APPL2

Summary

APPL2 (adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2, HGNC:18242) is a protein-coding gene on chromosome 12q23.3, encoding DCC-interacting protein 13-beta (Q8NEU8). Multifunctional adapter protein that binds to various membrane receptors, nuclear factors and signaling proteins to regulate many processes, such as cell proliferation, immune response, endosomal trafficking and cell metabolism.

The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome.

Source: NCBI Gene 55198 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 113 total
• GTEx eGene: eQTL in 33 tissues, sQTL in 7 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.07 (unconstrained)
• MANE Select transcript: NM_018171
• Notable: 113 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18242
Approved symbol	APPL2
Name	adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2
Location	12q23.3
Locus type	gene with protein product
Status	Approved
Aliases	FLJ10659, DIP13B
Ensembl gene	ENSG00000136044
Ensembl biotype	protein_coding
OMIM	606231
Entrez	55198

Gene structure

Transcript identifiers

Ensembl transcripts: 72 — 46 protein_coding, 19 nonsense_mediated_decay, 5 retained_intron, 2 protein_coding_CDS_not_defined

MANE Select: ENST00000258530

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 3, TSL 2: 5, TSL 3: 3, TSL 4: 3, TSL 5: 2

ENST00000258530, ENST00000539978, ENST00000546731, ENST00000546768, ENST00000547439, ENST00000547790, ENST00000547809, ENST00000548425, ENST00000549056, ENST00000549573, ENST00000549974, ENST00000550648, ENST00000551662, ENST00000552945, ENST00000553097, ENST00000553109, ENST00000862266, ENST00000862267, ENST00000862268, ENST00000862269, ENST00000862270, ENST00000862271, ENST00000862272, ENST00000862273, ENST00000862274, ENST00000862275, ENST00000862276, ENST00000862277, ENST00000862278, ENST00000862279, ENST00000862280, ENST00000862281, ENST00000862282, ENST00000919694, ENST00000967974, ENST00000967975, ENST00000967976, ENST00000967977, ENST00000967978, ENST00000967979, ENST00000967980, ENST00000967981, ENST00000967982, ENST00000967983, ENST00000974139, ENST00000974140, ENST00000974141, ENST00000974142, ENST00001008954, ENST00001008955, ENST00001008956, ENST00001008957, ENST00001008958, ENST00001008959, ENST00001008960, ENST00001008961, ENST00001008962, ENST00001008964, ENST00001008965, ENST00001008967, ENST00001008968, ENST00001008969, ENST00001008970, ENST00001008971, ENST00001076640, ENST00001106310, ENST00001111771, ENST00001111772, ENST00001111773, ENST00001111774, ENST00001124102, ENST00001135191

RefSeq mRNA: 3 — MANE Select: NM_018171 NM_001251904, NM_001251905, NM_018171

CCDS: CCDS58275, CCDS58276, CCDS9101

Canonical transcript exons

ENST00000258530 — 21 exons

Exon	Start	End
ENSE00001350023	105235959	105236174
ENSE00002367052	105173300	105174448
ENSE00003492445	105189991	105190155
ENSE00003493222	105189772	105189824
ENSE00003501040	105229125	105229223
ENSE00003527948	105217069	105217140
ENSE00003550517	105195585	105195627
ENSE00003555445	105207061	105207207
ENSE00003591410	105176035	105176082
ENSE00003605866	105207971	105208029
ENSE00003606430	105197765	105197953
ENSE00003609369	105217666	105217725
ENSE00003614169	105208158	105208199
ENSE00003619723	105195261	105195349
ENSE00003626180	105195445	105195501
ENSE00003631122	105203703	105203785
ENSE00003640144	105177226	105177262
ENSE00003656932	105211230	105211317
ENSE00003658464	105199373	105199531
ENSE00003676940	105188273	105188447
ENSE00003688265	105176876	105177016

Expression profiles

Bgee: expression breadth ubiquitous, 265 present calls, max score 97.43.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 17.8238 / max 310.2371, expressed in 1796 samples.

Highest expression (Bgee): skin of leg, skin of abdomen, rectum, mucosa of transverse colon, ventricular zone.

Genetic regulation across tissues (GTEx eQTL / sQTL)

