AR

Summary

AR (androgen receptor, HGNC:644) is a protein-coding gene on chromosome Xq12, encoding Androgen receptor (P10275). Steroid hormone receptors are ligand-activated transcription factors that regulate eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues.

The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy’s disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms.

Source: NCBI Gene 367 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Kennedy disease (Definitive, ClinGen) — +3 more curated relationships
• Clinical variants (ClinVar): 1,138 total — 257 pathogenic, 123 likely-pathogenic (top 2% of genes corpus-wide)
• GTEx eGene: eQTL in 22 tissues, sQTL in 1 (q < 0.05)
• Drug target: yes — 42 curated mechanism-of-action drugs; 116 molecules with ChEMBL bioactivity (top 1% of genes corpus-wide)
• Approved drugs (ChEMBL mechanism of action): 24 — Abiraterone, Apalutamide, Bicalutamide, +21 more
• MANE Select transcript: NM_000044
• Interaction hub: 4,608 STRING partners (top 1% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:644
Approved symbol	AR
Name	androgen receptor
Location	Xq12
Locus type	gene with protein product
Status	Approved
Aliases	AIS, NR3C4, SMAX1, HUMARA
Ensembl gene	ENSG00000169083
Ensembl biotype	protein_coding
OMIM	313700
Entrez	367

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 5 protein_coding, 4 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000374690

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 7, TSL 5: 1

ENST00000374690, ENST00000396043, ENST00000396044, ENST00000504326, ENST00000513847, ENST00000514029, ENST00000612452, ENST00000613054, ENST00000853518, ENST00000853519

RefSeq mRNA: 5 — MANE Select: NM_000044 NM_000044, NM_001011645, NM_001348061, NM_001348063, NM_001348064

CCDS: CCDS14387, CCDS87754, CCDS87755

Canonical transcript exons

ENST00000374690 — 8 exons

Exon	Start	End
ENSE00001165458	67721833	67721963
ENSE00001165476	67711402	67711689
ENSE00001282597	67717478	67717622
ENSE00001316881	67722827	67722984
ENSE00001930911	67723686	67730619
ENSE00003606052	67643256	67643407
ENSE00003625235	67686010	67686126
ENSE00003901971	67544021	67546762

Expression profiles

Bgee: expression breadth ubiquitous, 250 present calls, max score 97.53.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 4.1307 / max 221.0612, expressed in 1026 samples.

Highest expression (Bgee): seminal vesicle, urethra, nipple, mammalian vulva, corpus epididymis.

Genetic regulation across tissues (GTEx eQTL / sQTL)

AR is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 22 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 23 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Thyroid	eqtl	2.9e-38	+0.28	X:68066129:T:C
Brain Nucleus accumbens basal ganglia	eqtl	2.5e-15	-0.49	X:67545785:G:A
Brain Frontal Cortex BA9	eqtl	2.6e-10	+0.54	X:67638479:G:A
Cells Cultured fibroblasts	eqtl	1.9e-08	-0.15	X:67349797:A:AAAATGGGAGAAGTAACTAATTCTCTC
Brain Cortex	eqtl	1.2e-06	-0.38	X:67824581:G:A
Colon Transverse	eqtl	9.9e-06	+0.44	X:67062284:T:C
Brain Caudate basal ganglia	eqtl	1.9e-05	-0.36	X:67545785:G:A
Pancreas	eqtl	4.4e-05	+0.20	X:68060539:C:T
Brain Putamen basal ganglia	eqtl	1.5e-04	-0.42	X:67545785:G:A
Kidney Cortex	eqtl	2.0e-03	+2.04	X:67026314:G:T
Esophagus Mucosa	eqtl	2.2e-03	+0.34	X:68092347:T:A
Heart Atrial Appendage	eqtl	6.3e-03	+0.19	X:68123869:G:A
Uterus	eqtl	8.5e-03	-1.12	X:66899540:T:C
Brain Cerebellar Hemisphere	eqtl	9.6e-03	-1.22	X:66566812:G:A
Adrenal Gland	eqtl	1.5e-02	+0.27	X:66887601:A:T
Brain Hypothalamus	eqtl	1.7e-02	+0.75	X:66855701:T:C
Nerve Tibial	eqtl	1.8e-02	+0.10	X:68180383:G:A
Esophagus Muscularis	eqtl	1.8e-02	+0.13	X:67585127:A:G
Vagina	eqtl	2.7e-02	-1.67	X:67081129:A:T
Artery Tibial	eqtl	3.6e-02	-0.08	X:68041587:G:T

FANTOM5 promoters

5 alternative TSS:

Promoter ID	TPM avg	Samples expressed
196580	2.0469	746
196579	1.2313	636
196581	0.5429	245
196585	0.2294	101
196582	0.0801	28

Top tissues by expression

showing 100 of 291 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
seminal vesicle	UBERON:0000998	97.53	gold quality
urethra	UBERON:0000057	96.69	gold quality
nipple	UBERON:0002030	96.13	gold quality
mammalian vulva	UBERON:0000997	94.97	gold quality
corpus epididymis	UBERON:0004359	94.70	gold quality
penis	UBERON:0000989	93.15	gold quality
caput epididymis	UBERON:0004358	92.58	gold quality
cauda epididymis	UBERON:0004360	90.91	gold quality
mammary duct	UBERON:0001765	90.78	gold quality
liver	UBERON:0002107	89.24	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	89.22	gold quality
buccal mucosa cell	CL:0002336	89.09	gold quality
saphenous vein	UBERON:0007318	88.92	gold quality
right lobe of liver	UBERON:0001114	87.87	gold quality
skin of hip	UBERON:0001554	87.47	gold quality
synovial joint	UBERON:0002217	87.40	gold quality
epithelium of mammary gland	UBERON:0003244	86.96	gold quality
mammary gland	UBERON:0001911	86.73	gold quality
calcaneal tendon	UBERON:0003701	86.66	gold quality
thoracic mammary gland	UBERON:0005200	86.65	gold quality
left ventricle myocardium	UBERON:0006566	85.78	gold quality
endocervix	UBERON:0000458	85.48	gold quality
heart right ventricle	UBERON:0002080	85.47	gold quality
prostate gland	UBERON:0002367	85.46	gold quality
tendon	UBERON:0000043	84.65	gold quality
fallopian tube	UBERON:0003889	84.36	gold quality
endometrium epithelium	UBERON:0004811	83.90	silver quality
ectocervix	UBERON:0012249	83.88	gold quality
vagina	UBERON:0000996	83.84	gold quality
vena cava	UBERON:0004087	83.75	gold quality
biceps brachii	UBERON:0001507	83.67	gold quality
upper leg skin	UBERON:0004262	83.48	gold quality
body of uterus	UBERON:0009853	82.90	gold quality
right uterine tube	UBERON:0001302	82.81	gold quality
myometrium	UBERON:0001296	82.79	gold quality
endometrium	UBERON:0001295	82.68	gold quality
uterus	UBERON:0000995	82.66	gold quality
myocardium	UBERON:0002349	82.57	gold quality
uterine cervix	UBERON:0000002	82.20	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	81.98	gold quality
parietal pleura	UBERON:0002400	81.96	gold quality
oviduct epithelium	UBERON:0004804	81.88	gold quality
deltoid	UBERON:0001476	81.85	gold quality
sperm	CL:0000019	81.46	gold quality
vastus lateralis	UBERON:0001379	81.01	gold quality
quadriceps femoris	UBERON:0001377	80.68	gold quality
left uterine tube	UBERON:0001303	80.61	gold quality
stromal cell of endometrium	CL:0002255	80.38	gold quality
skeletal muscle tissue	UBERON:0001134	80.36	gold quality
germinal epithelium of ovary	UBERON:0001304	80.29	gold quality
descending thoracic aorta	UBERON:0002345	80.14	gold quality
muscle tissue	UBERON:0002385	80.12	gold quality
female reproductive system	UBERON:0000474	80.06	gold quality
cardiac muscle of right atrium	UBERON:0003379	80.05	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	79.91	gold quality
adipose tissue	UBERON:0001013	79.81	gold quality
adult organism	UBERON:0007023	79.63	gold quality
connective tissue	UBERON:0002384	79.49	gold quality
tibia	UBERON:0000979	79.40	gold quality
male germ cell	CL:0000015	79.39	gold quality
muscle organ	UBERON:0001630	79.31	gold quality
subcutaneous adipose tissue	UBERON:0002190	79.17	gold quality
hindlimb stylopod muscle	UBERON:0004252	79.15	gold quality
right ovary	UBERON:0002118	78.97	gold quality
upper arm skin	UBERON:0004263	78.77	gold quality
dorsal root ganglion	UBERON:0000044	78.75	gold quality
trachea	UBERON:0003126	78.70	gold quality
tibialis anterior	UBERON:0001385	78.66	silver quality
muscle of leg	UBERON:0001383	78.64	gold quality
body of tongue	UBERON:0011876	78.60	gold quality
left ovary	UBERON:0002119	78.59	gold quality
pericardium	UBERON:0002407	78.44	gold quality
pleura	UBERON:0000977	78.41	gold quality
ovary	UBERON:0000992	78.40	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.01	gold quality
thoracic aorta	UBERON:0001515	77.92	gold quality
cardiac ventricle	UBERON:0002082	77.84	gold quality
ascending aorta	UBERON:0001496	77.71	gold quality
heart left ventricle	UBERON:0002084	77.51	gold quality
gastrocnemius	UBERON:0001388	77.48	gold quality
aorta	UBERON:0000947	77.14	gold quality
heart	UBERON:0000948	76.50	gold quality
tendon of biceps brachii	UBERON:0008188	76.48	gold quality
popliteal artery	UBERON:0002250	76.47	gold quality
tibial artery	UBERON:0007610	76.44	gold quality
superior surface of tongue	UBERON:0007371	76.06	gold quality
renal medulla	UBERON:0000362	75.97	gold quality
mucosa of paranasal sinus	UBERON:0005030	75.87	gold quality
tongue	UBERON:0001723	75.71	gold quality
decidua	UBERON:0002450	75.41	gold quality
layer of synovial tissue	UBERON:0007616	75.41	gold quality
pharyngeal mucosa	UBERON:0000355	75.40	gold quality
trigeminal ganglion	UBERON:0001675	75.38	gold quality
visceral pleura	UBERON:0002401	75.36	gold quality
coronary artery	UBERON:0001621	75.16	gold quality
cardiac atrium	UBERON:0002081	74.64	gold quality
urinary bladder	UBERON:0001255	74.45	gold quality
left coronary artery	UBERON:0001626	74.27	gold quality
right coronary artery	UBERON:0001625	73.95	gold quality
apex of heart	UBERON:0002098	73.65	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

HPA expression

RNA tissue specificity: Tissue enriched

showing 60 of 151 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Adrenal gland	tissue	168.8	high
Liver	tissue	35.8	not detected
Cervix	tissue	22.2	low
Fallopian tube	tissue	19.5	medium
Testis	tissue	18.6	high
Spleen	tissue	17.8	not detected
Endometrium 1	tissue	17.4	medium
Seminal vesicle	tissue	17.2	high
Prostate	tissue	15.4
Epididymis	tissue	15.2	high
Ovary	tissue	13.9	high
Skeletal muscle	tissue	13.0	not detected
Ovary	tissue	12.8	not detected
Fallopian tube	tissue	12.1	medium
Skin 1	tissue	10.8	not detected
Vagina	tissue	10.3	not detected
Choroid plexus	tissue	9.6
Esophagus	tissue	9.5	not detected
Colon	tissue	9.1	not detected
Smooth muscle	tissue	8.8	not detected
Breast	tissue	8.2	medium
Cerebellum	tissue	8.1	not detected
Vagina	tissue	7.9	not detected
Locus coeruleus	tissue	7.8
Liver	tissue	6.9	not detected
Pons	tissue	6.7
Adipose tissue	tissue	6.3	not detected
Thalamus	tissue	6.1
Spinal cord	tissue	6.1
Hippocampal formation	tissue	6.0
Cerebral cortex	tissue	5.9	not detected
Somatosensory cortex	tissue	5.9
Medulla oblongata	tissue	5.8
Locus coeruleus	tissue	5.8
Motor cortex	tissue	5.7
Tongue	tissue	5.7
Superior colliculi	tissue	5.6
Parathyroid gland	tissue	5.5	not detected
Midbrain	tissue	5.5
Entorhinal cortex	tissue	5.5
Hippocampus	tissue	5.4	not detected
Heart muscle	tissue	5.4	not detected
Spinal cord	tissue	5.4
Putamen	tissue	5.2
Temporal cortex	tissue	5.2
Hypothalamus	tissue	5.2
Salivary gland	tissue	5.1	not detected
Substantia nigra	tissue	5.1
Frontal cortex	tissue	5.1
Cingulate cortex	tissue	5.0
Occipital cortex	tissue	5.0
Caudate putamen	tissue	5.0
Basal ganglia	tissue	4.9	not detected
Corpus callosum	tissue	4.9
Skin 1	tissue	4.9	not detected
Prefrontal cortex	tissue	4.8
Epididymis	tissue	4.8	high
Insular cortex	tissue	4.8
Ventral pallidum	tissue	4.7
Retrosplenial cortex	tissue	4.7

Brain sub-regions (HPA Brain Atlas): detected in 557; highest nTPM — Dorsal spinal cord (237.6), Lateral funiculus (white matter) (94.8), Nucleus raphe magnus (87.4), Nuclei of the trapezoid body (86.9), Anterior funiculus (white matter) (83.1).

