted by CD4(+)H9 T cells and mature monocyte-derived dendritic cells encapsidate APOBEC3G and APOBEC3F and inhibit L1 and Alu retrotransposition (PMID:20153011)
• The authors observed that both APOBEC3F and APOBEC3G inhibit HIV-1 DNA synthesis and integration, but APOBEC3F is more potent than APOBEC3G in preventing HIV-1 DNA integration. (PMID:20219927)
• hiv1 VIF sequences (81)LGxGxxIxW(89) and (171)EDRW(174) are two novel functional domains that are very critical for Vif function and Vif binding to both A3G and A3F (PMID:20335268)
• These results suggest that APOBEC3F neutralization is dispensable for HIV-1 replication in primary human T-lymphocytes. (PMID:20592068)
• T(Q/D/E)x(5)ADx(2)(I/L) motif of HIV1 Vif protein is a critical motif for interaction with APOBEC3G and APOBEC3F. (PMID:20592083)
• Alternative splicing of A3F mRNA generates truncated antiviral proteins that differ sharply in their sensitivity to Vif. (PMID:20624919)
• Long-term restriction by APOBEC3F selects human immunodeficiency virus type 1 variants with restored Vif function. (PMID:20686027)
• the antiviral activity of endogenous A3F is negligible compared to that of A3G. (PMID:20702622)
• HIV-1 central polypurine tract functions as a second line of defense against APOBEC3G and APOBEC3F. (PMID:20844042)
• G-to-A mutations on V3 HIV peptide caused by APOBEC3F and APOBEC3G facilitate co-receptor switch of HIV from R5 to X4 strains. (PMID:21573951)
• levels of A3G and A3F expression and induced G-to-A hypermutation in a group of children with distinct profiles of disease progression (PMID:21897871)
• Most Vif proteins counteract APOBEC3G and APOBEC3F efficiently but display differences with respect to the inhibition of APOBEC3H. (PMID:22013041)
• APOBEC3G/3F and BST-2 mRNA expression was significantly elevated during IFN-alpha/riba treatment in patient-derived CD4+ T cells (P < 0.04 and P < 0.008, paired Wilcoxon), and extent of BST-2 induction was correlated with reduction in HIV-1 viral load. (PMID:22315404)
• Analysis of the A3F (W126A L306A) double mutant revealed that both residues are required for full anti-HIV function (PMID:22451677)
• endogenous levels of APOBEC3D, APOBEC3F, and APOBEC3G combine to restrict Vif-deficient HIV-1 and cause the hallmark dinucleotide hypermutation patterns in in the nonpermissive T cell line CEM2n (PMID:22807680)
• The authors conclude that APOBEC3G exerts a greater restriction effect on HIV-1 than APOBEC3F and APOBEC3DE. (PMID:23097438)
• Data indicate that internal lysines are the dominant ubquuitin (Ub) acceptor sites in both APOBEC3F(A3F) and APOBEC3G (A3G). (PMID:23318957)
• APOBEC3F/G-specific responses in HIV-1-infected patients are CD8+ T cell mediated. (PMID:23536679)

Cross-species orthologs

0 orthologs

Paralogs (9): APOBEC3H (ENSG00000100298), APOBEC1 (ENSG00000111701), AICDA (ENSG00000111732), APOBEC2 (ENSG00000124701), APOBEC3A (ENSG00000128383), APOBEC3B (ENSG00000179750), APOBEC3G (ENSG00000239713), APOBEC3D (ENSG00000243811), APOBEC3C (ENSG00000244509)

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Pan paniscus	Q694B6	99.2%	Diamond
Pan troglodytes	Q7YR24	99.2%	Diamond
Pongo pygmaeus	Q694B4	98.7%	Diamond
Macaca fascicularis	Q694C2	96.4%	Diamond
Macaca nigra	Q694C4	96.4%	Diamond
Rattus norvegicus	P60705	95.6%	Diamond
Gorilla gorilla gorilla	Q694C1	95.6%	Diamond
Mus musculus	Q99J72	95.6%	Diamond
Canis lupus familiaris	Q75W64	94.9%	Diamond
Bos taurus	Q2PT36	94.5%	Diamond
Macaca mulatta	Q7YR23	93.7%	Diamond
Papio anubis	Q694B7	93.0%	Diamond
Erythrocebus patas	Q694C5	92.0%	Diamond
Chlorocebus aethiops	Q7YR25	92.0%	Diamond
Cricetulus longicaudatus	P60704	89.0%	Diamond
Mesocricetus auratus	Q9EQP0	83.7%	Diamond
Lagothrix lagotricha	Q694B8	80.8%	Diamond
Saguinus labiatus	Q694B9	80.8%	Diamond
Oryctolagus cuniculus	P47855	75.4%	Diamond
Monodelphis domestica	Q9TUI7	67.4%	Diamond
Felis catus	A9QA56	53.1%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
APOBEC3D	protein-coding	140564
APOBEC3G	protein-coding	60489
APOBEC3B-AS1	ncRNA	100874530
APOBEC3C	protein-coding	27350
APOBEC3B	protein-coding	9582
APOBEC3H	protein-coding	164668