APPL2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 33 tissues and its splicing (sQTL) in 7 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 40 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Cells Cultured fibroblasts	eqtl	1.3e-54	-0.39	12:105236175:G:GCCCGCCGGCCCTCCTCCCGGCCCT
Whole Blood	eqtl	1.1e-33	+0.20	12:105252011:A:G
Brain Cerebellar Hemisphere	eqtl	1.3e-22	-0.53	12:105222467:C:T
Brain Cerebellum	eqtl	2.4e-18	-0.48	12:105222465:G:A
Artery Aorta	eqtl	1.7e-14	-0.27	12:105331911:G:A
Cells Cultured fibroblasts	sqtl	4.4e-14	+0.42	12:105251624:C:A
Nerve Tibial	eqtl	5.9e-13	-0.21	12:105256297:C:T
Artery Tibial	eqtl	6.1e-13	-0.28	12:105339236:GTTATAT:G
Skin Sun Exposed Lower leg	eqtl	2.2e-10	+0.13	12:105227377:T:C
Muscle Skeletal	sqtl	7.9e-10	+0.40	12:105255722:G:A
Esophagus Muscularis	eqtl	2.2e-09	-0.23	12:105261954:C:T
Skin Sun Exposed Lower leg	sqtl	1.2e-08	-0.51	12:105248715:C:T
Colon Sigmoid	eqtl	2.0e-07	-0.21	12:105260584:G:A
Skin Not Sun Exposed Suprapubic	sqtl	2.7e-07	-0.53	12:105222816:C:T
Muscle Skeletal	eqtl	4.4e-07	-0.17	12:105258975:C:A
Esophagus Mucosa	eqtl	2.0e-06	+0.15	12:105096145:C:T
Adrenal Gland	eqtl	4.8e-06	-0.27	12:105268377:T:C
Pancreas	eqtl	6.9e-06	-0.30	12:105282031:T:C
Brain Anterior cingulate cortex BA24	eqtl	2.3e-05	-0.15	12:105236175:G:GCCCGCCGGCCCTCCTCCCGGCCCT
Brain Substantia nigra	eqtl	2.5e-05	+0.23	12:105056815:C:T

FANTOM5 promoters

5 alternative TSS:

Promoter ID	TPM avg	Samples expressed
133032	13.3142	1748
133033	2.8154	1187
133031	1.1620	731
133034	0.4463	229
133030	0.0859	43

Top tissues by expression

showing 100 of 283 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
skin of leg	UBERON:0001511	97.43	gold quality
skin of abdomen	UBERON:0001416	97.39	gold quality
rectum	UBERON:0001052	97.25	gold quality
mucosa of transverse colon	UBERON:0004991	96.97	gold quality
ventricular zone	UBERON:0003053	96.66	gold quality
calcaneal tendon	UBERON:0003701	96.66	gold quality
stromal cell of endometrium	CL:0002255	96.57	gold quality
small intestine Peyer’s patch	UBERON:0003454	96.30	gold quality
transverse colon	UBERON:0001157	96.12	gold quality
endocervix	UBERON:0000458	96.04	gold quality
ectocervix	UBERON:0012249	95.99	gold quality
bronchial epithelial cell	CL:0002328	95.84	gold quality
ganglionic eminence	UBERON:0004023	95.81	gold quality
adrenal tissue	UBERON:0018303	95.78	gold quality
right ovary	UBERON:0002118	95.67	gold quality
body of uterus	UBERON:0009853	95.67	gold quality
right hemisphere of cerebellum	UBERON:0014890	95.67	gold quality
tibial nerve	UBERON:0001323	95.54	gold quality
right uterine tube	UBERON:0001302	95.43	gold quality
left ovary	UBERON:0002119	95.37	gold quality
cerebellar hemisphere	UBERON:0002245	95.35	gold quality
right testis	UBERON:0004534	95.34	gold quality
gall bladder	UBERON:0002110	95.32	gold quality
mucosa of stomach	UBERON:0001199	95.31	gold quality
body of pancreas	UBERON:0001150	95.27	gold quality
zone of skin	UBERON:0000014	95.25	gold quality
cerebellar cortex	UBERON:0002129	95.19	gold quality
right adrenal gland	UBERON:0001233	95.13	gold quality
right adrenal gland cortex	UBERON:0035827	95.02	gold quality
right lung	UBERON:0002167	94.97	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	94.77	gold quality
body of stomach	UBERON:0001161	94.69	gold quality
left testis	UBERON:0004533	94.69	gold quality
left adrenal gland	UBERON:0001234	94.56	gold quality
small intestine	UBERON:0002108	94.26	gold quality
left adrenal gland cortex	UBERON:0035825	94.23	gold quality
minor salivary gland	UBERON:0001830	94.18	gold quality
left uterine tube	UBERON:0001303	94.03	gold quality
metanephros cortex	UBERON:0010533	93.97	gold quality
omental fat pad	UBERON:0010414	93.76	gold quality
right coronary artery	UBERON:0001625	93.74	gold quality
peritoneum	UBERON:0002358	93.68	gold quality
intestine	UBERON:0000160	93.51	gold quality
sural nerve	UBERON:0015488	93.50	gold quality
subcutaneous adipose tissue	UBERON:0002190	93.29	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	93.29	gold quality
adrenal gland	UBERON:0002369	93.28	gold quality
cerebellum	UBERON:0002037	93.23	gold quality
colon	UBERON:0001155	93.20	gold quality
upper lobe of left lung	UBERON:0008952	93.18	gold quality
large intestine	UBERON:0000059	93.16	gold quality
descending thoracic aorta	UBERON:0002345	93.15	gold quality
right frontal lobe	UBERON:0002810	92.93	gold quality
tibial artery	UBERON:0007610	92.92	gold quality
popliteal artery	UBERON:0002250	92.91	gold quality
adipose tissue of abdominal region	UBERON:0007808	92.89	gold quality
thoracic aorta	UBERON:0001515	92.83	gold quality
left coronary artery	UBERON:0001626	92.83	gold quality
ascending aorta	UBERON:0001496	92.82	gold quality
testis	UBERON:0000473	92.77	gold quality
stomach	UBERON:0000945	92.76	gold quality
aorta	UBERON:0000947	92.71	gold quality
colonic epithelium	UBERON:0000397	92.69	gold quality
islet of Langerhans	UBERON:0000006	92.47	gold quality
jejunal mucosa	UBERON:0000399	92.47	gold quality
epithelium of bronchus	UBERON:0002031	92.46	gold quality
pancreas	UBERON:0001264	92.30	gold quality
vagina	UBERON:0000996	92.12	gold quality
adrenal cortex	UBERON:0001235	92.08	gold quality
esophagus mucosa	UBERON:0002469	92.06	gold quality
muscle layer of sigmoid colon	UBERON:0035805	91.99	gold quality
adenohypophysis	UBERON:0002196	91.95	gold quality
caudate nucleus	UBERON:0001873	91.85	gold quality
upper leg skin	UBERON:0004262	91.81	gold quality
right lobe of thyroid gland	UBERON:0001119	91.76	gold quality
upper lobe of lung	UBERON:0008948	91.70	gold quality
anterior cingulate cortex	UBERON:0009835	91.61	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	91.53	gold quality
esophagus	UBERON:0001043	91.50	gold quality
right atrium auricular region	UBERON:0006631	91.50	gold quality
left lobe of thyroid gland	UBERON:0001120	91.49	gold quality
cingulate cortex	UBERON:0003027	91.46	gold quality
ovary	UBERON:0000992	91.44	gold quality
spleen	UBERON:0002106	91.41	gold quality
bronchus	UBERON:0002185	91.28	gold quality
lower esophagus	UBERON:0013473	91.20	gold quality
lower esophagus muscularis layer	UBERON:0035833	91.19	gold quality
nucleus accumbens	UBERON:0001882	91.10	gold quality
prostate gland	UBERON:0002367	91.10	gold quality
coronary artery	UBERON:0001621	90.97	gold quality
colonic mucosa	UBERON:0000317	90.93	gold quality
amygdala	UBERON:0001876	90.83	gold quality
lower esophagus mucosa	UBERON:0035834	90.83	gold quality
pituitary gland	UBERON:0000007	90.76	gold quality
apex of heart	UBERON:0002098	90.71	gold quality
monocyte	CL:0000576	90.56	gold quality
spinal cord	UBERON:0002240	90.52	gold quality
mononuclear cell	CL:0000842	90.33	gold quality
mouth mucosa	UBERON:0003729	90.10	gold quality
leukocyte	CL:0000738	90.09	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	7.36