Regulation

Is transcription factor: yes

JASPAR motifs

Motif	Name	Family
MA0007.2	AR	Steroid hormone receptors (NR3)

JASPAR matrix evidence (PMIDs): PMID:20943813

miRNA regulators (miRDB)

Targeting AR by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 316 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-520G-5P	99.99	66.76	658
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996

Functional genomics

Regional missense constraint (gnomAD)

ENST00000374690 splits into 5 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
X:67,545,147–67,545,487	55 / 84.8	0.65	no
X:67,545,488–67,643,314	423 / 377.0	1.12	no
X:67,643,315–67,686,103	19 / 48.3	0.39	no
X:67,686,104–67,711,529	47 / 35.9	1.31	no
X:67,711,530–67,723,838	95 / 196.4	0.48	no

Literature-anchored findings (GeneRIF, showing 40)

• Androgens induce neuroprotection directly through the androgen receptor. (PMID:11389183)
• Almost all of the amino acids located at the 13-residue C-terminal end of the androgen receptor participate in its ligand binding function and consequently in its transcriptional activation. (PMID:11456479)
• androgen receptor and DXS15-134 markers show a high rate of discordance for germline X chromosome inactivation in patients with breast or ovarian cancer (PMID:11474658)
• Molecular studies performed on eight individuals with AIS were reported. Exon-specific polymerase chain reaction (PCR), single-strand conformation polymorphism, and sequencing analyses, were performed in exons 2 to 8 of the AR gene. (PMID:11587068)
• androgen receptor CAG repeats in both black and white patients do not appear to be a strong indicator of prostatic cancer risk (PMID:11720249)
• The aggregation and localization of the truncated form, with or without an expanded polyglutamine tract, is differentially controlled by Glucocorticoid receptor mutants. (PMID:11751688)
• These results demonstrate that activation of the human AR NTD by IL-6 was mediated through MAPK and STAT3 signal transduction pathways in LNCaP prostate cancer cells (PMID:11751884)
• The AR gene (CAG)n exhibits polymorphism among normal male population and the present work could serve as a basis for further exploration of its pathological and genetic significance. (PMID:11774215)
• The FXXLF motif mediates androgen receptor-specific interactions with coregulators (PMID:11779876)
• poor reproductive performance observed in women with PCOS may be due to the concomitant increase and elevations in endometrial AR (PMID:11804942)
• Domain interactions between coregulator ARA(70) and the androgen receptor (AR); structure activity relationship (PMID:11818501)
• Missense substitution at M807 is associated with androgen insensitivity syndrome (PMID:11818512)
• stained sections throughout male genital development documented the expression of AR and 5 alpha-reductase type 2 in the phallus. (PMID:11845321)
• can promote nuclear translocation of beta-catenin in LNCaP and PC3 prostate cancer cells (PMID:11856748)
• function inhibited by the reproductive orphan nuclear receptor DAX-1 (PMID:11875111)
• Two de novo mutations in the AR gene cause the complete androgen insensitivity syndrome in a pair of monozygotic twins. (PMID:11889162)
• Conformational analysis of the androgen receptor amino-terminal domain involved in transactivation. Influence of structure-stabilizing solutes and protein-protein interactions (PMID:11896058)
• role in blood pressure (PMID:11903314)
• Structural basis for the glucocorticoid response in a mutant human androgen receptor (PMID:11906285)
• presence of both the amino- and carboxyl-terminal domains in the AR is essential for the completion of a transcriptionally active form with coactivators and intranuclear compartmentalization common to the steroid hormone receptors (PMID:11923466)
• CAG/CAA repeat lengths in androgen receptor gene may provide useful marker for clinically significant prostate cancer (PMID:11927493)
• These results suggest a model for the functional coordination between the promoter and enhancer in which communication between these elements is established through shared coactivators in the AR transcription complex. (PMID:11931767)
• CAG polymorphic repeat lengths in androgen receptor gene among Japanese prostate cancer patients: potential predictor of prognosis after endocrine therapy. (PMID:11967956)
• regulation of androgen receptor by PI3 kinase (PMID:11971763)
• Results suggest that the conserved AR acetylation site contributes to a pathway governing prostate cancer cellular survival, as AR acetylation mutants are defective in MEKK1-induced apoptosis. (PMID:11971970)
• androgen receptor has a capacity to activate transcription in a ligand-independent manner (PMID:11981028)
• The binding of HuR, CP1, and CP2 to AR mRNA suggests a role for each of these proteins in the post-transcriptional regulation of AR expression in cancer cells. (PMID:12011088)
• major sites of AR phosphorylation (PMID:12015328)
• contribution of genetic polymorphism of oestrogen and androgen receptor (AR) genes in male infertility (PMID:12031042)
• activation function-1 domain of androgen receptor contributes to the interaction between subnuclear splicing factor compartment and nuclear receptor compartment (PMID:12039962)
• identification as a coactivator for the androgen receptor [p102 U5 small nuclear ribonucleoprotein particle-binding protein] (PMID:12039962)
• An androgen receptor gene mutation (E653K) in a family with congenital adrenal hyperplasia due to steroid 21-hydroxylase deficiency as well as in partial androgen insensitivity. (PMID:12050225)
• review of NH(2)-terminal and carboxyl-terminal interaction in the androgen receptor (PMID:12051960)
• Stabilization of androgen receptor protein is induced by agonist, not by antagonists. (PMID:12061774)
• significance for endocrine therapy in prostatic cancer (REVIEW) (PMID:12083956)
• the androgen receptor-CAG alleles may contribute to hepatocellular carcinoma predisposition among women through a mechanism different from that for men (PMID:12085360)
• Our study thus suggests a functional cooperation between AR and Stat5. (PMID:12089361)
• Polymorphisms within the gene are biomarkers for the development of benign prostatic hyperplasia and benign prostatic enlargement(SRD5A2) (PMID:12111704)
• DHT may play more important roles than testosterone in the regulation of androgen action in endometrial cancer and normal human endometrium, especially in the secretory phase, in which both AR and 5alpha-reductase are increased (PMID:12115497)
• Androgen Receptor requires proteasome activity in prostate tumor cells (PMID:12119296)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	ar	ENSDARG00000067976
mus_musculus	Ar	ENSMUSG00000046532
rattus_norvegicus	Ar	ENSRNOG00000005639
drosophila_melanogaster	ERR	FBGN0035849

Paralogs (8): PGR (ENSG00000082175), ESR1 (ENSG00000091831), NR3C1 (ENSG00000113580), ESRRB (ENSG00000119715), ESR2 (ENSG00000140009), NR3C2 (ENSG00000151623), ESRRA (ENSG00000173153), ESRRG (ENSG00000196482)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:88064) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 164 distinct phenotype terms.

Mouse phenotype (MP)	Records
cryptorchism	9
small testis	8
secondary sex reversal	8
decreased testis weight	8
arrest of spermatogenesis	7
absent seminal vesicle	7
arrest of male meiosis	7
abnormal testis morphology	6
decreased circulating testosterone level	6
absent epididymis	6
small seminiferous tubules	5
absent prostate gland	5
azoospermia	5
abnormal spermatogenesis	4
male infertility	4
abnormal seminiferous tubule morphology	4
absent vas deferens	4
decreased seminal vesicle weight	4
abnormal male reproductive system morphology	3
decreased body weight	3
increased circulating follicle stimulating hormone level	3
increased circulating luteinizing hormone level	3
decreased litter size	3
abnormal secondary sex determination	3
decreased male germ cell number	3

+139 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Macaca fascicularis	O97952	99.8%	Diamond
Macaca mulatta	Q6QT55	99.8%	Diamond
Saimiri boliviensis boliviensis	O13186	99.7%	Diamond
Saimiri sciureus	O46567	99.7%	Diamond
Pan troglodytes	A7X8B3	99.5%	Diamond
Pan paniscus	A7X8B5	99.5%	Diamond
Aotus nancymaae	P79686	99.5%	Diamond
Saguinus oedipus	P79269	99.4%	Diamond
Pongo abelii	Q5R9P5	99.4%	Diamond
Callithrix jacchus	Q6XLJ0	99.4%	Diamond
Papio hamadryas	O97960	99.2%	Diamond
Gorilla gorilla gorilla	A7X8B7	99.1%	Diamond
Bos taurus	P49884	99.1%	Diamond
Ovis aries	P49885	99.1%	Diamond
Sus scrofa	P79404	98.7%	Diamond
Macaca sylvanus	A7X8C4	98.3%	Diamond
Papio anubis	A7X8C7	98.3%	Diamond
Felis catus	Q53AD2	98.3%	Diamond
Coturnix japonica	O93511	98.1%	Diamond
Canis lupus familiaris	Q9GLW0	98.1%	Diamond
Gallus gallus	Q9PTU5	98.1%	Diamond
Colobus guereza	A7X8D2	98.0%	Diamond
Trachypithecus obscurus	A7X8D4	98.0%	Diamond
Chlorocebus aethiops	A7X8C9	97.5%	Diamond
Pongo pygmaeus	A7X8B9	97.4%	Diamond
Hylobates lar	A7X8C2	97.1%	Diamond
Sapajus apella	A7XW16	97.1%	Diamond
Pithecia irrorata	A7XW20	97.1%	Diamond
Ateles paniscus	A7XW25	97.1%	Diamond
Taeniopygia guttata	Q91250	96.9%	Diamond
Oryctolagus cuniculus	P06186	96.8%	Diamond
Tupaia belangeri	Q29131	93.5%	Diamond
Notamacropus eugenii	P79373	93.3%	Diamond
Eulemur fulvus collaris	O97776	92.8%	Diamond
Aspidoscelis uniparens	Q91424	92.5%	Diamond
Crocuta crocuta	Q8MIK0	92.0%	Diamond
Oreochromis aureus	P50240	90.6%	Diamond
Oreochromis niloticus	Q9YH33	90.6%	Diamond
Cavia porcellus	P49115	88.7%	Diamond
Xenopus laevis	Q91573	85.2%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
NXTAR	ncRNA	105373241
OPHN1	protein-coding	4983

Protein

Protein identifiers

Androgen receptor — P10275 (reviewed: P10275)

Alternative names: Dihydrotestosterone receptor, Nuclear receptor subfamily 3 group C member 4

All UniProt accessions (6): A0A087WUX9, A0A087X1B6, A0A7I2PS51, E9PEG3, F5GZG9, P10275

UniProt curated annotations — full annotation on UniProt →

Function. Steroid hormone receptors are ligand-activated transcription factors that regulate eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues. Transcription factor activity is modulated by bound coactivator and corepressor proteins like ZBTB7A that recruits NCOR1 and NCOR2 to the androgen response elements/ARE on target genes, negatively regulating androgen receptor signaling and androgen-induced cell proliferation. Transcription activation is also down-regulated by NR0B2. Activated, but not phosphorylated, by HIPK3 and ZIPK/DAPK3. Lacks the C-terminal ligand-binding domain and therefore constitutively regulates the transcription of a specific set of canonical AR-target genes, including PSA/KLK3 and TMPRSS2, independently of steroid hormones. However, some genes are differentially regulated by full-length AR (isoform 1) and isoform 3. Isoform 3-specific target genes may be regulated independently of FOXA1 expression. Lacks the C-terminal ligand-binding domain and may therefore constitutively activate the transcription of a specific set of genes independently of steroid hormones.

