APOOL

Summary

APOOL (apolipoprotein O like, HGNC:24009) is a protein-coding gene on chromosome Xq21.1, encoding MICOS complex subunit MIC27 (Q6UXV4). Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane.

This gene encodes a protein which contains an apolipoprotein O superfamily domain. This domain is found on proteins in circulating lipoprotein complexes.

Source: NCBI Gene 139322 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 117 total — 14 pathogenic, 1 likely-pathogenic
• GTEx eGene: eQTL in 28 tissues, sQTL in 5 (q < 0.05)
• MANE Select transcript: NM_198450
• Notable: 117 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24009
Approved symbol	APOOL
Name	apolipoprotein O like
Location	Xq21.1
Locus type	gene with protein product
Status	Approved
Aliases	UNQ8193, AAIR8193, Mic27, MICOS27
Ensembl gene	ENSG00000155008
Ensembl biotype	protein_coding
OMIM	300955
Entrez	139322

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 6 protein_coding, 1 nonsense_mediated_decay

MANE Select: ENST00000373173

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1

ENST00000373173, ENST00000895507, ENST00000895508, ENST00000990590, ENST00001089618, ENST00001098352, ENST00001134797

RefSeq mRNA: 1 — MANE Select: NM_198450 NM_198450

CCDS: CCDS48138

Canonical transcript exons

ENST00000373173 — 9 exons

Exon	Start	End
ENSE00001018759	85054344	85054398
ENSE00001018761	85051389	85051508
ENSE00001018762	85067127	85067218
ENSE00001190497	85073998	85074111
ENSE00001214782	85074274	85074391
ENSE00001294157	85055827	85055925
ENSE00001459714	85087590	85093315
ENSE00001459717	85003877	85003927
ENSE00001708477	85046446	85046550

Expression profiles

Bgee: expression breadth ubiquitous, 282 present calls, max score 95.20.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 10.0933 / max 107.3570, expressed in 1726 samples.

Highest expression (Bgee): skeletal muscle tissue of biceps brachii, biceps brachii, diaphragm, heart right ventricle, ventricle myocardium.

Genetic regulation across tissues (GTEx eQTL / sQTL)

APOOL is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 28 tissues and its splicing (sQTL) in 5 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 33 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Artery Tibial	eqtl	3.4e-53	+0.29	X:85018942:GT:G
Artery Aorta	eqtl	6.6e-31	+0.29	X:85081382:G:A
Pituitary	eqtl	3.9e-30	-0.42	X:85043683:G:A
Muscle Skeletal	eqtl	8.3e-29	+0.17	X:85088817:CAGTGAGCAAATTAGAAGAATAGGTTAGAAGAATAGGGTAGTAGATACTG:C
Thyroid	eqtl	1.6e-22	-0.22	X:84959436:A:G
Cells Cultured fibroblasts	eqtl	2.4e-21	+0.28	X:85088817:CAGTGAGCAAATTAGAAGAATAGGTTAGAAGAATAGGGTAGTAGATACTG:C
Adipose Subcutaneous	eqtl	2.4e-12	+0.17	X:85125297:G:A
Nerve Tibial	eqtl	4.6e-12	+0.16	X:85088817:CAGTGAGCAAATTAGAAGAATAGGTTAGAAGAATAGGGTAGTAGATACTG:C
Brain Substantia nigra	eqtl	9.8e-11	+0.28	X:84983014:C:T
Cells EBV-transformed lymphocytes	eqtl	3.0e-10	+0.36	X:85048896:C:G
Spleen	eqtl	1.2e-08	-0.24	X:85094801:G:A
Liver	eqtl	2.7e-08	+0.22	X:84929287:G:A
Artery Coronary	eqtl	1.1e-06	+0.19	X:85061908:G:T
Testis	eqtl	3.5e-06	-0.09	X:84959436:A:G
Colon Transverse	eqtl	4.9e-06	+0.14	X:85073247:T:C
Breast Mammary Tissue	eqtl	2.7e-05	+0.13	X:85125297:G:A
Skin Sun Exposed Lower leg	eqtl	1.5e-04	+0.40	X:85032470:C:G
Adipose Visceral Omentum	eqtl	1.7e-04	+0.13	X:85117441:G:T
Whole Blood	eqtl	9.9e-04	+0.10	X:85125297:G:A
Kidney Cortex	eqtl	1.6e-03	+0.32	X:84994784:C:T