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Skin 1	tissue	62.8	not detected
Small intestine	tissue	54.2	high
Nucleus accumbens	tissue	53.2
Rectum	tissue	51.4	high
Colon	tissue	50.7	high
Hippocampus	tissue	50.0	low
Choroid plexus	tissue	49.0
Locus coeruleus	tissue	47.9
Postcentral gyrus	tissue	41.9
Corpus callosum	tissue	37.7
Frontal cortex	tissue	37.0
Spinal cord	tissue	36.7
Duodenum	tissue	36.5	high
Prostate	tissue	36.4	high
Bone marrow	tissue	34.7	low
Periaqueductal gray	tissue	34.6
Testis	tissue	34.2	high
Medulla oblongata	tissue	33.4
Gallbladder	tissue	32.3	high
Thalamus	tissue	32.2
Cerebellum	tissue	32.1	medium
Midbrain	tissue	32.0
Breast	tissue	31.1	medium
Retina	tissue	31.0
Substantia nigra	tissue	30.8
Hypothalamus	tissue	30.7
Stomach 1	tissue	29.9	high
Amygdala	tissue	29.3
Hippocampal formation	tissue	29.3
Superior colliculi	tissue	29.2
Pons	tissue	28.3
Septum	tissue	28.3
Ventral forebrain	tissue	27.5
Putamen	tissue	27.4
Vagina	tissue	27.1	low
Olfactory bulb	tissue	27.1
Caudate putamen	tissue	26.7
Cervix	tissue	26.3	medium
Ovary	tissue	26.3	medium
Cerebral cortex	tissue	25.9	medium
Retrosplenial cortex	tissue	25.9
Insular cortex	tissue	25.7
Seminal vesicle	tissue	25.3	high
Entorhinal cortex	tissue	25.3
Motor cortex	tissue	24.9
Basal ganglia	tissue	24.6	low
Temporal cortex	tissue	24.5
Prefrontal cortex	tissue	24.2
Retrosplenial and cingulate cortex	tissue	23.9
Endometrium 1	tissue	23.7	medium
Occipital cortex	tissue	23.7
Somatosensory cortex	tissue	23.0
Adipose tissue	tissue	22.9	not detected
Pancreas	tissue	22.0	medium
Parathyroid gland	tissue	21.8	medium
Placenta	tissue	21.7	medium
Lymph node	tissue	21.2	low
Smooth muscle	tissue	20.6	not detected
Adrenal gland	tissue	19.5	medium
Fallopian tube	tissue	19.5	high