Subunit / interactions. Binds DNA as a homodimer. Part of a ternary complex containing AR, EFCAB6/DJBP and PARK7. Interacts with HIPK3 and NR0B2 in the presence of androgen. The ligand binding domain interacts with KAT7/HBO1 in the presence of dihydrotestosterone. Interacts with EFCAB6/DJBP, PQBP1, RANBP9, RBAK, SPDEF, SRA1, TGFB1I1 and RREB1. Interacts with ZMIZ1/ZIMP10 and ZMIZ2/ZMIP7 which both enhance its transactivation activity. Interacts with SLC30A9 and RAD54L2/ARIP4. Interacts with MACROD1 (via macro domain). Interacts via the ligand-binding domain with LXXLL and FXXLF motifs from NCOA1, NCOA2, NCOA3 and MAGEA11. Interacts (via nuclear receptor DNA binding domain and nuclear receptor ligand binding domain) with NCOA4. The AR N-terminal poly-Gln region binds Ran resulting in enhancement of AR-mediated transactivation. Ran-binding decreases as the poly-Gln length increases. Interacts with HIP1 (via coiled coil domain). Interacts (via ligand-binding domain) with TRIM68. Interacts with TNK2. Interacts with USP26. Interacts with RNF6. Interacts (regulated by RNF6 probably through polyubiquitination) with RNF14; regulates AR transcriptional activity. Interacts with PRMT2 and TRIM24. Interacts with RACK1. Interacts with RANBP10; this interaction enhances dihydrotestosterone-induced AR transcriptional activity. Interacts with PRPF6 in a hormone-independent way; this interaction enhances dihydrotestosterone-induced AR transcriptional activity. Interacts with STK4/MST1. Interacts with ZIPK/DAPK3. Interacts with LPXN. Interacts with MAK. Part of a complex containing AR, MAK and NCOA3. Interacts with CRY1. Interacts with CCAR1 and GATA2. Interacts with ZNF318. Interacts with BUD31. Interacts with ARID4A. Interacts with ARID4B. Interacts (via NR LBD domain) with ZBTB7A; the interaction is direct and androgen-dependent. Interacts with NCOR1. Interacts with NCOR2. Interacts with CRY2 in a ligand-dependent manner. Interacts (via NR LBD domain) with RWDD1; the interaction is direct and may stimulate AR activity.

Subcellular location. Nucleus. Cytoplasm.

Tissue specificity. Mainly expressed in heart and skeletal muscle. Expressed in basal and stromal cells of the prostate (at protein level).

Post-translational modifications. Sumoylated on Lys-388 (major) and Lys-521. Ubiquitinated. Deubiquitinated by USP26. ‘Lys-6’ and ‘Lys-27’-linked polyubiquitination by RNF6 modulates AR transcriptional activity and specificity. Phosphorylated in prostate cancer cells in response to several growth factors including EGF. Phosphorylation is induced by c-Src kinase (CSK). Tyr-535 is one of the major phosphorylation sites and an increase in phosphorylation and Src kinase activity is associated with prostate cancer progression. Phosphorylation by TNK2 enhances the DNA-binding and transcriptional activity and may be responsible for androgen-independent progression of prostate cancer. Phosphorylation at Ser-83 by CDK9 regulates AR promoter selectivity and cell growth. Phosphorylation by PAK6 leads to AR-mediated transcription inhibition. Palmitoylated by ZDHHC7 and ZDHHC21. Palmitoylation is required for plasma membrane targeting and for rapid intracellular signaling via ERK and AKT kinases and cAMP generation.

Disease relevance. Androgen insensitivity syndrome (AIS) [MIM:300068] An X-linked recessive form of pseudohermaphroditism due end-organ resistance to androgen. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal 46,XY karyotype. The disease is caused by variants affecting the gene represented in this entry. Spinal and bulbar muscular atrophy X-linked 1 (SMAX1) [MIM:313200] An X-linked recessive form of spinal muscular atrophy. Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX1 occurs only in men. Age at onset is usually in the third to fifth decade of life, but earlier involvement has been reported. It is characterized by slowly progressive limb and bulbar muscle weakness with fasciculations, muscle atrophy, and gynecomastia. The disorder is clinically similar to classic forms of autosomal spinal muscular atrophy. The disease is caused by variants affecting the gene represented in this entry. Caused by trinucleotide CAG repeat expansion. In SMAX1 patients the number of Gln ranges from 38 to 62. Longer expansions result in earlier onset and more severe clinical manifestations of the disease. Prostate cancer, hereditary, X-linked 3 (HPCX3) [MIM:301120] A condition associated with familial predisposition to cancer of the prostate. Most prostate cancers are adenocarcinomas that develop in the acini of the prostatic ducts. Other rare histopathologic types of prostate cancer that occur in approximately 5% of patients include small cell carcinoma, mucinous carcinoma, prostatic ductal carcinoma, transitional cell carcinoma, squamous cell carcinoma, basal cell carcinoma, adenoid cystic carcinoma (basaloid), signet-ring cell carcinoma and neuroendocrine carcinoma. Disease susceptibility is associated with variants affecting the gene represented in this entry. Defects in AR may play a role in metastatic prostate cancer. The mutated receptor stimulates prostate growth and metastases development despite of androgen ablation. This treatment can reduce primary and metastatic lesions probably by inducing apoptosis of tumor cells when they express the wild-type receptor. Androgen insensitivity, partial (PAIS) [MIM:312300] A disorder that is characterized by hypospadias, hypogonadism, gynecomastia, genital ambiguity, normal XY karyotype, and a pedigree pattern consistent with X-linked recessive inheritance. Some patients present azoospermia or severe oligospermia without other clinical manifestations. The disease is caused by variants affecting the gene represented in this entry. Hypospadias 1, X-linked (HYSP1) [MIM:300633] A common malformation in which the urethra opens on the ventral side of the penis, due to developmental arrest of urethral fusion. The opening can be located glandular, penile, or even more posterior in the scrotum or perineum. Hypospadias is a feature of several syndromic disorders, including the androgen insensitivity syndrome and Opitz syndrome. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. AIM-100 (4-amino-5,6-biaryl-furo[2,3-d]pyrimidine) suppresses TNK2-mediated phosphorylation at Tyr-269. Inhibits the binding of the Tyr-269 phosphorylated form to androgen-responsive enhancers (AREs) and its transcriptional activity.

Domain organisation. Composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. In the presence of bound steroid the ligand-binding domain interacts with the N-terminal modulating domain, and thereby activates AR transcription factor activity. Agonist binding is required for dimerization and binding to target DNA. The transcription factor activity of the complex formed by ligand-activated AR and DNA is modulated by interactions with coactivator and corepressor proteins. Interaction with RANBP9 is mediated by both the N-terminal domain and the DNA-binding domain. Interaction with EFCAB6/DJBP is mediated by the DNA-binding domain.

Polymorphism. The poly-Gln region of AR is highly polymorphic and the number of Gln varies in the population (from 17 to 26). A smaller size of the poly-Gln region may be associated with the development of prostate cancer. Long poly-Gln alleles (>23) may be associated with higher testosterone levels and severe clinical outcome in COVID-19 disease. The poly-Gly region of AR is polymorphic and ranges from 24 to 31 Gly. A poly-Gly region shorter or equal to 23 may be associated with the development of androgenetic alopecia.

Miscellaneous. In the absence of ligand, steroid hormone receptors are thought to be weakly associated with nuclear components; hormone binding greatly increases receptor affinity. The hormone-receptor complex appears to recognize discrete DNA sequences upstream of transcriptional start sites. Transcriptional activity is enhanced by binding to RANBP9. The level of tyrosine phosphorylation may serve as a diagnostic tool to predict patient outcome in response to hormone-ablation therapy. Inhibition of tyrosine phosphorylation may be an effective intervention target for hormone-refractory prostate cancer. Minor isoform up-regulated in prostate cancer cells. Minor isoform identified in prostate cancer cells.

Similarity. Belongs to the nuclear hormone receptor family. NR3 subfamily.

Isoforms (4)

UniProt ID	Names	Canonical?
P10275-1	1, AR-B	yes
P10275-2	2, AR-A, Variant AR45
P10275-3	3, AR3, AR-V7
P10275-4	4, AR4

RefSeq proteins (4): NP_000035, NP_001011645, NP_001334990, NP_001334993 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000536	Nucl_hrmn_rcpt_lig-bd	Domain
IPR001103	Andrgn_rcpt	Family
IPR001628	Znf_hrmn_rcpt	Domain
IPR013088	Znf_NHR/GATA	Homologous_superfamily
IPR035500	NHR-like_dom_sf	Homologous_superfamily
IPR050200	Nuclear_hormone_rcpt_NR3	Family

Pfam: PF00104, PF00105, PF02166

UniProt features (321 total): sequence variant 219, mutagenesis site 19, helix 19, modified residue 15, strand 9, region of interest 8, sequence conflict 7, splice variant 6, cross-link 4, compositionally biased region 3, binding site 3, site 2, turn 2, zinc finger region 2, chain 1, domain 1, DNA-binding region 1

Structure

Experimental structures (PDB)

showing 30 of 95 structures by resolution:

PDB	Title	Method	Resolution (Å)
8E1A	Structure-based study to overcome cross-reactivity of novel androgen receptor inhibitors	X-RAY DIFFRACTION	1.2
7ZTZ	Crystal structure of mutant AR-LBD (Y764C) bound to dihydrotestosterone	X-RAY DIFFRACTION	1.4
4OHA	Crystal structure of T877A-AR-LBD bound with co-regulator peptide	X-RAY DIFFRACTION	1.42
5V8Q	Synthesis and biological evaluation of novel selective androgen receptor modulators …	X-RAY DIFFRACTION	1.44
2AX6	Crystal Structure Of The Androgen Receptor Ligand Binding Domain T877A Mutant In Complex …	X-RAY DIFFRACTION	1.5
3L3X	Crystal structure of DHT-bound androgen receptor in complex with the first motif of …	X-RAY DIFFRACTION	1.55
8FH0	Crystal structure of mutant Androgen Receptor ligand binding domain H875Y/F877L/T878A …	X-RAY DIFFRACTION	1.59
8FH2	Crystal structure of mutant Androgen Receptor ligand binding domain L702H/H875Y with DHT	X-RAY DIFFRACTION	1.59
8FGZ	Crystal structure of mutant Androgen Receptor ligand binding domain L702H/H875Y/F877L …	X-RAY DIFFRACTION	1.61
2AM9	Crystal structure of human androgen receptor ligand binding domain in complex with …	X-RAY DIFFRACTION	1.64
2AX9	Crystal Structure Of The Androgen Receptor Ligand Binding Domain In Complex With R-3	X-RAY DIFFRACTION	1.65
2PNU	Crystal structure of human androgen receptor ligand-binding domain in complex with EM-5744	X-RAY DIFFRACTION	1.65
3B66	Crystal structure of the androgen receptor ligand binding domain in complex with SARM S-21	X-RAY DIFFRACTION	1.65
1T65	Crystal structure of the androgen receptor ligand binding domain with DHT and a peptide …	X-RAY DIFFRACTION	1.66
7ZU1	Crystal structure of mutant AR-LBD (V758A) bound to dihydrotestosterone	X-RAY DIFFRACTION	1.68
8FH1	Crystal structure of mutant Androgen Receptor ligand binding domain F877L/T878A with DHT	X-RAY DIFFRACTION	1.69
2AX8	Crystal Structure Of The Androgen Receptor Ligand Binding Domain W741L Mutant In Complex …	X-RAY DIFFRACTION	1.7
3RLL	Crystal structure of the T877A androgen receptor ligand binding domain in complex with …	X-RAY DIFFRACTION	1.7
3V49	Structure of ar lbd with activator peptide and sarm inhibitor 1	X-RAY DIFFRACTION	1.7
7ZU2	Crystal structure of mutant AR-LBD (Q799E) bound to dihydrotestosterone	X-RAY DIFFRACTION	1.74
2AMB	Crystal structure of human androgen receptor ligand binding domain in complex with …	X-RAY DIFFRACTION	1.75
2PIT	Androgen receptor LBD with small molecule	X-RAY DIFFRACTION	1.76
1XOW	Crystal structure of the human androgen receptor ligand binding domain bound with an …	X-RAY DIFFRACTION	1.8
1Z95	Crystal Structure of the Androgen Receptor Ligand-binding Domain W741L Mutant Complex …	X-RAY DIFFRACTION	1.8
2AXA	Crystal Structure Of The Androgen Receptor Ligand Binding Domain In Complex With S-1	X-RAY DIFFRACTION	1.8
2OZ7	Crystal structure of the human androgen receptor T877A mutant ligand-binding domain with …	X-RAY DIFFRACTION	1.8
2PIP	Androgen receptor LBD with small molecule	X-RAY DIFFRACTION	1.8
2Q7K	The Androgen Receptor Prostate Cancer Mutant H874Y Ligand Binding Domain Bound with …	X-RAY DIFFRACTION	1.8
3B5R	Crystal structure of the androgen receptor ligand binding domain in complex with SARM C-31	X-RAY DIFFRACTION	1.8
3B65	Crystal structure of the androgen receptor ligand binding domain in complex with SARM S-24	X-RAY DIFFRACTION	1.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P10275-F1	58.85	0.29

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Oxidoreductases, Metabolic proteins, Predicted intracellular proteins, Disease related genes, Potential drug targets, Human disease related genes, Ear disease, Essential proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): mitochondria

Antibody reliability (HPA): IH enhanced · IF enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2)

Position	Role
721	interaction with coactivator lxxl and fxxfy motifs
898	interaction with coactivator fxxlf and fxxfy motifs

Ligand- & substrate-binding residues (3)

Position	Role
706	17beta-hydroxy-5alpha-androstan-3-one
753	17beta-hydroxy-5alpha-androstan-3-one
878	17beta-hydroxy-5alpha-androstan-3-one

Post-translational modifications (19)

Type	Positions
Phosphoserine	83, 96, 258, 651
Phosphotyrosine	225, 269, 309, 348, 359, 364, 365, 395, 535, 552, 916
Glycyl lysine isopeptide (lys-gly) (interchain with g-cter in sumo)	388, 521
Glycyl lysine isopeptide (lys-gly) (interchain with g-cter in ubiquitin)	846, 848

Mutagenesis-validated functional residues (19)

Position	Phenotype
83	reduced cell growth.
225	decrease of csk-induced phosphorylation.
269	decrease of csk-induced phosphorylation and phosphorylation by tnk2. complete loss of tnk2-dependent phosphorylation; when associated with …
309	decrease of csk-induced phosphorylation.
348	decrease of csk-induced phosphorylation.
359	decrease of csk-induced phosphorylation.
364	decrease of csk-induced phosphorylation.
365	decrease of csk-induced phosphorylation and phosphorylation by tnk2. complete loss of tnk2-dependent phosphorylation; when associated with …
395	decrease of csk-induced phosphorylation.
535	greatest decrease of csk-induced phosphorylation and inhibition of transcriptional activity induced by egf.
552	decrease in csk-induced phosphorylation.
702	alters receptor specificity, so that transcription is activated by the antiandrogen cyproterone acetate.
721	loss of transcription activation in the presence of androgen and of interaction with ncoa2.
742	strongly decreased transcription activation in the presence of androgen.
846	prevents ubiquitination by rnf6. prevents ar transcriptional activation by rnf14 in absence of hormone.
848	partially prevents ubiquitination by rnf6.
898	reduced transcription activation in the presence of androgen.
898	loss of transcription activation in the presence of androgen.
916	decrease in csk-induced phosphorylation.

Function

Pathways and Gene Ontology

Reactome pathways

5 curated (TAS) of 23; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

23 pathways:

ID	Pathway	Evidence
R-HSA-5625886	Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3	curated
R-HSA-3371497	HSP90 chaperone cycle for steroid hormone receptors (SHR) in the presence of ligand	curated
R-HSA-383280	Nuclear Receptor transcription pathway	curated
R-HSA-4090294	SUMOylation of intracellular receptors	curated
R-HSA-5689880	Ub-specific processing proteases	curated
R-HSA-8953897	Cellular responses to stimuli	—
R-HSA-2262752	Cellular responses to stress	—
R-HSA-5688426	Deubiquitination	—
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-212436	Generic Transcription Pathway	—
R-HSA-392499	Metabolism of proteins	—
R-HSA-597592	Post-translational protein modification	—
R-HSA-195258	RHO GTPase Effectors	—
R-HSA-5625740	RHO GTPases activate PKNs	—
R-HSA-73857	RNA Polymerase II Transcription	—
R-HSA-8941326	RUNX2 regulates bone development	—
R-HSA-8940973	RUNX2 regulates osteoblast differentiation	electronic
R-HSA-3108232	SUMO E3 ligases SUMOylate target proteins	—
R-HSA-2990846	SUMOylation	—
R-HSA-162582	Signal Transduction	—
R-HSA-194315	Signaling by Rho GTPases	—
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3	—
R-HSA-8878166	Transcriptional regulation by RUNX2	—

MSigDB gene sets: 613 (showing top): GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_UP, GSE45365_NK_CELL_VS_CD8A_DC_UP, GOBP_NEGATIVE_REGULATION_OF_EPITHELIAL_CELL_PROLIFERATION, GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_SINGLE_FERTILIZATION, MODULE_92, GOBP_POSITIVE_REGULATION_OF_REPRODUCTIVE_PROCESS, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_MAMMARY_GLAND_MORPHOGENESIS, FARMER_BREAST_CANCER_CLUSTER_7, GOBP_GLAND_MORPHOGENESIS, GOBP_REGULATION_OF_BLOOD_PRESSURE, YAGI_AML_WITH_INV_16_TRANSLOCATION, GOBP_REGULATION_OF_MORPHOGENESIS_OF_A_BRANCHING_STRUCTURE

GO Biological Process (28): negative regulation of transcription by RNA polymerase II (GO:0000122), DNA-templated transcription (GO:0006351), signal transduction (GO:0007165), cell-cell signaling (GO:0007267), spermatogenesis (GO:0007283), positive regulation of cell population proliferation (GO:0008284), negative regulation of cell population proliferation (GO:0008285), male gonad development (GO:0008584), positive regulation of gene expression (GO:0010628), estrogen receptor signaling pathway (GO:0030520), androgen receptor signaling pathway (GO:0030521), intracellular receptor signaling pathway (GO:0030522), positive regulation of cell differentiation (GO:0045597), positive regulation of integrin biosynthetic process (GO:0045726), positive regulation of DNA-templated transcription (GO:0045893), positive regulation of transcription by RNA polymerase II (GO:0045944), positive regulation of transcription by RNA polymerase III (GO:0045945), cellular response to steroid hormone stimulus (GO:0071383), cellular response to estrogen stimulus (GO:0071391), cellular response to testosterone stimulus (GO:0071394), membraneless organelle assembly (GO:0140694), positive regulation of miRNA transcription (GO:1902895), regulation of protein localization to plasma membrane (GO:1903076), negative regulation of extrinsic apoptotic signaling pathway (GO:2001237), regulation of DNA-templated transcription (GO:0006355), nuclear receptor-mediated steroid hormone signaling pathway (GO:0030518), response to testosterone (GO:0033574), response to ketone (GO:1901654)

GO Molecular Function (30): transcription cis-regulatory region binding (GO:0000976), RNA polymerase II transcription regulatory region sequence-specific DNA binding (GO:0000977), RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), RNA polymerase II general transcription initiation factor binding (GO:0001091), transcription coactivator binding (GO:0001223), DNA-binding transcription activator activity, RNA polymerase II-specific (GO:0001228), chromatin binding (GO:0003682), DNA-binding transcription factor activity (GO:0003700), nuclear steroid receptor activity (GO:0003707), nuclear receptor activity (GO:0004879), signaling receptor binding (GO:0005102), steroid binding (GO:0005496), androgen binding (GO:0005497), beta-catenin binding (GO:0008013), zinc ion binding (GO:0008270), enzyme binding (GO:0019899), estrogen response element binding (GO:0034056), ATPase binding (GO:0051117), molecular adaptor activity (GO:0060090), RNA polymerase II-specific DNA-binding transcription factor binding (GO:0061629), POU domain binding (GO:0070974), molecular condensate scaffold activity (GO:0140693), DNA binding (GO:0003677), protein binding (GO:0005515), lipid binding (GO:0008289), sequence-specific DNA binding (GO:0043565), metal ion binding (GO:0046872), sequence-specific double-stranded DNA binding (GO:1990837)

GO Cellular Component (8): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), plasma membrane (GO:0005886), nuclear speck (GO:0016607), protein-containing complex (GO:0032991)

Reactome top-level categories

15 top-level categories:

Category	Pathways
Generic Transcription Pathway	2
Post-translational protein modification	2
Cellular responses to stress	1
SUMO E3 ligases SUMOylate target proteins	1
RHO GTPases activate PKNs	1
Deubiquitination	1
RUNX2 regulates bone development	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
Signaling by Rho GTPases	1
RNA Polymerase II Transcription	1
Cellular responses to stimuli	1
SUMOylation	1
RHO GTPase Effectors	1
Metabolism of proteins	1
Gene expression (Transcription)	1

GO top-level categories

showing 60 of 76 GO namespaces:

Category	Terms
RNA polymerase II transcription regulatory region sequence-specific DNA binding	4
cellular anatomical structure	4
regulation of transcription by RNA polymerase II	3
nuclear receptor-mediated steroid hormone signaling pathway	3
protein binding	3
transcription by RNA polymerase II	2
gene expression	2
cell communication	2
signaling	2
cell population proliferation	2
regulation of cell population proliferation	2
positive regulation of cellular process	2
positive regulation of macromolecule biosynthetic process	2
regulation of DNA-templated transcription	2
positive regulation of DNA-templated transcription	2
cellular response to hormone stimulus	2
cellular response to lipid	2
transcription cis-regulatory region binding	2
DNA-binding transcription factor activity, RNA polymerase II-specific	2
negative regulation of DNA-templated transcription	1
RNA biosynthetic process	1
cellular process	1
regulation of cellular process	1
cellular response to stimulus	1
developmental process involved in reproduction	1
male gamete generation	1
negative regulation of cellular process	1
gonad development	1
development of primary male sexual characteristics	1
regulation of gene expression	1
intracellular signal transduction	1
cell differentiation	1
regulation of cell differentiation	1
positive regulation of developmental process	1
integrin biosynthetic process	1
regulation of integrin biosynthetic process	1
positive regulation of cellular component organization	1
DNA-templated transcription	1
positive regulation of RNA biosynthetic process	1
regulation of transcription by RNA polymerase III	1
transcription by RNA polymerase III	1
response to steroid hormone	1
response to estrogen	1
response to testosterone	1
cellular response to ketone	1
transcription regulatory region nucleic acid binding	1
sequence-specific double-stranded DNA binding	1
cis-regulatory region sequence-specific DNA binding	1
core promoter sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
RNA polymerase II complex binding	1
general transcription initiation factor binding	1
transcription coregulator binding	1
DNA-binding transcription activator activity	1
positive regulation of transcription by RNA polymerase II	1
binding	1
transcription regulator activity	1
nuclear receptor activity	1
intracellular receptor signaling pathway	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 43 of 66 annotations. The rest are phylogenetic / computational / electronic (IEA).