FANTOM5 promoters

1 alternative TSS:

Promoter ID	TPM avg	Samples expressed
196838	10.0933	1726

Top tissues by expression

showing 100 of 294 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	95.20	gold quality
biceps brachii	UBERON:0001507	94.52	gold quality
diaphragm	UBERON:0001103	93.72	gold quality
heart right ventricle	UBERON:0002080	93.13	gold quality
left ventricle myocardium	UBERON:0006566	92.68	gold quality
blood vessel layer	UBERON:0004797	91.54	gold quality
myocardium	UBERON:0002349	91.45	gold quality
skeletal muscle tissue	UBERON:0001134	90.41	gold quality
deltoid	UBERON:0001476	90.39	gold quality
vastus lateralis	UBERON:0001379	90.33	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	90.30	gold quality
quadriceps femoris	UBERON:0001377	90.00	gold quality
parietal pleura	UBERON:0002400	89.97	gold quality
hair follicle	UBERON:0002073	89.80	silver quality
muscle tissue	UBERON:0002385	89.41	gold quality
visceral pleura	UBERON:0002401	89.36	gold quality
pleura	UBERON:0000977	89.18	gold quality
endothelial cell	CL:0000115	88.91	silver quality
cardiac muscle of right atrium	UBERON:0003379	88.68	gold quality
tibialis anterior	UBERON:0001385	88.37	gold quality
pigmented layer of retina	UBERON:0001782	87.99	gold quality
buccal mucosa cell	CL:0002336	87.92	gold quality
tibia	UBERON:0000979	87.90	gold quality
mucosa of sigmoid colon	UBERON:0004993	87.03	gold quality
nephron tubule	UBERON:0001231	86.39	gold quality
upper leg skin	UBERON:0004262	86.21	gold quality
CA1 field of hippocampus	UBERON:0003881	86.19	gold quality
colonic mucosa	UBERON:0000317	86.09	gold quality
esophagus squamous epithelium	UBERON:0006920	86.07	gold quality
cauda epididymis	UBERON:0004360	86.01	gold quality
muscle organ	UBERON:0001630	86.00	gold quality
corpus epididymis	UBERON:0004359	85.96	gold quality
nipple	UBERON:0002030	85.91	gold quality
tongue squamous epithelium	UBERON:0006919	85.89	gold quality
kidney epithelium	UBERON:0004819	85.38	gold quality
germinal epithelium of ovary	UBERON:0001304	85.35	gold quality
squamous epithelium	UBERON:0006914	85.31	gold quality
jejunum	UBERON:0002115	85.24	gold quality
caput epididymis	UBERON:0004358	85.13	gold quality
jejunal mucosa	UBERON:0000399	84.98	gold quality
epithelium of esophagus	UBERON:0001976	84.81	gold quality
oral cavity	UBERON:0000167	84.41	gold quality
cervix squamous epithelium	UBERON:0006922	84.28	gold quality
palpebral conjunctiva	UBERON:0001812	84.26	gold quality
entorhinal cortex	UBERON:0002728	84.22	gold quality
postcentral gyrus	UBERON:0002581	84.17	gold quality
skin of hip	UBERON:0001554	84.13	gold quality
muscle of leg	UBERON:0001383	84.04	gold quality
seminal vesicle	UBERON:0000998	83.99	gold quality
gastrocnemius	UBERON:0001388	83.80	gold quality
adrenal tissue	UBERON:0018303	83.73	gold quality
superficial temporal artery	UBERON:0001614	83.47	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.33	gold quality
liver	UBERON:0002107	83.21	gold quality
hindlimb stylopod muscle	UBERON:0004252	83.16	gold quality
lower lobe of lung	UBERON:0008949	83.13	gold quality
superior frontal gyrus	UBERON:0002661	82.97	gold quality
Brodmann (1909) area 23	UBERON:0013554	82.94	gold quality
middle temporal gyrus	UBERON:0002771	82.91	gold quality
cardia of stomach	UBERON:0001162	82.72	gold quality
cardiac ventricle	UBERON:0002082	82.72	gold quality
choroid plexus epithelium	UBERON:0003911	82.68	gold quality
islet of Langerhans	UBERON:0000006	82.52	gold quality
heart left ventricle	UBERON:0002084	82.44	gold quality
metanephric glomerulus	UBERON:0004736	82.41	gold quality
parietal lobe	UBERON:0001872	82.36	gold quality
gingival epithelium	UBERON:0001949	82.34	gold quality
oviduct epithelium	UBERON:0004804	82.27	gold quality
renal glomerulus	UBERON:0000074	82.08	gold quality
Brodmann (1909) area 46	UBERON:0006483	82.07	gold quality
mammalian vulva	UBERON:0000997	81.86	gold quality
metanephros	UBERON:0000081	81.84	gold quality
epithelium of mammary gland	UBERON:0003244	81.83	gold quality
mammary duct	UBERON:0001765	81.78	gold quality
gingiva	UBERON:0001828	81.77	gold quality
ileal mucosa	UBERON:0000331	81.71	gold quality
kidney	UBERON:0002113	81.67	gold quality
heart	UBERON:0000948	81.58	gold quality
saphenous vein	UBERON:0007318	81.46	gold quality
thoracic mammary gland	UBERON:0005200	81.44	gold quality
popliteal artery	UBERON:0002250	81.34	gold quality
tibial artery	UBERON:0007610	81.32	gold quality
mammary gland	UBERON:0001911	81.30	gold quality
sperm	CL:0000019	81.01	gold quality
epithelium of nasopharynx	UBERON:0001951	80.94	silver quality
pons	UBERON:0000988	80.89	gold quality
decidua	UBERON:0002450	80.71	silver quality
renal medulla	UBERON:0000362	80.55	gold quality
cortex of kidney	UBERON:0001225	80.48	gold quality
bronchial epithelial cell	CL:0002328	80.46	gold quality
aorta	UBERON:0000947	80.46	gold quality
substantia nigra pars compacta	UBERON:0001965	80.46	gold quality
duodenum	UBERON:0002114	80.45	gold quality
dorsal root ganglion	UBERON:0000044	80.42	gold quality
mucosa of paranasal sinus	UBERON:0005030	80.31	gold quality
medial globus pallidus	UBERON:0002477	80.16	gold quality
male germ cell	CL:0000015	80.09	silver quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	80.01	gold quality
epithelial cell of pancreas	CL:0000083	79.85	silver quality
descending thoracic aorta	UBERON:0002345	79.85	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-6678	yes	647.06
E-ANND-3	yes	7.65