Brain sub-regions (HPA Brain Atlas): detected in 292; highest nTPM — Blood vessel (376.4), Cerebellar cortex (273.6), Lateral hypothalamic area (255.4), Lateral funiculus (white matter) (252.6), Flocculonodular lobe (252.2).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting APPL2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 73 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4776-3P	100.00	68.73	1340
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-8087	99.90	69.55	1351
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-345-3P	99.89	70.23	1421
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-4779	99.86	66.50	1583
HSA-MIR-1321	99.84	65.30	1811
HSA-MIR-4739	99.84	65.25	1832
HSA-MIR-4756-5P	99.84	64.98	1809
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-26A-5P	99.78	73.52	2303
HSA-MIR-26B-5P	99.78	73.51	2305
HSA-MIR-6745	99.74	65.33	1321
HSA-MIR-556-3P	99.74	68.75	1203
HSA-MIR-4255	99.72	67.70	1541
HSA-MIR-4465	99.71	72.56	2096
HSA-MIR-670-5P	99.67	69.94	1565
HSA-MIR-6715B-5P	99.64	69.63	1420
HSA-MIR-875-3P	99.63	69.47	2548
HSA-MIR-24-3P	99.59	69.97	1934

Functional genomics

gnomAD constraint: pLI 1.36e-23, LOEUF 1.07, missense Z 1.44 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000258530 — one region, missense o/e 0.89.

Literature-anchored findings (GeneRIF, showing 16)

• identification of a pathway directly linking the small GTPase Rab5, a key regulator of endocytosis, to signal transduction and mitogenesis via APPL1 and APPL2, two Rab5 effectors (PMID:15016378)
• The findings suggest a role for APPL1 and APPL2 protein as dynamic scaffolds that modulate RAB5-associated signaling endosomal membranes by their ability to undergo domain-mediated oligomerization, membrane targeting and phosphoinositide binding. (PMID:18034774)
• APPL proteins exert their stimulatory effects on beta-catenin/TCF-dependent transcription by decreasing the activity of a Reptin-containing repressive complex (PMID:19433865)
• significant fluorescence resonance energy transfer between APPL minimal BAR domain FRET pairs (PMID:20814572)
• Data suggest that although annexin A2 is not an exclusive marker of APPL1/2 endosomes, it has an important function in membrane recruitment of APPL proteins, acting in parallel to Rab5. (PMID:21645192)
• Genetic variation(s) in APPL1/2 may be associated with CAD risk in T2DM in Chinese population. (PMID:22340213)
• found significant evidence of association with overweight/obesity for rs2272495 and rs1107756. rs2272495 C allele and rs1107756 T allele both conferred a higher risk of being overweight and obese. (PMID:22462604)
• Data indicate that a high level of APPL2 protein might enhance glioblastoma growth by maintaining low expression level of genes responsible for cell death induction. (PMID:22989406)
• analysis of APPL1 and APPL2 proteins and their interaction with Rab (PMID:23055524)
• It concludes that APPL2(PH) binding to BAR domain and Reptin is mutually exclusive which regulates the nucleocytoplasmic shuttling of Reptin. (PMID:23891720)
• C-APPL1/A-APPL2 allele combination is associated with non-alcoholic fatty liver disease occurrence, with a more severe hepatic steatosis grade and with a reduced adiponectin cytoprotective effect on liver. (PMID:23977033)
• ATM is the central modulator of APPL-mediated effects on radiosensitivity and DNA repair. (PMID:24763056)
• Data show that signal transducing adaptor proteins APPL1 and APPL2 are required for TGFbeta-induced nuclear translocation of TGFbeta type I receptor (TbetaRI)-ICD and for cancer cell invasiveness of prostate and breast cancer cell lines. (PMID:26583432)
• Results show the suppressive effect of OCC-1 RNA on transcription level of the APPL2 gene provides a putative colorectal neoplasm progression index. (PMID:27986894)
• A negative correlation of expression is evident between APPL2 and OCC-1 genes in breast cancer specimen. Unlike OCC-1A/B which encodes a small protein, OCC-1D noncoding RNA overexpression lead to APPL2 downregulation in MCF7 cells. (PMID:30218350)
• The adaptor protein APPL2 controls glucose-stimulated insulin secretion via F-actin remodeling in pancreatic beta-cells. (PMID:33122440)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio		ENSDARG00000078139
mus_musculus	Appl2	ENSMUSG00000020263
rattus_norvegicus	Appl2	ENSRNOG00000008174