43 experimentally-supported GO terms:

GO term	NS	Evidence
androgen receptor signaling pathway	BP	direct assay
cellular response to estrogen stimulus	BP	direct assay
cellular response to steroid hormone stimulus	BP	mutant phenotype
cellular response to testosterone stimulus	BP	direct assay
estrogen receptor signaling pathway	BP	direct assay
intracellular receptor signaling pathway	BP	direct assay
membraneless organelle assembly	BP	direct assay
negative regulation of cell population proliferation	BP	mutant phenotype
negative regulation of extrinsic apoptotic signaling pathway	BP	direct assay
negative regulation of transcription by RNA polymerase II	BP	mutant phenotype
positive regulation of DNA-templated transcription	BP	direct assay
positive regulation of cell differentiation	BP	mutant phenotype
positive regulation of cell population proliferation	BP	direct assay
positive regulation of gene expression	BP	direct assay
positive regulation of integrin biosynthetic process	BP	direct assay
positive regulation of miRNA transcription	BP	direct assay
positive regulation of transcription by RNA polymerase II	BP	direct assay
positive regulation of transcription by RNA polymerase III	BP	direct assay
regulation of protein localization to plasma membrane	BP	direct assay
chromatin	CC	direct assay
cytoplasm	CC	direct assay
cytosol	CC	direct assay
nuclear speck	CC	direct assay
nucleus	CC	direct assay
protein-containing complex	CC	direct assay
ATPase binding	MF	direct assay
DNA-binding transcription activator activity, RNA polymerase II-specific	MF	direct assay
DNA-binding transcription factor activity	MF	direct assay
RNA polymerase II cis-regulatory region sequence-specific DNA binding	MF	direct assay
RNA polymerase II general transcription initiation factor binding	MF	physical interaction
RNA polymerase II transcription regulatory region sequence-specific DNA binding	MF	direct assay
RNA polymerase II-specific DNA-binding transcription factor binding	MF	physical interaction
androgen binding	MF	direct assay
beta-catenin binding	MF	direct assay
chromatin binding	MF	direct assay
enzyme binding	MF	physical interaction
molecular adaptor activity	MF	direct assay
molecular condensate scaffold activity	MF	direct assay
nuclear receptor activity	MF	direct assay
nuclear steroid receptor activity	MF	direct assay
signaling receptor binding	MF	physical interaction
transcription cis-regulatory region binding	MF	direct assay
transcription coactivator binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 4,608 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
AR	KLK3	P07288	930
AR	NKX3-1	Q99801	873
AR	TMPRSS2	O15393	864
AR	TP53	P04637	826
AR	SRD5A2	P31213	806
AR	CYP19A1	P11511	792
AR	CYP17A1	P05093	775
AR	GNRH1	P01148	769
AR	ERBB2	P04626	753
AR	KLKB1	P03952	752
AR	NCOA2	Q15596	744
AR	FOLH1	Q04609	741
AR	HOXB13	Q92826	740
AR	PTEN	P60484	733
AR	FKBP5	Q13451	726

IntAct

Human interaction partners of AR in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 125 partners by confidence:

Partner	Interaction type	MIscore	Records
CTNNB1	physical association	0.890	15
FOXA1	physical association	0.710	2
ERG	physical association	0.690	4
NCOA2	direct interaction	0.690	3
BRD4	physical association	0.680	6
KMT2A	physical association	0.670	2
JMJD1C	physical association	0.640	2
DAXX	physical association	0.630	5
CREBBP	physical association	0.630	2
NCOA6	physical association	0.620	2
SUMO1	physical association	0.600	7
PARK7	physical association	0.600	6
SMAD1	physical association	0.600	6
NSD2	association	0.600	5
KLK3	association	0.600	3
KMT2D	association	0.600	2
ASH2L	physical association	0.600	1
KAT7	physical association	0.590	5
RNF6	physical association	0.580	5
CTDSP2	physical association	0.580	3
NCOR1	association	0.570	1
MAK	physical association	0.540	5
CCND1	physical association	0.540	4
HDAC4	physical association	0.540	4
PRDX1	physical association	0.540	3
CTNNBIP1	association	0.530	3
GSN	physical association	0.530	2
BTG2	physical association	0.520	4
KDM5D	physical association	0.520	4
IFI16	physical association	0.520	3

BioGRID (1,735 interactions; top human partners by supporting records in a sample of 600 records): CTNNB1 (Reconstituted Complex; 13 records), NCOA4 (Two-hybrid; 13 records), NCOR1 (Proximity Label-MS; 12 records), SMAD3 (Reconstituted Complex; 12 records), MDM2 (Affinity Capture-Western; 11 records), NCOR2 (Proximity Label-MS; 8 records), STUB1 (Biochemical Activity; 8 records), HSP90AA1 (Affinity Capture-Western; 7 records), HIF1A (Reconstituted Complex; 6 records), CCND1 (Affinity Capture-Western; 5 records), CREBBP (Reconstituted Complex; 5 records), EP300 (Affinity Capture-Western; 5 records), FOXA1 (Affinity Capture-Western; 5 records), SPOP (Affinity Capture-Western; 5 records), SUV39H2 (Two-hybrid; 5 records)

SIGNOR signaling

showing 57 of 114 signaling interactions:

A	Effect	B	Mechanism
NCOR2	down-regulates	AR	acetylation
AR	up-regulates	NR5A1	binding
NR0B2	down-regulates	AR	binding
AR	“down-regulates quantity by repression”	CTNNB1	“transcriptional regulation”
ERBB3	“up-regulates quantity by expression”	AR	“transcriptional regulation”
HIP1	“down-regulates quantity by repression”	AR	“transcriptional regulation”
PKN1	up-regulates	AR	phosphorylation
AKT1	down-regulates	AR	phosphorylation
CDK7	down-regulates	AR	phosphorylation
CDK1	up-regulates	AR	phosphorylation
CDK5	up-regulates	AR	phosphorylation
MAPK1	down-regulates	AR	phosphorylation
DDX5	up-regulates	AR	binding
NSD2	up-regulates	AR	binding
TRIM24	up-regulates	AR	binding
(2S)-3-(4-acetamidophenoxy)-2-hydroxy-2-methyl-N-[4-nitro-3-(trifluoromethyl)phenyl]propanamide	up-regulates	AR	“chemical activation”
N-[4-cyano-3-(trifluoromethyl)phenyl]-3-(4-fluorophenyl)sulfonyl-2-hydroxy-2-methylpropanamide	down-regulates	AR	“chemical inhibition”
“cyproterone acetate”	down-regulates	AR	“chemical inhibition”
enzalutamide	down-regulates	AR	“chemical inhibition”
nilutamide	down-regulates	AR	“chemical inhibition”
FER	up-regulates	AR	phosphorylation
ENOBOSARM	up-regulates	AR	“chemical activation”
TBL1XR1	up-regulates	AR	binding
AKT	down-regulates	AR	phosphorylation
ERK1/2	down-regulates	AR	phosphorylation
NCOA2	“up-regulates activity”	AR	binding
17beta-hydroxy-5alpha-androstan-3-one	up-regulates	AR	“chemical activation”
HSP90AB1	“up-regulates activity”	AR	binding
HSP90AA1	“up-regulates activity”	AR	binding
AR	“up-regulates activity”	AR	binding
AR	up-regulates	Differentiation
AR	up-regulates	Survival
AR	up-regulates	Proliferation
FOXA1	“down-regulates quantity by repression”	AR	“transcriptional regulation”
EZH2	“up-regulates activity”	AR	binding
AR	“up-regulates quantity by expression”	UBE2C	“transcriptional regulation”
AR	“up-regulates quantity by expression”	TMPRSS2	“transcriptional regulation”
AR	“up-regulates quantity by expression”	NKX3-1	“transcriptional regulation”
NKX3-1	“down-regulates quantity by repression”	AR	“transcriptional regulation”
testosterone	“up-regulates activity”	AR	“chemical activation”
AR	“up-regulates quantity by expression”	ARG2	“transcriptional regulation”
AR	“down-regulates quantity by repression”	CLK3	“transcriptional regulation”
AR	“down-regulates quantity by repression”	BTG1	“transcriptional regulation”
AR	“down-regulates quantity by repression”	BTG2	“transcriptional regulation”
AR	“down-regulates quantity by repression”	CDKN1A	“transcriptional regulation”
AR	“down-regulates quantity by repression”	NRAS	“transcriptional regulation”
AR	“down-regulates quantity by repression”	SEPTIN7	“transcriptional regulation”
AR	“down-regulates quantity by repression”	WEE1	“transcriptional regulation”
AR	“up-regulates quantity by expression”	NAT1	“transcriptional regulation”
AR	“down-regulates quantity by repression”	UCN	“transcriptional regulation”
AR	“down-regulates quantity by repression”	AKR1C3	“transcriptional regulation”
AR	“up-regulates quantity by expression”	ARG1	“transcriptional regulation”
AR	“down-regulates quantity by repression”	CYP7B1	“transcriptional regulation”
HOXB13	“down-regulates quantity by repression”	AR	“transcriptional regulation”
KDM4B	“up-regulates quantity by expression”	AR	“transcriptional regulation”
DAB2IP	“down-regulates activity”	AR	binding
PP2Ca_R1A_Bd	“down-regulates activity”	AR	dephosphorylation

Protein complexes (CORUM) (108)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

showing 60 of 108 complexes by size:

Complex	Subunits	Members
★ AR-CLNS1A-PRMT5-WDR77 complex	4	CLNS1A, PRMT5, WDR77, AR
★ AKT1-APPL1-AR complex	3	AKT1, APPL1, AR
★ AR-CTNNB1-CTNNBIP1 complex	3	AR, CTNNB1, CTNNBIP1
★ AR-EFCAB6-PARK7 complex	3	AR, EFCAB6, PARK7
★ AR-DTX3L-PARP9 complex	3	AR, DTX3L, PARP9
★ AR-HDAC1-KAT5 complex	3	HDAC1, KAT5, AR
★ AR-KDM1A-KDM4C complex	3	AR, KDM1A, KDM4C
★ AR-HDAC1-MDM2 complex	3	AR, HDAC1, MDM2
★ AR-HDAC1-RCHY1 complex	3	AR, HDAC1, RCHY1
★ AR-XRCC5-XRCC6 complex	3	AR, XRCC5, XRCC6
★ AR-BAG1-HSP1A1 complex	3	AR, BAG1, HSPA1A
★ AR-FHL2-PELP1 complex	3	PELP1, AR, FHL2
★ AR-NCOA2-PKN1 complex	3	PKN1, AR, NCOA2
★ AR-RACK1-SRC complex	3	AR, RACK1, SRC
★ AR-PATZ1-RNF4 complex	3	AR, PATZ1, RNF4
★ AR-MAK-NCOA3 complex	3	NCOA3, AR, MAK
★ AR-PPP2CA-PPP2R1A complex	3	AR, PPP2CA, PPP2R1A
★ AR-PIK3R1-SRC complex	3	AR, PIK3R1, SRC
★ AR-ATF2-JUN complex	3	AR, ATF2, JUN
★ AR-NONO-SFPQ complex	3	AR, NONO, SFPQ
★ ESR2-AR complex	2	AR, ESR2
★ AR-MAGEA11 complex	2	AR, MAGEA11
★ AR-NCOA2 complex	2	NCOA2, AR
★ AR-KAT5 complex	2	AR, KAT5
★ AR-KAT7 complex	2	AR, KAT7
★ AR-SIRT1 complex	2	AR, SIRT1
★ AR-NSD1 complex	2	AR, NSD1
★ AR-KDM1A complex	2	AR, KDM1A
★ AR-KDM3A complex	2	KDM3A, AR
★ AR-UBE3A complex	2	AR, UBE3A
★ AR-RNF4 complex	2	AR, RNF4
★ AR-RNF14 complex	2	AR, RNF14
★ AR-USP10 complex	2	USP10, AR
★ AR-SUMO3 complex	2	AR, SUMO3
★ AR-ZMIZ1 complex	2	AR, ZMIZ1
★ AR-SENP1 complex	2	AR, SENP1
★ AR-PRPF6 complex	2	AR, PRPF6
★ AR-NONO complex	2	AR, NONO
★ AR-RAD9A complex	2	AR, RAD9A
★ AR-BRCA1 complex	2	AR, BRCA1
★ AR-BRCA2 complex	2	AR, BRCA2
★ AR-SVIL complex	2	AR, SVIL
★ AR-GSN complex	2	AR, GSN
★ AR-FLNA complex	2	AR, FLNA
★ APPBP2-AR complex	2	APPBP2, AR
★ AR-HIP1 complex	2	AR, HIP1
★ AR-GAK complex	2	AR, GAK
★ AR-CAV1 complex	2	AR, CAV1
★ AR-TGFB1I1 complex	2	AR, TGFB1I1
★ AR-FHL2 complex	2	FHL2, AR
★ AR-TNK2 complex	2	AR, TNK2
★ AR-RANBP9 complex	2	AR, RANBP9
★ AR-PAK6 complex	2	AR, PAK6
★ AR-STAT3 complex	2	AR, STAT3
★ AR-SMAD3 complex	2	AR, SMAD3
★ AR-HEY1 complex	2	AR, HEY1
★ AR-RNASEL complex	2	AR, RNASEL
★ AR-CTNNB1 complex	2	AR, CTNNB1
★ AR-GSK3B complex	2	AR, GSK3B
★ AR-TCF4 complex	2	TCF4, AR