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Choroid plexus	tissue	20.9
Postcentral gyrus	tissue	19.8
Locus coeruleus	tissue	19.4
Olfactory bulb	tissue	17.8
Spinal cord	tissue	17.0
Hippocampus	tissue	17.0	not detected
Skeletal muscle	tissue	16.7	not detected
Tongue	tissue	16.7
Cerebellum	tissue	15.7	medium
Nucleus accumbens	tissue	15.5
Corpus callosum	tissue	15.3
Medulla oblongata	tissue	14.5
Liver	tissue	13.5	medium
Substantia nigra	tissue	13.4
Superior colliculi	tissue	13.0
Cerebral cortex	tissue	12.7	medium
Insular cortex	tissue	12.7
Hippocampal formation	tissue	12.5
Periaqueductal gray	tissue	12.5
Basal ganglia	tissue	12.4	low
Midbrain	tissue	12.4
Pons	tissue	12.3
Putamen	tissue	12.3
Amygdala	tissue	12.2
Retrosplenial cortex	tissue	12.2
Retrosplenial and cingulate cortex	tissue	12.1
Septum	tissue	12.1
Thalamus	tissue	12.0
Hypothalamus	tissue	11.6
Entorhinal cortex	tissue	11.6
Temporal cortex	tissue	11.4
Prefrontal cortex	tissue	11.2
Ventral forebrain	tissue	11.2
Motor cortex	tissue	11.1
Occipital cortex	tissue	11.1
Parathyroid gland	tissue	10.9	medium
Heart muscle	tissue	10.8	high
Somatosensory cortex	tissue	10.6
Kidney	tissue	10.4	medium
Caudate putamen	tissue	7.9
Thyroid gland	tissue	7.8	low
Stomach 1	tissue	6.4	medium
Skin 1	tissue	6.3	medium
Breast	tissue	6.2	medium
Retina	tissue	6.2
Adrenal gland	tissue	6.2	medium
Rectum	tissue	6.1	high
Frontal cortex	tissue	6.0
Esophagus	tissue	5.8	low
Pancreas	tissue	5.7	high
Adipose tissue	tissue	5.5	not detected
Salivary gland	tissue	5.5	medium
Smooth muscle	tissue	5.5	medium
Colon	tissue	5.5	medium
Duodenum	tissue	5.5	medium
Prostate	tissue	5.5	medium
Fallopian tube	tissue	4.8	not detected
Epididymis	tissue	4.5
Small intestine	tissue	4.3	medium
Seminal vesicle	tissue	4.2	medium