Protein

Protein identifiers

DNA dC->dU-editing enzyme APOBEC-3F — Q8IUX4 (reviewed: Q8IUX4)

Alternative names: Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3F

All UniProt accessions (1): Q8IUX4

UniProt curated annotations — full annotation on UniProt →

Function. DNA deaminase (cytidine deaminase) which acts as an inhibitor of retrovirus replication and retrotransposon mobility via deaminase-dependent and -independent mechanisms. Exhibits antiviral activity against viruse such as HIV-1 or HIV-2. After the penetration of retroviral nucleocapsids into target cells of infection and the initiation of reverse transcription, it can induce the conversion of cytosine to uracil in the minus-sense single-strand viral DNA, leading to G-to-A hypermutations in the subsequent plus-strand viral DNA. The resultant detrimental levels of mutations in the proviral genome, along with a deamination-independent mechanism that works prior to the proviral integration, together exert efficient antiretroviral effects in infected target cells. Selectively targets single-stranded DNA and does not deaminate double-stranded DNA or single- or double-stranded RNA. Exhibits antiviral activity also against hepatitis B virus (HBV), equine infectious anemia virus (EIAV), xenotropic MuLV-related virus (XMRV) and simian foamy virus (SFV) and may inhibit the mobility of LTR and non-LTR retrotransposons. May also play a role in the epigenetic regulation of gene expression through the process of active DNA demethylation.

Subunit / interactions. Homodimer. Interacts with APOBEC3G in an RNA-dependent manner. Interacts with AGO1, AGO2 and AGO3. (Microbial infection) Interacts with HIV-1 Vif, leading to its ubiquitination and degradation by the proteasome. In the absence of Vif protein, specifically packaged into HIV-1 virions.

Subcellular location. Cytoplasm. P-body.

Tissue specificity. Widely expressed. Highly expressed in ovary.

Post-translational modifications. (Microbial infection) Following infection by HIV-1, ubiquitinated by a cullin-5-RING E3 ubiquitin-protein ligase complex (ECS complex) hijacked by the HIV-1 Vif protein, leading to its degradation.

Activity regulation. (Microbial infection) Antiviral activity is neutralized by the HIV-1 virion infectivity factor (Vif), that prevents its incorporation into progeny virions by both inhibiting its translation and/or by inducing its ubiquitination and subsequent degradation by the 26S proteasome.

Domain organisation. The CMP/dCMP deaminase domain 1 mediates RNA binding, RNA-dependent oligomerization and virion incorporation whereas the CMP/dCMP deaminase domain 2 confers deoxycytidine deaminase activity and substrate sequence specificity.

Miscellaneous. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. May be due to a competing donor splice site.

Similarity. Belongs to the cytidine and deoxycytidylate deaminase family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q8IUX4-1	1	yes
Q8IUX4-2	2
Q8IUX4-3	3

RefSeq proteins (2): NP_001006667, NP_660341* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002125	CMP_dCMP_dom	Domain
IPR016192	APOBEC/CMP_deaminase_Zn-bd	Binding_site
IPR016193	Cytidine_deaminase-like	Homologous_superfamily
IPR050610	APOBEC_Cyt_Deaminase	Family
IPR059136	APOBEC3_CD_dom	Domain

Pfam: PF18782

Enzyme classification (BRENDA)

• EC 3.5.4.38 — single-stranded DNA cytosine deaminase (BRENDA: 8 organisms, 58 substrates, 4 inhibitors, 11 Km, 10 kcat entries)

Substrate kinetics (BRENDA)

2 substrates with measured Km, best-characterized 2. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
CCCA	0.001–0.073	5
TTCA	0.001–0.019	5

Catalyzed reactions (Rhea)

• a 2’-deoxycytidine in single-stranded DNA + H2O + H(+) = a 2’-deoxyuridine in single-stranded DNA + NH4(+) (RHEA:50948)