Paralogs (28): ARAP2 (ENSG00000047365), ACAP1 (ENSG00000072818), SMAP2 (ENSG00000084070), ASAP3 (ENSG00000088280), ARFGAP1 (ENSG00000101199), ADAP1 (ENSG00000105963), AGFG2 (ENSG00000106351), GIT1 (ENSG00000108262), SMAP1 (ENSG00000112305), ACAP2 (ENSG00000114331), ARAP3 (ENSG00000120318), ACAP3 (ENSG00000131584), AGAP3 (ENSG00000133612), AGAP2 (ENSG00000135439), GIT2 (ENSG00000139436), ARFGAP2 (ENSG00000149182), ASAP2 (ENSG00000151693), ASAP1 (ENSG00000153317), APPL1 (ENSG00000157500), AGAP1 (ENSG00000157985), AGAP5 (ENSG00000172650), AGFG1 (ENSG00000173744), ADAP2 (ENSG00000184060), ARAP1 (ENSG00000186635), AGAP4 (ENSG00000188234), AGAP6 (ENSG00000204149), AGAP9 (ENSG00000204172), ARFGAP3 (ENSG00000242247)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:2384914) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 9 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased mean corpuscular volume	1
increased hematocrit	1
increased insulin sensitivity	1
improved glucose tolerance	1
abnormal cell physiology	1
decreased mean corpuscular hemoglobin concentration	1
embryonic lethality, complete penetrance	1
decreased fibroblast cell migration	1
increased skeletal muscle cell glucose uptake	1

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
WASHC4	protein-coding	23325
C12orf75	protein-coding	387882
C12orf75-AS1	ncRNA	105369954
NOPCHAP1	protein-coding	121053
ALDH1L2	protein-coding	160428

Protein

Protein identifiers

DCC-interacting protein 13-beta — Q8NEU8 (reviewed: Q8NEU8)

Alternative names: Adapter protein containing PH domain, PTB domain and leucine zipper motif 2

All UniProt accessions (7): Q8NEU8, F8VR68, F8VS86, F8VWV2, F8VXB0, F8W124, H0YH86

UniProt curated annotations — full annotation on UniProt →

Function. Multifunctional adapter protein that binds to various membrane receptors, nuclear factors and signaling proteins to regulate many processes, such as cell proliferation, immune response, endosomal trafficking and cell metabolism. Regulates signaling pathway leading to cell proliferation through interaction with RAB5A and subunits of the NuRD/MeCP1 complex. Plays a role in immune response by modulating phagocytosis, inflammatory and innate immune responses. In macrophages, enhances Fc-gamma receptor-mediated phagocytosis through interaction with RAB31 leading to activation of PI3K/Akt signaling. In response to LPS, modulates inflammatory responses by playing a key role on the regulation of TLR4 signaling and in the nuclear translocation of RELA/NF-kappa-B p65 and the secretion of pro- and anti-inflammatory cytokines. Also functions as a negative regulator of innate immune response via inhibition of AKT1 signaling pathway by forming a complex with APPL1 and PIK3R1. Plays a role in endosomal trafficking of TGFBR1 from the endosomes to the nucleus. Plays a role in cell metabolism by regulating adiponecting and insulin signaling pathways and adaptative thermogenesis. In muscle, negatively regulates adiponectin-simulated glucose uptake and fatty acid oxidation by inhibiting adiponectin signaling pathway through APPL1 sequestration thereby antagonizing APPL1 action. In muscles, negatively regulates insulin-induced plasma membrane recruitment of GLUT4 and glucose uptake through interaction with TBC1D1. Plays a role in cold and diet-induced adaptive thermogenesis by activating ventromedial hypothalamus (VMH) neurons throught AMPK inhibition which enhances sympathetic outflow to subcutaneous white adipose tissue (sWAT), sWAT beiging and cold tolerance. Also plays a role in other signaling pathways namely Wnt/beta-catenin, HGF and glucocorticoid receptor signaling. Positive regulator of beta-catenin/TCF-dependent transcription through direct interaction with RUVBL2/reptin resulting in the relief of RUVBL2-mediated repression of beta-catenin/TCF target genes by modulating the interactions within the beta-catenin-reptin-HDAC complex. May affect adult neurogenesis in hippocampus and olfactory system via regulating the sensitivity of glucocorticoid receptor. Required for fibroblast migration through HGF cell signaling.

Subunit / interactions. Homodimer. Homotetramer. Binds RAB5A/Rab5 through an N-terminal domain. This interaction is essential for its recruitment to endosomal membranes as well as its role in cell proliferation. Binds subunits of the NuRD/MeCP1 complex. Interacts with FSHR; interaction is independent of follicle stimulating hormone stimulation. Interacts with APPL1; the interaction is decreased by adiponectin in a time-dependent manner. Forms a complex comprising APPL1, RUVBL2, CTNNB1, HDAC1 and HDAC2; interaction reduces interaction between CTNNB1, HDAC1, HDAC2 and RUVBL2 leading to the decrease of deacetylase activity of this complex; affects the recruitment of repressive complexes to the Wnt target genes. Interacts (via BAR domain) with TBC1D1; interaction is dependent of TBC1D1 phosphorylation at ‘Ser-235’; interaction diminishes the phosphorylation of TBC1D1 at ‘Thr-596’, resulting in inhibition of SLC2A4 translocation and glucose uptake. Interacts with ANXA2; targets APPL2 to endosomes and acting in parallel to RAB5A. Interacts with RAB31 (in GTP-bound form); interaction contributes to or enhances recruitment of APPL2 to the phagosomes; interaction enhances Fc-gamma receptor-mediated phagocytosis through PI3K/Akt signaling in macrophages. Interacts with PIK3R1; forms a complex with PIK3R1 and APPL1. Interacts (via BAR domain) with ADIPOR1; hinders the accessibility of APPL1 to ADIPOR1; negatively regulates adiponectin signaling; ADIPOQ dissociates this interaction and facilitates the recruitment of APPL1 to ADIPOR1. Interacts (via BAR domain) with ADIPOR2; ADIPOQ dissociates this interaction.