Brain sub-regions (HPA Brain Atlas): detected in 190; highest nTPM — Lateral geniculate body (19.1), Spinal trigeminal nucleus, interpolar (19.0), Pulvinar (18.6), Median raphe nucleus (18.5), Medial vestibular nucleus (18.4).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting APOOL by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 249 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3924	100.00	72.09	2394
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-3162-3P	100.00	65.37	363
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593

Functional genomics

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000373173 — one region, missense o/e 1.06.

Literature-anchored findings (GeneRIF, showing 2)

• APOOL is a cardiolipin-binding component of the Mitofilin/MINOS protein complex. (PMID:23704930)
• MIC26 and MIC27 cooperate to regulate cardiolipin levels and the landscape of OXPHOS complexes. (PMID:32788226)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	apool	ENSDARG00000039374
mus_musculus	Apool	ENSMUSG00000025525
rattus_norvegicus	Apool	ENSRNOG00000082020
drosophila_melanogaster	Mic26-27	FBGN0038400
caenorhabditis_elegans		WBGENE00019333

Paralogs (1): APOO (ENSG00000184831)

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Pongo abelii	Q5NVS6	98.7%	Diamond
Bos taurus	Q148H0	86.9%	Diamond
Gallus gallus	Q5ZK55	68.1%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
HDX	protein-coding	139324
SATL1	protein-coding	340562
MIR548I4	ncRNA	100302191
ZNF711	protein-coding	7552
POF1B	protein-coding	79983
MIR1321	ncRNA	100302171

Protein

Protein identifiers

MICOS complex subunit MIC27 — Q6UXV4 (reviewed: Q6UXV4)

Alternative names: Apolipoprotein O-like, Protein FAM121A

All UniProt accessions (1): Q6UXV4

UniProt curated annotations — full annotation on UniProt →

Function. Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Specifically binds to cardiolipin (in vitro) but not to the precursor lipid phosphatidylglycerol. Plays a crucial role in crista junction formation and mitochondrial function,.