UniProt features (87 total): mutagenesis site 30, helix 17, strand 10, sequence variant 7, cross-link 6, binding site 6, splice variant 4, domain 2, turn 2, chain 1, disulfide bond 1, active site 1

Structure

Experimental structures (PDB)

10 structures by resolution:

PDB	Title	Method	Resolution (Å)
5HX4	Zinc-Free APOBEC3F Catalytic Domain Crystal Structure	X-RAY DIFFRACTION	1.92
5ZVB	APOBEC3F Chimeric Catalytic Domain in Complex with DNA(dT9)	X-RAY DIFFRACTION	2
5ZVA	APOBEC3F Chimeric Catalytic Domain in Complex with DNA(dC9)	X-RAY DIFFRACTION	2.3
5HX5	APOBEC3F Catalytic Domain Crystal Structure	X-RAY DIFFRACTION	2.33
3WUS	Crystal Structure of the Vif-Binding Domain of Human APOBEC3F	X-RAY DIFFRACTION	2.54
8VUD	Crystal structure of APOBEC3F-CD1	X-RAY DIFFRACTION	2.6
4IOU	Crystal structure of the HIV-1 Vif binding, catalytically active domain of APOBEC3F	X-RAY DIFFRACTION	2.75
4J4J	Crystal structure of the APOBEC3F Vif binding domain	X-RAY DIFFRACTION	3.1
5W2M	APOBEC3F Catalytic Domain Complex with a Single-Stranded DNA	X-RAY DIFFRACTION	3.7
6NIL	cryoEM structure of the truncated HIV-1 Vif/CBFbeta/A3F complex	ELECTRON MICROSCOPY	3.9

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8IUX4-F1	89.31	0.64

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Hydrolases, Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): cytosol; nucleoplasm

Antibody reliability (HPA): IF uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
251	proton donor

Ligand- & substrate-binding residues (6)

Position	Role
65	Zn(2+)
96	Zn(2+)
99	Zn(2+)
249	Zn(2+)
280	Zn(2+)
283	Zn(2+)

Post-translational modifications (6)

Type	Positions
(microbial infection) glycyl lysine isopeptide (lys-gly) (interchain with g-cter in ubiquitin)	52, 234, 334, 352, 355, 358

Disulfide bonds (1)

Type	Positions
Disulfide bond	280–283

Mutagenesis-validated functional residues (30)

Position	Phenotype
65	reduced but not abolished antiviral activity.
65	nearly abolished antiviral activity; when associated with r-249.
67	decrease in cytidine deaminase and antiviral activity; when associated with a-251.
67	no effect on cytidine deaminase and antiviral activity.
67	reduced but not abolished antiviral activity. nearly abolished antiviral activity; when associated with q-251.
96	reduced but not abolished antiviral activity. nearly abolished antiviral activity; when associated with q-280.
99	reduced but not abolished antiviral activityy. nearly abolished antiviral activity; when associated with s-283.
249	reduced but not abolished antiviral activity.
249	nearly abolished antiviral activity; when associated with r-65.
251	decrease in cytidine deaminase and antiviral activity.
251	decrease in cytidine deaminase and antiviral activity; when associated with a-67.
251	remains able to bind vif.
251	reduced but not abolished antiviral activity. nearly abolished antiviral activity; when associated with q-67.
255	resistant to hiv-1 vif and reduces vif binding but is still efficiently incorporated into the virion.
258	resistant to hiv-1 vif and reduces vif binding but is still efficiently incorporated into the virion.
259	resistant to hiv-1 vif and reduces vif binding but is still efficiently incorporated into the virion.
260–261	does not affect interaction with apobec3g.
262–263	resistant to hiv-1 vif and abolishes vif binding but is still efficiently incorporated into the virion.
264	resistant to hiv-1 vif and reduces vif binding but is still efficiently incorporated into the virion.
265	impaired interaction with hiv-1 vif protein.
269	resistant to hiv-1 vif and reduces vif binding but is still efficiently incorporated into the virion.
280	reduced but not abolished antiviral activity. nearly abolished antiviral activity; when associated with q-96.
283	reduced but not abolished antiviral activity. nearly abolished antiviral activity; when associated with s-99.
289	abolished interaction with hiv-1 vif protein. resistant to hiv-1 vif and reduces vif binding but is still efficiently incorporated into the …
290	resistant to hiv-1 vif and reduces vif binding but is still efficiently incorporated into the virion.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 128 (showing top): GOBP_REGULATION_OF_DEFENSE_RESPONSE_TO_VIRUS, GOBP_NEGATIVE_REGULATION_OF_VIRAL_PROCESS, GOBP_DNA_MODIFICATION, GOBP_DEFENSE_RESPONSE_TO_OTHER_ORGANISM, GOBP_RNA_MODIFICATION, GOBP_REGULATION_OF_RESPONSE_TO_STRESS, GOBP_VIRAL_GENOME_REPLICATION, GOBP_VIRAL_LIFE_CYCLE, GOBP_DNA_TEMPLATED_TRANSCRIPTION_INITIATION, GOBP_TRANSCRIPTION_INITIATION_AT_RNA_POLYMERASE_II_PROMOTER, GOBP_DEFENSE_RESPONSE_TO_VIRUS, GOBP_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS, GOBP_REGULATION_OF_RESPONSE_TO_BIOTIC_STIMULUS, GOBP_REGULATION_OF_DEFENSE_RESPONSE, GOBP_CHROMATIN_REMODELING