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 125 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Regulation of signaling by CBL	11	47.5×	3e-14
DAP12 signaling	12	38.4×	3e-14
Signaling by phosphorylated juxtamembrane, extracellular and kinase domain KIT mutants	8	36.1×	1e-09
Signaling by CSF3 (G-CSF)	7	34.8×	2e-08
FCERI mediated Ca+2 mobilization	11	34.1×	1e-12
Signaling by CSF1 (M-CSF) in myeloid cells	11	33.1×	1e-12
Regulation of KIT signaling	6	31.4×	5e-07
Tie2 Signaling	6	31.4×	5e-07

GO biological processes:

GO term	Partners	Fold	FDR
Fc-gamma receptor signaling pathway involved in phagocytosis	10	57.5×	4e-13
Fc-epsilon receptor signaling pathway	8	48.0×	7e-10
B cell receptor signaling pathway	11	36.2×	3e-12
negative regulation of inflammatory response to antigenic stimulus	7	34.5×	1e-07
peptidyl-tyrosine phosphorylation	9	31.1×	2e-09
stimulatory C-type lectin receptor signaling pathway	5	30.0×	4e-05
positive regulation of erythrocyte differentiation	6	25.1×	1e-05
epidermal growth factor receptor signaling pathway	11	22.3×	6e-10

Disease & clinical

Genetic variants

Variant evidence for AR: 1,138 ClinVar records (380 pathogenic / likely pathogenic). Per-variant detail is on Sugi Variant.

ClinVar

1,138 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	257
Likely pathogenic	123
Uncertain significance	220
Likely benign	297
Benign	92

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 380 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
492787	NM_000044.6(AR):c.2086G>A (p.Asp696Asn)	Pathogenic	criteria provided, multiple submitters, no conflicts	10
9813	NM_000044.6(AR):c.1789G>A (p.Ala597Thr)	Pathogenic	criteria provided, multiple submitters, no conflicts	8
9829	NM_000044.6(AR):c.2522G>A (p.Arg841His)	Pathogenic	criteria provided, multiple submitters, no conflicts	8
458366	NM_000044.6(AR):c.2495G>A (p.Arg832Gln)	Pathogenic	criteria provided, multiple submitters, no conflicts	8
9806	NM_000044.6(AR):c.2599G>A (p.Val867Met)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
9830	NM_000044.6(AR):c.2521C>T (p.Arg841Cys)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
279684	NM_000044.6(AR):c.1847G>A (p.Arg616His)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
9804	NM_000044.6(AR):c.2323C>T (p.Arg775Cys)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
279687	NM_000044.6(AR):c.2566C>T (p.Arg856Cys)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
279690	NM_000044.6(AR):c.2668G>A (p.Val890Met)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
458363	NM_000044.6(AR):c.2296G>A (p.Ala766Thr)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
989383	NM_000044.6(AR):c.2338C>T (p.Arg780Trp)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
9850	NM_000044.6(AR):c.2667C>T (p.Ser889=)	Pathogenic	criteria provided, multiple submitters, no conflicts	5
279682	NM_000044.6(AR):c.1822C>T (p.Arg608Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	5
9819	NM_000044.6(AR):c.2324G>A (p.Arg775His)	Pathogenic	criteria provided, multiple submitters, no conflicts	4

Per-variant reference — Sugi Variant

Explore AR’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

AlphaMissense

2,322 missense substitutions predicted likely pathogenic (of 5,978 scored), across 444 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M625	9	0.998	1.000
M776	9	0.985	0.999
M895	9	0.981	0.999
M735	9	0.967	0.999
M781	9	0.960	0.998
M788	9	0.954	0.999
M762	9	0.951	0.997
M808	9	0.942	0.999
M746	9	0.905	0.998
M896	9	0.891	0.999
D605	8	1.000	1.000
H571	8	0.999	1.000
D565	8	0.998	1.000
F583	8	0.998	1.000
F584	8	0.998	1.000
D601	8	0.998	1.000
N611	8	0.998	1.000
D733	8	0.998	1.000
D768	8	0.998	1.000
D865	8	0.998	1.000

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

10 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	2.78e-11
Stomach Adenocarcinoma (TCGA)	unfavorable	6.55e-06
Glioblastoma Multiforme (TCGA)	unfavorable	1.19e-05
Head and Neck Squamous Cell Carcinoma (TCGA)	unfavorable	6.34e-05
Lung Squamous Cell Carcinoma (TCGA)	unfavorable	8.29e-05
Rectum Adenocarcinoma (validation)	favorable	0.000236
Pancreatic Adenocarcinoma (validation)	unfavorable	0.00043
Pancreatic Adenocarcinoma (TCGA)	unfavorable	0.000675
Lung Adenocarcinoma (TCGA)	unfavorable	0.000851
Kidney Renal Clear Cell Carcinoma (validation)	favorable	0.000945

Disease associations

OMIM: gene MIM:313700 | disease phenotypes: MIM:313200, MIM:300068, MIM:307300, MIM:312100, MIM:312300, MIM:167000, MIM:300633, MIM:301120, MIM:176807, MIM:400044

GenCC curated gene-disease

4 curated gene-disease records:

Disease	Classification	Inheritance	Records
androgen insensitivity syndrome	Definitive	X-linked	5
Kennedy disease	Definitive	X-linked	5
partial androgen insensitivity syndrome	Strong	X-linked	2
complete androgen insensitivity syndrome	Supportive	X-linked

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

1 validity classifications:

Disease	Classification	Inheritance
Kennedy disease	Definitive	XL

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (4 panels, 4 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

4 panels:

Panel	Rating
DDG2P	green
Differences in sex development	green
Fetal anomalies	green
Paediatric disorders	green

Mondo (12): Kennedy disease (MONDO:0010735), androgen insensitivity syndrome (MONDO:0019154), male infertility (MONDO:0005372), prostate cancer (MONDO:0008315), partial androgen insensitivity syndrome (MONDO:0010720), ovarian cancer (MONDO:0008170), hypospadias 1, X-linked (MONDO:0010384), prostate cancer, hereditary, X-linked 3 (MONDO:0971170), complete androgen insensitivity syndrome (MONDO:0021023), prostate cancer, hereditary (MONDO:0700275), disorder of sexual differentiation (MONDO:0002145), 46,XY complete gonadal dysgenesis (MONDO:0010765)

Orphanet (10): Kennedy disease (Orphanet:481), Androgen insensitivity syndrome (Orphanet:754), Complete androgen insensitivity syndrome (Orphanet:99429), Familial prostate cancer (Orphanet:1331), Partial androgen insensitivity syndrome (Orphanet:90797), Rare ovarian cancer (Orphanet:213500), OBSOLETE: Familial hypospadias (Orphanet:440), Male infertility with azoospermia or oligozoospermia due to single gene mutation (Orphanet:399805), Difference of sex development (Orphanet:90771), 46,XY complete gonadal dysgenesis (Orphanet:242)

MeSH disease descriptors

10 disease descriptors:

Descriptor	Name	Tree numbers
D013734	Androgen-Insensitivity Syndrome	C12.050.351.875.253.096.500; C12.200.706.316.096.500; C12.800.316.096.500; C16.131.939.316.096.500; C16.320.322.061; C19.391.119.096.500
D055534	Bulbo-Spinal Atrophy, X-Linked	C10.228.854.468.399; C10.574.500.175; C10.574.562.500.374; C10.668.467.500.186; C16.320.322.076; C16.320.400.100
D012734	Disorders of Sex Development	C12.050.351.875.253; C12.200.706.316; C12.800.316; C16.131.939.316; C19.391.119
D006061	Gonadal Dysgenesis, 46,XY	C12.050.351.875.253.096.687; C12.050.351.875.253.309.388; C12.200.706.316.096.687; C12.200.706.316.309.388; C12.800.316.096.687; C12.800.316.309.388; C16.131.939.316.096.687; C16.131.939.316.309.388; C19.391.119.096.687; C19.391.119.309.388
D007248	Infertility, Male	C12.100.500.430; C12.100.750.700; C12.200.294.430
D010051	Ovarian Neoplasms	C04.588.322.455; C12.050.351.500.056.630.705; C12.050.351.937.418.685; C12.100.250.056.630.705; C12.900.418.685; C19.344.410; C19.391.630.705
D011471	Prostatic Neoplasms	C04.588.945.440.770; C12.100.500.260.750; C12.100.500.565.625; C12.200.294.260.750; C12.200.294.565.625; C12.200.758.409.750; C12.900.619.750
C567482	Hypospadias 1, X-Linked *(supp.)*
C538435	Lubs syndrome *(supp.)*
C537243	Prostate cancer, familial *(supp.)*

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (7): CHEMBL1871 (SINGLE PROTEIN), CHEMBL4296118 (PROTEIN-PROTEIN INTERACTION), CHEMBL4523653 (PROTEIN-PROTEIN INTERACTION), CHEMBL4523684 (PROTEIN-PROTEIN INTERACTION), CHEMBL4523730 (PROTEIN-PROTEIN INTERACTION), CHEMBL5169084 (PROTEIN-PROTEIN INTERACTION), CHEMBL6193822 (PROTEIN-PROTEIN INTERACTION)

Drugs by curated mechanism of action (ChEMBL)

Drugs whose curated ChEMBL mechanism of action targets the AR protein itself — single-protein targets only (drugs acting on a protein family or complex that merely includes it are excluded). Includes antibodies and oligonucleotides that bioactivity screening does not capture.