Subunit / interactions. Component of the mitochondrial contact site and cristae organizing system (MICOS) complex, composed of at least MICOS10/MIC10, CHCHD3/MIC19, CHCHD6/MIC25, APOOL/MIC27, IMMT/MIC60, APOO/MIC23/MIC26 and MICOS13/MIC13. This complex was also known under the names MINOS or MitOS complex. The MICOS complex associates with mitochondrial outer membrane proteins SAMM50, MTX1 and MTX2 (together described as components of the mitochondrial outer membrane sorting assembly machinery (SAM) complex) and DNAJC11, mitochondrial inner membrane protein TMEM11 and with HSPA9. The MICOS and SAM complexes together with DNAJC11 are part of a large protein complex spanning both membranes termed the mitochondrial intermembrane space bridging (MIB) complex. Interacts with MICOS10/MIC10, IMMT/MIC60 and APOO/MIC23/MIC26.

Subcellular location. Mitochondrion inner membrane. Mitochondrion.

Similarity. Belongs to the apolipoprotein O/MICOS complex subunit Mic27 family.

RefSeq proteins (1): NP_940852* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR019166	MIC26/MIC27	Family
IPR033182	MIC26/MIC27_animal	Family

Pfam: PF09769

UniProt features (11 total): topological domain 3, transmembrane region 2, compositionally biased region 2, transit peptide 1, chain 1, modified residue 1, region of interest 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6UXV4-F1	70.83	0.30

Human Protein Atlas

Protein class: Predicted membrane proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): mitochondria

Antibody reliability (HPA): IH approved · IF enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1)

Type	Positions
Phosphoserine	204

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 7; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

7 pathways:

ID	Pathway	Evidence
R-HSA-114608	Platelet degranulation	curated
R-HSA-8949613	Cristae formation	electronic
R-HSA-109582	Hemostasis	—
R-HSA-1592230	Mitochondrial biogenesis	—
R-HSA-1852241	Organelle biogenesis and maintenance	—
R-HSA-76002	Platelet activation, signaling and aggregation	—
R-HSA-76005	Response to elevated platelet cytosolic Ca2+	—

MSigDB gene sets: 171 (showing top): GOCC_SECRETORY_GRANULE, REACTOME_PLATELET_ACTIVATION_SIGNALING_AND_AGGREGATION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_CRISTAE_FORMATION, GOBP_INNER_MITOCHONDRIAL_MEMBRANE_ORGANIZATION, GOCC_MITOCHONDRIAL_ENVELOPE, BASAKI_YBX1_TARGETS_DN, GOBP_MEMBRANE_ORGANIZATION, GATA1_02, ISRE_01, GATA_Q6, EVI1_04, SENESE_HDAC3_TARGETS_DN, GOCC_PLATELET_ALPHA_GRANULE, GOCC_SECRETORY_VESICLE

GO Biological Process (2): inner mitochondrial membrane organization (GO:0007007), cristae formation (GO:0042407)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (8): SAM complex (GO:0001401), extracellular region (GO:0005576), mitochondrion (GO:0005739), mitochondrial inner membrane (GO:0005743), platelet alpha granule lumen (GO:0031093), mitochondrial crista junction (GO:0044284), MICOS complex (GO:0061617), MIB complex (GO:0140275)

Reactome top-level categories

5 top-level categories:

Category	Pathways
Response to elevated platelet cytosolic Ca2+	1
Mitochondrial biogenesis	1
Organelle biogenesis and maintenance	1
Hemostasis	1
Platelet activation, signaling and aggregation	1

GO top-level categories

14 GO namespaces:

Category	Terms
inner mitochondrial membrane protein complex	2
mitochondrial membrane organization	1
inner mitochondrial membrane organization	1
binding	1
mitochondrial outer membrane translocase complex	1
cellular anatomical structure	1
cytoplasm	1
intracellular membrane-bounded organelle	1
organelle inner membrane	1
mitochondrial membrane	1
platelet alpha granule	1
secretory granule lumen	1
mitochondrial inner membrane	1
organelle membrane contact site	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 4 of 11 annotations. The rest are phylogenetic / computational / electronic (IEA).