GO Biological Process (14): positive regulation of defense response to virus by host (GO:0002230), transposable element silencing (GO:0010526), base conversion or substitution editing (GO:0016553), cytidine to uridine editing (GO:0016554), positive regulation of gene expression via chromosomal CpG island demethylation (GO:0044029), clearance of foreign intracellular DNA (GO:0044355), negative regulation of viral genome replication (GO:0045071), innate immune response (GO:0045087), negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869), negative regulation of viral process (GO:0048525), defense response to virus (GO:0051607), DNA cytosine deamination (GO:0070383), antiviral innate immune response (GO:0140374), immune system process (GO:0002376)

GO Molecular Function (8): RNA binding (GO:0003723), cytidine deaminase activity (GO:0004126), zinc ion binding (GO:0008270), identical protein binding (GO:0042802), catalytic activity (GO:0003824), protein binding (GO:0005515), hydrolase activity (GO:0016787), metal ion binding (GO:0046872)

GO Cellular Component (5): P-body (GO:0000932), nucleus (GO:0005634), cytoplasm (GO:0005737), apolipoprotein B mRNA editing enzyme complex (GO:0030895), ribonucleoprotein complex (GO:1990904)

GO top-level categories

41 GO namespaces:

Category	Terms
regulation of defense response to virus by host	1
negative regulation of gene expression	1
retrotransposition	1
RNA modification	1
base conversion or substitution editing	1
transcription initiation-coupled chromatin remodeling	1
clearance of foreign intracellular nucleic acids	1
viral genome replication	1
regulation of viral genome replication	1
negative regulation of viral process	1
immune response	1
defense response to symbiont	1
single stranded viral RNA replication via double stranded DNA intermediate	1
negative regulation of viral genome replication	1
regulation of single stranded viral RNA replication via double stranded DNA intermediate	1
negative regulation of RNA biosynthetic process	1
viral process	1
negative regulation of biological process	1
regulation of viral process	1
defense response	1
response to virus	1
DNA deamination	1
innate immune response	1
defense response to virus	1
biological_process	1
nucleic acid binding	1
hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines	1
deaminase activity	1
transition metal ion binding	1
protein binding	1
molecular_function	1
binding	1
catalytic activity	1
cation binding	1
cytoplasmic ribonucleoprotein granule	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1
cellular anatomical structure	1
mRNA editing complex	1
nuclear protein-containing complex	1
protein-containing complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 18 of 27 annotations. The rest are phylogenetic / computational / electronic (IEA).

18 experimentally-supported GO terms:

GO term	NS	Evidence
DNA cytosine deamination	BP	direct assay
antiviral innate immune response	BP	direct assay
base conversion or substitution editing	BP	direct assay
clearance of foreign intracellular DNA	BP	direct assay
innate immune response	BP	direct assay
negative regulation of single stranded viral RNA replication via double stranded DNA intermediate	BP	direct assay
negative regulation of viral genome replication	BP	direct assay
negative regulation of viral process	BP	direct assay
positive regulation of defense response to virus by host	BP	direct assay
positive regulation of gene expression via chromosomal CpG island demethylation	BP	direct assay
transposable element silencing	BP	direct assay
P-body	CC	direct assay
cytoplasm	CC	direct assay
ribonucleoprotein complex	CC	direct assay
RNA binding	MF	direct assay
cytidine deaminase activity	MF	direct assay
identical protein binding	MF	physical interaction
zinc ion binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 796 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
APOBEC3F	CUL5	Q93034	916
APOBEC3F	CDA	P32320	823
APOBEC3F	APOBEC4	Q8WW27	793
APOBEC3F	TRIM5	Q9C035	695
APOBEC3F	APOB	P04114	675
APOBEC3F	ELOB	Q15370	653
APOBEC3F	ELOC	Q15369	607
APOBEC3F	CBFB	Q13951	571
APOBEC3F	RBX1	P62877	565
APOBEC3F	SAMHD1	Q9Y3Z3	551
APOBEC3F	RNF7	Q9UBF6	536
APOBEC3F	BST2	Q10589	522
APOBEC3F	UNG	P13051	508
APOBEC3F	MOV10	Q9HCE1	464
APOBEC3F	CD4	P01730	401