42 curated-mechanism drugs:

Drug	Modality	Max phase
ABIRATERONE	Small molecule	4
APALUTAMIDE	Small molecule	4
BICALUTAMIDE	Small molecule	4
CLASCOTERONE	Small molecule	4
DANAZOL	Small molecule	4
DAROLUTAMIDE	Small molecule	4
DROMOSTANOLONE PROPIONATE	Small molecule	4
ENZALUTAMIDE	Small molecule	4
ETHYLESTRENOL	Small molecule	4
FLUOXYMESTERONE	Small molecule	4
FLUTAMIDE	Small molecule	4
METHANDROSTENOLONE	Small molecule	4
METHYLTESTOSTERONE	Small molecule	4
NANDROLONE DECANOATE	Small molecule	4
NANDROLONE PHENPROPIONATE	Small molecule	4
NILUTAMIDE	Small molecule	4
OXANDROLONE	Small molecule	4
OXYMETHOLONE	Small molecule	4
STANOZOLOL	Small molecule	4
TESTOSTERONE	Small molecule	4
TESTOSTERONE CYPIONATE	Small molecule	4
TESTOSTERONE ENANTHATE	Small molecule	4
TESTOSTERONE PROPIONATE	Small molecule	4
TESTOSTERONE UNDECANOATE	Small molecule	4
CYPROTERONE ACETATE	Small molecule	3
ENOBOSARM	Small molecule	3
GALETERONE	Small molecule	3
PRUXELUTAMIDE	Small molecule	3
REZVILUTAMIDE	Small molecule	3
CR 1447	Unknown	2
DIMETHYLCURCUMIN	Small molecule	2
GSK2881078	Unknown	2
LY2452473	Small molecule	2
MK-0773	Small molecule	2
SEVITERONEL	Small molecule	2
VK5211	Small molecule	2
APC-100	Small molecule	1
AZD3514	Small molecule	1
GLPG0492	Small molecule	1
GSK2849466	Unknown	1
HE3235	Small molecule	1
LGD-2941	Small molecule	1

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 745,973 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

showing 60 of 116 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL271227	ABIRATERONE ACETATE	4	2,765
CHEMBL3183409	APALUTAMIDE	4	4,347
CHEMBL409	BICALUTAMIDE	4	87,631
CHEMBL3590187	CLASCOTERONE	4	479
CHEMBL4297185	DAROLUTAMIDE	4	2,127
CHEMBL1082407	ENZALUTAMIDE	4	10,210
CHEMBL1445	FLUOXYMESTERONE	4	33,076
CHEMBL806	FLUTAMIDE	4	100,220
CHEMBL1274	NILUTAMIDE	4	64,906
CHEMBL1200436	OXANDROLONE	4	5,274
CHEMBL386630	TESTOSTERONE	4	131,189
CHEMBL1170	TESTOSTERONE PROPIONATE	4	17,758
CHEMBL1112	ARIPIPRAZOLE	4	24,497
CHEMBL1200500	BECLOMETHASONE DIPROPIONATE	4	29,453
CHEMBL632	BETAMETHASONE	4	77,547
CHEMBL290106	BITHIONOL	4	6,490
CHEMBL253376	BROMHEXINE	4	6,586
CHEMBL1370	BUDESONIDE	4	73,656
CHEMBL110691	CHLORMADINONE ACETATE	4	9,833
CHEMBL1741	CLARITHROMYCIN	4	57,929
CHEMBL1200975	CLOCORTOLONE PIVALATE	4
CHEMBL2355051	CLOMIPHENE	4
CHEMBL1650	CORTISONE ACETATE	4
CHEMBL141305	CYCLOFENIL	4
CHEMBL1533	DESOGESTREL	4
CHEMBL1766	DESOXIMETASONE	4
CHEMBL384467	DEXAMETHASONE	4
CHEMBL411	DIETHYLSTILBESTROL	4
CHEMBL1200545	DIFLORASONE DIACETATE	4
CHEMBL218490	DORZOLAMIDE	4
CHEMBL1509	DROSPIRENONE	4
CHEMBL1200853	DYDROGESTERONE	4
CHEMBL1095097	EPLERENONE	4
CHEMBL135	ESTRADIOL	4
CHEMBL1200430	ESTRADIOL ACETATE	4
CHEMBL1200973	ESTRADIOL CYPIONATE	4
CHEMBL1511	ESTRADIOL VALERATE	4
CHEMBL193482	ESTRIOL	4
CHEMBL1405	ESTRONE	4
CHEMBL691	ETHINYL ESTRADIOL	4
CHEMBL1200624	ETHYNODIOL DIACETATE	4
CHEMBL1531	ETONOGESTREL	4
CHEMBL1200877	FLUMETHASONE PIVALATE	4
CHEMBL989	FLUOCINOLONE ACETONIDE	4
CHEMBL1501	FLUOCINONIDE	4
CHEMBL1201012	FLURANDRENOLIDE	4
CHEMBL1676	FLUTICASONE FUROATE	4
CHEMBL1473	FLUTICASONE PROPIONATE	4
CHEMBL1200845	HALCINONIDE	4
CHEMBL1200908	HALOBETASOL PROPIONATE	4
CHEMBL496	HEXACHLOROPHENE	4
CHEMBL9225	HEXESTROL	4
CHEMBL1091	HYDROCORTISONE ACETATE	4
CHEMBL6	INDOMETHACIN	4
CHEMBL1389	LEVONORGESTREL	4
CHEMBL717	MEDROXYPROGESTERONE ACETATE	4
CHEMBL1201139	MEGESTROL ACETATE	4
CHEMBL1364144	METHYLPREDNISOLONE ACETATE	4
CHEMBL1276308	MIFEPRISTONE	4
CHEMBL1161	MOMETASONE FUROATE	4

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: nhr — 3C. 3-Ketosteroid receptors

Most potent curated ligand interactions (30 total), top 25:

Ligand	Action	Affinity	Parameter
methyltestosterone	Full agonist	9.66	pEC50
testosterone propionate	Agonist	9.6	pKi
dihydrotestosterone	Agonist	9.3	pKd
mifepristone	Antagonist	9.19	pKi
mibolerone	Agonist	8.96	pIC50
androstenedione	Agonist	8.56	pIC50
GSK2881078	Agonist	8.4	pEC50
andarine	Agonist	8.4	pKi
fluoxymesterone	Agonist	8.24	pKi
danazol	Agonist	8.0	pKi
cyproterone acetate	Antagonist	7.85	pKi
testosterone	Agonist	7.8	pIC50
stanozolol	Agonist	7.66	pIC50
darolutamide	Antagonist	7.59	pIC50
PF0998425	Antagonist	7.5	pIC50
pruxelutamide	Antagonist	7.49	pIC50
clascoterone	Antagonist	7.4	pKi
deutenzalutamide	Antagonist	7.4	pIC50
JNJ-63576253	Antagonist	7.27	pIC50
ARD-69	Antagonist	7.23	pIC50
nilutamide	Antagonist	7.12	pIC50
apalutamide	Antagonist	6.7	pIC50
enzalutamide	Antagonist	6.66	pIC50
hydroxyflutamide	Antagonist	6.6	pEC50
galeterone	Antagonist	6.42	pIC50

Binding affinities (BindingDB)

2850 measured of 3610 human assays (3626 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
17-Hydroxy-13-methyl-11-pentyl-1,2,6,7,8,11,12,13,14,15,16,17-dodecahydro-cyclopenta[a]phenanthren-3-one	IC50	0.009 nM
Metribolone	EC50	0.013 nM
CHEMBL3818706	EC50	0.0316 nM
CHEMBL3238292	EC50	0.039 nM
CHEMBL3765171	EC50	0.0398 nM
DHT	EC50	0.05 nM
CHEMBL3238291	EC50	0.06 nM
CHEMBL3238288	EC50	0.074 nM
2-chloro-4-((1R,2S)-1-(5-(4-cyanophenyl)-1,3,4-oxadiazol-2-yl)-2-hydroxypropylamino)-3-methylbenzonitrile	EC50	0.1 nM
CHEMBL3233072	EC50	0.11 nM
CHEMBL194467	EC50	0.13 nM
CHEMBL4095364	EC50	0.14 nM
CHEMBL3238287	EC50	0.15 nM
CHEMBL3819048	EC50	0.158 nM
CHEMBL3326461	EC50	0.16 nM
CHEMBL4074555	EC50	0.17 nM
CHEMBL3402221	EC50	0.19 nM
CHEMBL4090028	EC50	0.19 nM
CHEMBL3818497	EC50	0.2 nM
CHEMBL3818619	EC50	0.2 nM
CHEMBL3819648	EC50	0.2 nM
6-[bis(2,2,2-trifluoroethyl)amino]-4-(trifluoromethyl)-1,2-dihydroquinolin-2-one	EC50	0.2 nM
6-[(2,2-difluoroethyl)(2,2,2-trifluoroethyl)amino]-4-(trifluoromethyl)-1,2-dihydroquinolin-2-one	EC50	0.2 nM
4-(2-hydroxyphenyl)-2-(trifluoromethyl)benzonitrile	IC50	0.2 nM
BMS-665139	EC50	0.2 nM
oxazolidin-2-imine, 6d	KI	0.2 nM
11-Dodecyl-17-hydroxy-13-methyl-1,2,6,7,8,11,12,13,14,15,16,17-dodecahydro-cyclopenta[a]phenanthren-3-one	IC50	0.2 nM
CHEMBL2311179	IC50	0.2 nM
CHEMBL3402224	EC50	0.24 nM
CHEMBL3233071	EC50	0.25 nM
CHEMBL3402228	EC50	0.25 nM
Propionic acid 10,13-dimethyl-3-oxo-2,3,6,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-17-yl ester	KI	0.25 nM
ACP-105	EC50	0.251 nM
CHEMBL3819080	EC50	0.251 nM
CHEMBL3819303	EC50	0.251 nM
CHEMBL3233070	EC50	0.28 nM
CHEMBL4060271	EC50	0.29 nM
CHEMBL4092535	EC50	0.29 nM
(1R,2S,10S,11S,14S,15S,17S)-1-fluoro-14,17-dihydroxy-2,14,15-trimethyltetracyclo[8.7.0.0^{2,7}.0^{11,15}]heptadec-6-en-5-one	EC50	0.3 nM
(2R)-3-bromo-2-hydroxy-2-methyl-N-[4-nitro-3-(trifluoromethyl)phenyl]propanamide	KI	0.3 nM
oxazolidin-2-imine, 6b	KI	0.3 nM
oxazolidin-2-imine, 6f	KI	0.3 nM
CHEMBL3326466	EC50	0.3 nM
(9R,10S,11S,13S,17S)-9-Fluoro-11,17-dihydroxy-10,13,17-trimethyl-1,2,6,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-cyclopenta[a]phenanthren-3-one	EC50	0.3 nM
CHEMBL3402229	EC50	0.32 nM
CHEMBL4068946	IC50	0.32 nM
CHEMBL3238280	EC50	0.34 nM
CHEMBL4095883	EC50	0.34 nM
CHEMBL5193931	EC50	0.34 nM
CHEMBL4100995	EC50	0.39 nM

ChEMBL bioactivities

5359 potent at pChembl≥5 of 5556 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
11.00	Ki	0.01	nM	CHEMBL180681
10.89	EC50	0.013	nM	METRIBOLONE
10.70	IC50	0.02	nM	CHEMBL391548
10.50	EC50	0.03162	nM	CHEMBL3818706
10.41	EC50	0.039	nM	CHEMBL3238292
10.40	EC50	0.0398	nM	CHEMBL3765171
10.30	IC50	0.05	nM	STANOLONE
10.30	EC50	0.05	nM	STANOLONE
10.22	EC50	0.06	nM	CHEMBL3238291
10.13	EC50	0.074	nM	CHEMBL3238288
10.00	EC50	0.1	nM	CHEMBL2323490
10.00	IC50	0.1	nM	CHEMBL184313
10.00	EC50	0.1	nM	CHEMBL4879244
10.00	EC50	0.1	nM	STANOLONE
10.00	EC50	0.1	nM	RAD-140
9.96	EC50	0.11	nM	CHEMBL3233072
9.96	EC50	0.11	nM	METRIBOLONE
9.89	EC50	0.13	nM	STANOLONE
9.85	EC50	0.14	nM	INDOMETHACIN
9.85	EC50	0.14	nM	CHEMBL2323511
9.85	EC50	0.14	nM	CHEMBL3238292
9.85	EC50	0.14	nM	CHEMBL4095364
9.85	EC50	0.14	nM	STANOLONE
9.82	EC50	0.15	nM	CHEMBL2323507
9.82	EC50	0.15	nM	CHEMBL3238287
9.80	EC50	0.16	nM	CHEMBL3326461
9.80	EC50	0.1585	nM	CHEMBL3819048
9.77	EC50	0.17	nM	CHEMBL4074555
9.74	EC50	0.18	nM	STANOLONE
9.72	EC50	0.19	nM	CHEMBL3402221
9.72	IC50	0.19	nM	CHEMBL4090028
9.72	EC50	0.19	nM	CHEMBL4090028
9.70	IC50	0.2	nM	CHEMBL2311179
9.70	IC50	0.2	nM	CHEMBL189306
9.70	EC50	0.1995	nM	CHEMBL3818497
9.70	EC50	0.1995	nM	CHEMBL3818619
9.70	EC50	0.1995	nM	CHEMBL3819648
9.70	Ki	0.2	nM	STANOLONE
9.70	EC50	0.2	nM	CHEMBL436784
9.70	IC50	0.2	nM	CHEMBL4060271
9.70	EC50	0.2	nM	CHEMBL440980
9.70	IC50	0.2	nM	CHEMBL256769
9.70	IC50	0.2	nM	CHEMBL427898
9.70	EC50	0.2	nM	CHEMBL4747369
9.70	EC50	0.2	nM	CHEMBL484726
9.70	IC50	0.2	nM	CHEMBL391548
9.70	Ki	0.2	nM	CHEMBL484727
9.62	EC50	0.24	nM	CHEMBL3402224
9.60	EC50	0.25	nM	CHEMBL3233071
9.60	EC50	0.25	nM	CHEMBL3402228