4 experimentally-supported GO terms:

GO term	NS	Evidence
MIB complex	CC	high-throughput assay
MICOS complex	CC	direct assay
SAM complex	CC	high-throughput assay
mitochondrion	CC	direct assay

Protein interactions and networks

STRING

showing 15 of 870 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
APOOL	CHCHD6	Q9BRQ6	871
APOOL	CHCHD3	Q9NX63	833
APOOL	MICOS13	Q5XKP0	805
APOOL	MICOS10	Q5TGZ0	794
APOOL	IMMT	Q16891	787
APOOL	SAMM50	Q9Y512	751
APOOL	MTX2	O75431	717
APOOL	DNAJC11	Q9NVH1	713
APOOL	APOO	Q9BUR5	702
APOOL	MTX1	Q13505	580
APOOL	ZNF711	Q9Y462	572
APOOL	SATL1	Q86VE3	547
APOOL	CHCHD5	Q9BSY4	540
APOOL	CYLC1	P35663	527
APOOL	CHCHD10	Q8WYQ3	504

IntAct

Human interaction partners of APOOL in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

4 partners by confidence:

Partner	Interaction type	MIscore	Records
MTX2	association	0.530	3
BNRF1	physical association	0.370	1
ALDH1L1	association	0.350	1
MGST3	association	0.350	1

BioGRID (115 interactions; top human partners by supporting records): AIFM1 (Affinity Capture-MS; 4 records), SFXN1 (Affinity Capture-MS; 3 records), APOO (Affinity Capture-MS; 2 records), C1orf85 (Affinity Capture-MS; 2 records), CHCHD3 (Affinity Capture-MS; 2 records), CHCHD6 (Affinity Capture-MS; 2 records), IMMT (Affinity Capture-MS; 2 records), MTX2 (Affinity Capture-MS; 2 records), SAMM50 (Affinity Capture-MS; 2 records), SLC15A1 (Affinity Capture-MS; 2 records), SLC1A1 (Affinity Capture-MS; 2 records), SLC25A46 (Affinity Capture-Western; 2 records), SLC39A12 (Affinity Capture-MS; 2 records), AFG3L2 (Affinity Capture-MS), AQP3 (Affinity Capture-MS)

Protein complexes (CORUM) (2)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

2 complexes by size:

Complex	Subunits	Members
MIB complex, mitochondrial	12	MTX1, SAMM50, CHCHD3, DNAJC11, MICOS10, MTX2, MTX3, APOO, APOOL, CHCHD6, IMMT, MICOS13
MICOS complex, mitochondrial	7	CHCHD6, IMMT, MICOS10, MICOS13, APOO, APOOL, CHCHD3

Disease & clinical

Genetic variants

Variant evidence for APOOL: 117 ClinVar records (15 pathogenic / likely pathogenic). Per-variant detail is on Sugi Variant.

ClinVar

117 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	14
Likely pathogenic	1
Uncertain significance	37
Likely benign	5
Benign	0

Top pathogenic / likely-pathogenic (15)