Subcellular location. Early endosome membrane. Nucleus. Cell membrane. Endosome membrane. Cytoplasm. Cytoplasmic vesicle. Phagosome. Cell projection. Ruffle. Ruffle membrane. Phagosome membrane.

Tissue specificity. High levels in brain, heart, kidney and skeletal muscle.

Disease relevance. A chromosomal aberration involving APPL2/DIP13B is found in patients with chromosome 22q13.3 deletion syndrome. Translocation t(12;22)(q24.1;q13.3) with SHANK3/PSAP2.

Domain organisation. The BAR domain is necessary and sufficient for mediating homotypic and heterotypic interactions; associates with cytoplasmic membrane structures; mediates interaction with TBC1D1 and ADIPOR1. The PH and PID domains mediate phosphoinositide binding. The PID domain mediates phosphatidylserine binding and allows localization to cytosolic membrane structures and nucleus. The PH domain allows localization to the plasma membrane, cytosolic vesicles and distinct nuclear and perinuclear structures and is sufficient for RUVBL2 interaction.

Isoforms (3)

UniProt ID	Names	Canonical?
Q8NEU8-1	1	yes
Q8NEU8-2	2
Q8NEU8-3	3

RefSeq proteins (3): NP_001238833, NP_001238834, NP_060641* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001849	PH_domain	Domain
IPR004148	BAR_dom	Domain
IPR006020	PTB/PI_dom	Domain
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR027267	AH/BAR_dom_sf	Homologous_superfamily
IPR047181	DP13A/B	Family
IPR047236	PH_DP13A/B	Domain
IPR047237	PTB_APPL	Domain
IPR047239	BAR_APPL2	Domain

Pfam: PF00169, PF00640, PF16746

UniProt features (37 total): helix 12, strand 9, sequence conflict 4, domain 3, region of interest 2, splice variant 2, chain 1, sequence variant 1, turn 1, compositionally biased region 1, site 1

Structure

Experimental structures (PDB)

2 structures by resolution:

PDB	Title	Method	Resolution (Å)
5C5B	Crystal Structure of Human APPL BAR-PH Heterodimer	X-RAY DIFFRACTION	2.9
4H8S	Crystal structure of human APPL2BARPH domain	X-RAY DIFFRACTION	3.5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NEU8-F1	82.09	0.61

Human Protein Atlas

Protein class: Predicted intracellular proteins, Disease related genes

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): vesicles; cytosol

Antibody reliability (HPA): IH approved · IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
234–235	breakpoint for chromosomal translocation

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 450 (showing top): GSE45365_NK_CELL_VS_CD8_TCELL_UP, GGGACCA_MIR133A_MIR133B, GOBP_LIPID_MODIFICATION, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_NEGATIVE_REGULATION_OF_TRANSMEMBRANE_TRANSPORT, GOBP_CARBOHYDRATE_TRANSPORT, GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, GOBP_PINOCYTOSIS, GOBP_POSITIVE_REGULATION_OF_ENDOCYTOSIS, GOBP_RESPONSE_TO_COLD, LU_IL4_SIGNALING, GOBP_PROTEIN_HOMOTETRAMERIZATION, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, GOBP_INFLAMMATORY_RESPONSE, GOBP_RESPONSE_TO_PEPTIDE

GO Biological Process (25): diet induced thermogenesis (GO:0002024), protein import into nucleus (GO:0006606), signal transduction (GO:0007165), transforming growth factor beta receptor signaling pathway (GO:0007179), cold acclimation (GO:0009631), regulation of fibroblast migration (GO:0010762), signaling (GO:0023052), adiponectin-activated signaling pathway (GO:0033211), regulation of toll-like receptor 4 signaling pathway (GO:0034143), cellular response to hepatocyte growth factor stimulus (GO:0035729), glucose homeostasis (GO:0042593), regulation of innate immune response (GO:0045088), negative regulation of fatty acid oxidation (GO:0046322), negative regulation of D-glucose import across plasma membrane (GO:0046325), negative regulation of neurogenesis (GO:0050768), protein homotetramerization (GO:0051289), positive regulation of phagocytosis, engulfment (GO:0060100), positive regulation of cold-induced thermogenesis (GO:0120162), negative regulation of cytokine production involved in inflammatory response (GO:1900016), negative regulation of cellular response to insulin stimulus (GO:1900077), positive regulation of macropinocytosis (GO:1905303), positive regulation of Fc-gamma receptor signaling pathway involved in phagocytosis (GO:1905451), regulation of G1/S transition of mitotic cell cycle (GO:2000045), negative regulation of neural precursor cell proliferation (GO:2000178), homeostatic process (GO:0042592)

GO Molecular Function (6): phosphatidylserine binding (GO:0001786), phosphatidylinositol binding (GO:0035091), identical protein binding (GO:0042802), protein homodimerization activity (GO:0042803), protein-containing complex binding (GO:0044877), protein binding (GO:0005515)