IntAct

Human interaction partners of APOBEC3F in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

3 partners by confidence:

Partner	Interaction type	MIscore	Records
APOBEC3G	physical association	0.400	1
ACD	physical association	0.370	1
TINF2	physical association	0.370	1

BioGRID (94 interactions; top human partners by supporting records): APOBEC3D (Affinity Capture-MS; 2 records), ELAVL2 (Affinity Capture-MS; 2 records), SNRNP70 (Affinity Capture-MS; 2 records), TRA2A (Affinity Capture-MS; 2 records), VHL (Affinity Capture-Western; 2 records), ZC3H18 (Affinity Capture-MS; 2 records), ABT1 (Affinity Capture-MS), ACD (Two-hybrid), ARIH2 (Biochemical Activity), BMI1 (Affinity Capture-MS), CBX6 (Affinity Capture-MS), CHPF (Affinity Capture-MS), CLK3 (Affinity Capture-MS), COQ4 (Affinity Capture-MS), DCAF4 (Proximity Label-MS)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
APOBEC3F	up-regulates	“Clearance_of_foreign intracellular_DNA”

Disease & clinical

Genetic variants

Variant evidence for APOBEC3F: 84 ClinVar records (0 pathogenic / likely pathogenic).

ClinVar

84 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	57
Likely benign	7
Benign	2

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 17 predictions of 761):

Position(s)	Effect	Δscore	Sites
22:39043159	donor_gain	1.0000
22:39040978–39040979	donor_loss	0.9900	4
22:39043121	donor_gain	0.9900
22:39043127	donor_gain	0.9900
22:39043141	donor_gain	0.9800
22:39052354–39052355	donor_loss	0.9800	5
22:39052150	acceptor_gain	0.9700
22:39052321	donor_gain	0.9700
22:39052682	donor_gain	0.9700
22:39040978	donor_loss	0.9600

AlphaMissense

629 missense substitutions predicted likely pathogenic (of 2,496 scored), across 169 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M147	9	0.758	0.936
N206	8	0.870	0.965
F238	8	0.848	0.970
F351	8	0.835	0.960
F254	8	0.834	0.960
F17	8	0.832	0.977
F70	8	0.794	0.953
F204	7	0.911	0.975
W277	7	0.910	0.971
W217	7	0.889	0.963
F336	7	0.878	0.970
F152	7	0.877	0.974
F200	7	0.876	0.972
W354	7	0.876	0.943
F290	7	0.874	0.980
F343	7	0.853	0.967
W93	7	0.850	0.937
F90	7	0.847	0.971
C219	7	0.846	0.931
F21	7	0.844	0.972

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Glioblastoma Multiforme (validation)	unfavorable	4.23e-07
Kidney Renal Clear Cell Carcinoma (TCGA)	unfavorable	0.000812

Disease associations

OMIM: gene MIM:608993 | disease phenotypes:

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2007626 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

32 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Estradiol	increases expression, affects cotreatment, decreases expression	2
Tobacco Smoke Pollution	decreases expression	2
Aflatoxin B1	increases expression	2
aristolochic acid I	increases expression	1
GSK-J4	decreases expression	1
triphenyl phosphate	affects expression	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	affects cotreatment, decreases expression, increases abundance	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
ceric oxide	decreases expression	1
cobalt oxide	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
ICG 001	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Decitabine	increases expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Azacitidine	increases expression	1
Benzo(a)pyrene	increases methylation	1
Diuron	decreases expression	1
Doxorubicin	affects expression	1
Hydrogen Peroxide	affects expression	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Nickel	increases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Ribonucleotides	affects binding	1
Smoke	decreases expression	1
Tretinoin	increases expression	1
Urethane	decreases expression	1
Sodium Selenite	decreases expression	1

ChEMBL screening assays

3 unique, capped per target: 3 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1963966	Functional	PUBCHEM_BIOASSAY: qHTS for Inhibitors of Vif-A3F Interactions: qHTS. (Class of assay: confirmatory)	PubChem BioAssay data set

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.