Showing all 15 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
57134	GRCh38/hg38 Xq21.1-21.31(chrX:79372269-91308122)x1	Pathogenic	criteria provided, single submitter	1
57928	GRCh38/hg38 Xq21.1-21.2(chrX:80329330-86150446)x1	Pathogenic	criteria provided, single submitter	1
57931	GRCh38/hg38 Xq21.1-21.2(chrX:81762601-86471468)x1	Pathogenic	criteria provided, single submitter	1
57965	GRCh38/hg38 Xq21.1-21.2(chrX:81762602-86457999)x1	Pathogenic	criteria provided, single submitter	1
57967	GRCh38/hg38 Xq21.1-21.2(chrX:81765008-86444979)x0	Pathogenic	criteria provided, single submitter	1
831865	NC_000023.10:g.(?83126460)(86924394_?)del	Pathogenic	criteria provided, single submitter	1
832734	NC_000023.10:g.(?83576897)(86924394_?)del	Pathogenic	criteria provided, single submitter	1
833457	NC_000023.10:g.(?82763333)(86924394_?)del	Pathogenic	criteria provided, single submitter	1
833482	NC_000023.10:g.(?83372068)(86924394_?)del	Pathogenic	criteria provided, single submitter	1
1526822	GRCh37/hg19 Xq21.1-21.2(chrX:78104966-86189374)x1	Pathogenic	criteria provided, single submitter	1
4683020	GRCh37/hg19 Xq21.1-22.3(chrX:77574432-106660031)x1	Pathogenic	criteria provided, single submitter	1
1807759	GRCh37/hg19 Xq21.1-21.2(chrX:84343474-84990478)x0	Likely pathogenic	criteria provided, single submitter	1
146002	GRCh38/hg38 Xq21.1-21.2(chrX:81930916-85965282)x1	Pathogenic	no assertion criteria provided	1
150837	GRCh38/hg38 Xq21.1-21.31(chrX:80722314-92152619)x0	Pathogenic	no assertion criteria provided	1
686630	GRCh37/hg19 Xq13.3-21.31(chrX:74667077-90312981)x1	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore APOOL’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 36 predictions of 908):

Position(s)	Effect	Δscore	Sites
X:85055815	acceptor_gain	1.0000
X:85046444–85046445	acceptor_loss	0.9900	5
X:85051387–85051388	acceptor_loss	0.9900	6
X:85051509–85051510	donor_loss	0.9900	5
X:85055823	acceptor_gain	0.9900
X:85067125–85067126	acceptor_loss	0.9900	6
X:85067219–85067220	donor_loss	0.9900	5
X:85087717	donor_gain	0.9900
X:85003928–85003929	donor_loss	0.9800	5
X:85046436	acceptor_loss	0.9800

AlphaMissense

227 missense substitutions predicted likely pathogenic (of 1,726 scored), across 87 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D260	8	0.790	0.908
D252	8	0.784	0.884
D262	7	0.721	0.774
P154	6	0.770	0.864
G254	6	0.767	0.828
R267	5	0.849	0.914
S265	5	0.844	0.933
F111	5	0.833	0.889
S268	5	0.821	0.919
C152	5	0.780	0.931
Y264	5	0.739	0.848
G125	4	0.773	0.909
F65	4	0.740	0.745
Y44	4	0.662	0.733
Y153	4	0.639	0.750
G148	3	0.913	0.927
G143	3	0.903	0.908
I118	3	0.875	0.903
G122	3	0.873	0.884
G116	3	0.863	0.884

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	2.54e-09
Breast Invasive Carcinoma (TCGA)	unfavorable	6.52e-05

Disease associations

OMIM: gene MIM:300955 | disease phenotypes:

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases methylation, decreases expression	2
aristolochic acid I	decreases expression	1
dicrotophos	decreases expression	1
methylmercuric chloride	decreases expression, increases expression	1
triphenyl phosphate	affects expression	1
glycidyl methacrylate	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
abrine	decreases expression	1
jinfukang	decreases expression	1
Bortezomib	increases expression	1
Temozolomide	increases expression	1
Acetaminophen	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	affects methylation	1
Benzo(a)pyrene	affects methylation, decreases methylation	1
Caffeine	decreases phosphorylation	1
Cisplatin	decreases expression	1
Formaldehyde	decreases expression	1
Rotenone	increases expression	1
Tetrachlorodibenzodioxin	decreases expression	1
Tobacco Smoke Pollution	increases expression	1
Isotretinoin	decreases expression	1
Cyclosporine	decreases expression	1
Aflatoxin B1	decreases methylation	1
Copper Sulfate	increases expression	1
Particulate Matter	decreases expression, increases abundance	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_SD01	HAP1 APOOL (-) 1	Cancer cell line	Male
CVCL_SD02	HAP1 APOOL (-) 2	Cancer cell line	Male
CVCL_SD03	HAP1 APOOL (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.