GO Cellular Component (19): ruffle (GO:0001726), nucleus (GO:0005634), endosome (GO:0005768), plasma membrane (GO:0005886), endosome membrane (GO:0010008), membrane (GO:0016020), cytoplasmic vesicle (GO:0031410), early endosome membrane (GO:0031901), vesicle (GO:0031982), early phagosome (GO:0032009), ruffle membrane (GO:0032587), early phagosome membrane (GO:0036186), macropinosome (GO:0044354), extracellular exosome (GO:0070062), cytoplasm (GO:0005737), cytoplasmic vesicle membrane (GO:0030659), phagocytic vesicle membrane (GO:0030670), phagocytic vesicle (GO:0045335), bounding membrane of organelle (GO:0098588)

GO top-level categories

showing 60 of 91 GO namespaces:

Category	Terms
anion binding	2
binding	2
cytoplasmic vesicle	2
cellular anatomical structure	2
phagocytic vesicle	2
response to dietary excess	1
adaptive thermogenesis	1
intracellular protein transport	1
protein localization to nucleus	1
import into nucleus	1
establishment of protein localization to organelle	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
cellular response to transforming growth factor beta stimulus	1
transforming growth factor beta receptor superfamily signaling pathway	1
response to cold	1
fibroblast migration	1
regulation of cell migration	1
regulation of biological process	1
hormone-mediated signaling pathway	1
cytokine-mediated signaling pathway	1
toll-like receptor 4 signaling pathway	1
regulation of pattern recognition receptor signaling pathway	1
response to hepatocyte growth factor	1
cellular response to growth factor stimulus	1
carbohydrate homeostasis	1
regulation of response to biotic stimulus	1
regulation of defense response	1
regulation of response to external stimulus	1
innate immune response	1
regulation of immune response	1
fatty acid oxidation	1
negative regulation of fatty acid metabolic process	1
regulation of fatty acid oxidation	1
negative regulation of D-glucose transmembrane transport	1
regulation of D-glucose import across plasma membrane	1
D-glucose import across plasma membrane	1
negative regulation of cell development	1
neurogenesis	1
regulation of neurogenesis	1
negative regulation of nervous system development	1
protein homooligomerization	1
protein tetramerization	1
phagocytosis, engulfment	1
positive regulation of phagocytosis	1
regulation of phagocytosis, engulfment	1
positive regulation of membrane invagination	1
positive regulation of multicellular organismal process	1
cold-induced thermogenesis	1
regulation of cold-induced thermogenesis	1
negative regulation of cytokine production	1
cytokine production involved in inflammatory response	1
regulation of cytokine production involved in inflammatory response	1
cellular response to insulin stimulus	1
negative regulation of cellular process	1
negative regulation of response to stimulus	1
regulation of cellular response to insulin stimulus	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 19 of 50 annotations. The rest are phylogenetic / computational / electronic (IEA).

19 experimentally-supported GO terms:

GO term	NS	Evidence
glucose homeostasis	BP	mutant phenotype
negative regulation of D-glucose import across plasma membrane	BP	mutant phenotype
protein homotetramerization	BP	direct assay
protein import into nucleus	BP	direct assay
regulation of G1/S transition of mitotic cell cycle	BP	direct assay
transforming growth factor beta receptor signaling pathway	BP	mutant phenotype
cytoplasmic vesicle	CC	direct assay
endosome	CC	direct assay
endosome membrane	CC	direct assay
extracellular exosome	CC	high-throughput assay
membrane	CC	direct assay
nucleus	CC	direct assay
plasma membrane	CC	direct assay
vesicle	CC	direct assay
identical protein binding	MF	physical interaction
phosphatidylinositol binding	MF	direct assay
phosphatidylserine binding	MF	direct assay
protein homodimerization activity	MF	direct assay
protein-containing complex binding	MF	physical interaction

Protein interactions and networks

STRING

showing 15 of 748 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
APPL2	RABL2B	Q9UNT1	892
APPL2	RABL2A	Q9UBK7	890
APPL2	SHANK3	Q9BYB0	859
APPL2	ALG12	Q9BV10	601
APPL2	C2orf42	Q9NWW7	483
APPL2	SMAP2	Q8WU79	473
APPL2	RAB5A	P20339	463
APPL2	PGM2L1	Q6PCE3	458
APPL2	SLC25A42	Q86VD7	452
APPL2	PIM3	Q86V86	429
APPL2	SHANK2	Q9UPX8	421
APPL2	ZNHIT1	O43257	362
APPL2	GRIP2	Q9C0E4	362
APPL2	ANKFY1	Q9P2R3	360
APPL2	MRPS18B	Q9Y676	357

IntAct

Human interaction partners of APPL2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 37 partners by confidence:

Partner	Interaction type	MIscore	Records
APPL1	physical association	0.960	21
RAB22A	physical association	0.830	8
RAB5C	physical association	0.780	9
SUV39H2	physical association	0.740	9
CRADD	physical association	0.670	4
TBC1D1	physical association	0.580	3
MAPRE3	physical association	0.570	3
EPM2AIP1	physical association	0.560	3
KIFC3	physical association	0.560	3
PRE6	physical association	0.560	3
PRR35	physical association	0.560	3
YPT52	physical association	0.560	3
YPT53	physical association	0.560	3
RAB5A	direct interaction	0.520	2
KMT2C	physical association	0.490	2
LGALS9B	physical association	0.490	2
LIX1	physical association	0.490	2
MLST8	physical association	0.490	2
GIPC1	association	0.480	2
YWHAE	physical association	0.400	1
ATF3	physical association	0.370	1
CNMD	physical association	0.370	1
CRBN	physical association	0.370	1
CRLF3	physical association	0.370	1
DOK3	physical association	0.370	1
LDHAL6B	physical association	0.370	1
LINC02875	physical association	0.370	1
PINK1	physical association	0.370	1
POT1	physical association	0.370	1
RAI2	physical association	0.370	1

BioGRID (108 interactions; top human partners by supporting records): APPL1 (Two-hybrid; 11 records), RAB22A (Two-hybrid; 3 records), RAB5A (Proximity Label-MS; 3 records), RAB5C (Two-hybrid; 3 records), RUVBL2 (Affinity Capture-Western; 3 records), SUV39H2 (Two-hybrid; 3 records), GIPC1 (Proximity Label-MS; 2 records), MAPRE3 (Two-hybrid; 2 records), MYO6 (Proximity Label-MS; 2 records), RAB11A (Proximity Label-MS; 2 records), ABI2 (Co-fractionation), ACE2 (Proximity Label-MS), ACOT9 (Co-fractionation), ANKFY1 (Proximity Label-MS), ATF3 (Two-hybrid)

Disease & clinical

Genetic variants

Variant evidence for APPL2: 113 ClinVar records (0 pathogenic / likely pathogenic); 1 GWAS association.

ClinVar

113 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	90
Likely benign	4
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 34 predictions of 1,837):

Position(s)	Effect	Δscore	Sites
12:105176917	donor_gain	1.0000
12:105199375	donor_gain	1.0000
12:105207059–105207060	donor_loss	1.0000	5
12:105207208–105207209	acceptor_loss	1.0000	5
12:105207212	acceptor_gain	1.0000
12:105211228–105211229	donor_loss	1.0000	4
12:105211318–105211319	acceptor_loss	1.0000	6
12:105217067–105217068	donor_loss	1.0000	5
12:105217149	acceptor_gain	1.0000
12:105217664–105217665	donor_loss	1.0000	5

AlphaMissense

1,555 missense substitutions predicted likely pathogenic (of 4,404 scored), across 433 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
F452	8	0.986	0.999
F342	8	0.980	0.999
F530	8	0.977	0.997
H527	8	0.970	0.997
D337	8	0.967	0.998
N572	8	0.964	0.995
D15	8	0.955	0.988
D453	8	0.938	0.986
F474	8	0.938	0.993
F118	8	0.927	0.993
F26	8	0.923	0.994
F73	8	0.923	0.991
D324	8	0.922	0.979
F498	8	0.921	0.995
D29	8	0.908	0.965
D326	8	0.896	0.973
F596	8	0.876	0.993
D548	8	0.871	0.988
H569	8	0.865	0.974
M517	8	0.864	0.972

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

8 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	9.06e-06
Kidney Chromophobe (TCGA)	unfavorable	7.39e-05
Lung Squamous Cell Carcinoma (validation)	favorable	0.000228
Glioblastoma Multiforme (validation)	unfavorable	0.000338
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	0.000351
Liver Hepatocellular Carcinoma (TCGA)	unfavorable	0.000366
Rectum Adenocarcinoma (TCGA)	favorable	0.000567
Kidney Renal Papillary Cell Carcinoma (TCGA)	favorable	0.000817

Disease associations

OMIM: gene MIM:606231 | disease phenotypes:

GWAS associations

1 associations:

Study	Trait	p-value
GCST004863_85	Mosquito bite size	7e-6

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0008378	mosquito bite reaction size measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

43 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
trichostatin A	affects cotreatment, decreases expression	3
sodium arsenite	decreases expression, increases expression	3
Arsenic	decreases methylation, increases abundance, decreases expression	2
Benzo(a)pyrene	decreases expression, increases methylation	2
aristolochic acid I	decreases expression	1
GSK-J4	increases expression	1
geldanamycin	increases expression	1
triphenyl phosphate	affects expression	1
sodium arsenate	decreases expression, increases abundance	1
cobaltous chloride	decreases expression	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
perfluoro-n-nonanoic acid	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
bisphenol B	increases expression	1
abrine	decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
7-(benzylamino)-1,3,4,8-tetrahydropyrrolo(4,3,2-de)quinolin-8(1H)-one	decreases expression	1
Temozolomide	decreases expression	1
Vorinostat	decreases expression	1
Air Pollutants, Occupational	affects expression	1
Cadmium	increases abundance, increases expression	1
Cisplatin	increases expression	1
Dimethyl Sulfoxide	increases expression	1
Doxorubicin	decreases expression	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.