PubChem BioAssay actives

1846 with measured affinity, of 6100 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(11S,13S,17S)-17-hydroxy-13-methyl-11-pentyl-2,6,7,8,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-one	242094: Inhibition of AR-dimerization in CHO-K1 cells expressing human androgen receptor	ic50	<0.0001	uM
4-(1-cyclopropyl-2,2,2-trifluoro-1-hydroxyethyl)-3-methyl-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	<0.0001	uM
(5S,8R,9S,10S,13S,14S,17S)-17-hydroxy-10,13-dimethyl-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-one	1187582: Agonist activity at human androgen receptor expressed in mouse C2C12 cells by androgen-specific response element-driven luciferase reporter gene assay	ec50	0.0001	uM
5-(2,6-difluoro-4-hydroxyphenyl)-1-methylpyrrole-2-carbonitrile	1457899: Agonist activity at human androgen receptor expressed in African green monkey CV-1 cells after 17 hrs by ARE luciferase reporter gene assay	ec50	0.0001	uM
N-[3-(3-chloro-4-cyanophenoxy)-2,2,4,4-tetramethylcyclobutyl]-4-[4-[4-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperazin-1-yl]piperidin-1-yl]benzamide	1784623: Protac activity at CRBN/AR in human VCaP cells assessed as induction of AR degradation measured after 24 hrs by western blot analysis	ec50	0.0001	uM
4-[[(1R,7S,7aS)-7-hydroxy-1-(trifluoromethyl)-5,6,7,7a-tetrahydro-1H-pyrrolo[1,2-c][1,3]oxazol-3-ylidene]amino]-2-chloro-3-methylbenzonitrile	1885023: Agonist activity at human Androgen receptor	ec50	0.0002	uM
6-[bis(2,2,2-trifluoroethyl)amino]-4-(trifluoromethyl)-1H-quinolin-2-one	1872308: Modulation of Androgen receptor (unknown origin)	ec50	0.0002	uM
(8S,13S,14S,17S)-17-hydroxy-13-methyl-2,6,7,8,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-one	242138: Inhibition of human androgen receptor expressed in Escherichia coli	ic50	0.0002	uM
4-(1-cyclopropyl-2,2,2-trifluoro-1-hydroxyethyl)-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0002	uM
4-(1-cyclobutyl-2,2,2-trifluoro-1-hydroxyethyl)-3-methyl-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0002	uM
2-chloro-4-(1-cyclopropyl-2,2,2-trifluoro-1-hydroxyethyl)-3-methylbenzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0002	uM
2,3-dichloro-4-(1-cyclopropyl-2,2,2-trifluoro-1-hydroxyethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0002	uM
5-(2,6-dichloro-4-hydroxyphenyl)-1-methylpyrrole-2-carbonitrile	1457899: Agonist activity at human androgen receptor expressed in African green monkey CV-1 cells after 17 hrs by ARE luciferase reporter gene assay	ec50	0.0002	uM
N-[3-(3-chloro-4-cyanophenoxy)-2,2,4,4-tetramethylcyclobutyl]-4-[4-[[1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]azetidin-3-yl]methyl]piperazin-1-yl]benzamide	1784623: Protac activity at CRBN/AR in human VCaP cells assessed as induction of AR degradation measured after 24 hrs by western blot analysis	ec50	0.0002	uM
(9R,10S,11S,13S,17S)-9-fluoro-11,17-dihydroxy-10,13,17-trimethyl-1,2,6,7,8,11,12,14,15,16-decahydrocyclopenta[a]phenanthren-3-one	38803: Agonist activity against Human Androgen receptor expressed in CV-1 cells	ec50	0.0003	uM
4-[[(1R,7R,7aS)-7-hydroxy-1-(trifluoromethyl)-5,6,7,7a-tetrahydro-1H-pyrrolo[1,2-c][1,3]oxazol-3-ylidene]amino]-2-chloro-3-methylbenzonitrile	1798994: Receptor Binding Assay (Ki) and Transactivation Assay (EC50) from Article 10.1021/jm801583j: “N-aryl-oxazolidin-2-imine muscle selective androgen receptor modulators enhance potency through pharmacophore reorientation.”	ki	0.0003	uM
2-chloro-4-[(1R,5S)-3-hydroxy-3-methyl-8-azabicyclo[3.2.1]octan-8-yl]-3-methylbenzonitrile	445841: Agonist activity at androgen receptor in human MDA-KB2 cells transfected with MMTV linked luciferase assessed as transcriptional activation by luciferase reporter gene assay	ec50	0.0003	uM
3-methyl-4-(1,1,1-trifluoro-2-hydroxy-3-methylbutan-2-yl)-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0003	uM
3-methyl-4-[2,2,2-trifluoro-1-(furan-2-yl)-1-hydroxyethyl]-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0003	uM
5-(2-fluoro-4-hydroxyphenyl)-1-methylpyrrole-2-carbonitrile	1457899: Agonist activity at human androgen receptor expressed in African green monkey CV-1 cells after 17 hrs by ARE luciferase reporter gene assay	ec50	0.0003	uM
N-[3-(3-chloro-4-cyanophenoxy)-2,2,4,4-tetramethylcyclobutyl]-4-[4-[[1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperidin-4-yl]methyl]piperazin-1-yl]benzamide	1784623: Protac activity at CRBN/AR in human VCaP cells assessed as induction of AR degradation measured after 24 hrs by western blot analysis	ec50	0.0003	uM
5-(2-fluoro-4-hydroxyphenyl)-1H-pyrrole-2-carbonitrile	1885054: Agonist activity at human Androgen receptor expressed in African green monkey CV-1 cells measured by ARE-luciferase assay	ec50	0.0003	uM
4-[(3aS,4R)-4-hydroxy-1,1,3-trioxo-3a,4,5,6-tetrahydropyrrolo[1,2-b][1,2,5]thiadiazol-2-yl]-2-chloro-3-methylbenzonitrile	1885049: Displacement of [3H]DHT from Androgen receptor expressed in human MDA-MB-453 cells	ki	0.0004	uM
2-chloro-4-(1-cyclopropyl-2,2,2-trifluoro-1-hydroxyethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0004	uM
N-[3-(3-chloro-4-cyanophenoxy)-2,2,4,4-tetramethylcyclobutyl]-4-[4-[[4-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperazin-1-yl]methyl]piperidin-1-yl]benzamide	1784623: Protac activity at CRBN/AR in human VCaP cells assessed as induction of AR degradation measured after 24 hrs by western blot analysis	ec50	0.0004	uM
2-chloro-4-[(7S,8R)-7-hydroxy-1-methyl-3-oxo-5,6,7,8-tetrahydropyrrolizin-2-yl]-3-methylbenzonitrile	1797702: Receptor Binding and Transactivation Assay from Article 10.1021/jm070312d: “Discovery of Potent and Muscle Selective Androgen Receptor Modulators through Scaffold Modifications.”	ki	0.0005	uM
3-methyl-4-[2,2,2-trifluoro-1-hydroxy-1-(1,3-oxazol-4-yl)ethyl]-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0005	uM
(2S)-3-(4-cyanophenoxy)-N-[4-cyano-3-(trifluoromethyl)phenyl]-2-hydroxy-2-methylpropanamide	1885044: Displacement of [3H]mibolerone from Androgen receptor (unknown origin) measured by liquid scintillation counting method	ki	0.0006	uM
(1S,3aS,3bS,5aR,9aS,9bS,11aS)-8-fluoro-N-(1H-imidazo[4,5-b]pyridin-2-ylmethyl)-6,9a,11a-trimethyl-7-oxo-2,3,3a,3b,4,5,5a,9b,10,11-decahydro-1H-indeno[5,4-f]quinoline-1-carboxamide	1872309: Modulation of human Androgen receptor transfected in African green monkey COS cells	ec50	0.0006	uM
2,3-dichloro-4-(1-cyclobutyl-2,2,2-trifluoro-1-hydroxyethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0006	uM
2-chloro-4-[(3S)-8-[4-[4-[1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]azetidin-3-yl]piperazine-1-carbonyl]phenyl]-3-methyl-2,8-diazaspiro[4.5]decan-2-yl]benzonitrile	1982086: Induction of androgen receptor degradation in human VCaP cells incubated for 24 hrs by Western blot analysis	ec50	0.0006	uM
4-[(1S,7R,7aR)-1-ethyl-7-hydroxy-3-oxo-5,6,7,7a-tetrahydro-1H-pyrrolo[1,2-c]imidazol-2-yl]-2-chloro-3-methylbenzonitrile	1797702: Receptor Binding and Transactivation Assay from Article 10.1021/jm070312d: “Discovery of Potent and Muscle Selective Androgen Receptor Modulators through Scaffold Modifications.”	ki	0.0007	uM
6-[cyclopropylmethyl(propyl)amino]-4-(trifluoromethyl)pyridine-3-carbonitrile	309346: Displacement of [3H]dihydrotestosterone from human androgen receptor expressed in Sf9 cells	ic50	0.0008	uM
2-chloro-3-methyl-4-(1,1,1-trifluoro-2-hydroxy-3-methylbutan-2-yl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0008	uM
2,3-dichloro-4-(1,1,1-trifluoro-2-hydroxy-3-methylbutan-2-yl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0008	uM
(2S,4R)-N-[(1S)-3-[4-[4-[2-[4-[[3-(3-chloro-4-cyanophenoxy)-2,2,4,4-tetramethylcyclobutyl]carbamoyl]phenyl]ethynyl]piperidin-1-yl]piperidin-1-yl]-1-[4-(4-methyl-1,3-thiazol-5-yl)phenyl]-3-oxopropyl]-1-[(2S)-2-[(1-fluorocyclopropanecarbonyl)amino]-3,3-dimethylbutanoyl]-4-hydroxypyrrolidine-2-carboxamide	1960582: Protac activity at VHL/AR in human VCaP cells assessed as induction of protein degradation measured after 24 hrs by Western blot analysis	ec50	0.0008	uM
N-[3-(3-chloro-4-cyanophenoxy)-2,2,4,4-tetramethylcyclobutyl]-4-[4-[1-[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-5-yl]piperidin-4-yl]piperazin-1-yl]benzamide	1784623: Protac activity at CRBN/AR in human VCaP cells assessed as induction of AR degradation measured after 24 hrs by western blot analysis	ec50	0.0008	uM
4-[(1S,7S,7aR)-1-ethyl-7-hydroxy-3-oxo-5,6,7,7a-tetrahydro-1H-pyrrolo[1,2-c]imidazol-2-yl]-2-chloro-3-methylbenzonitrile	1797702: Receptor Binding and Transactivation Assay from Article 10.1021/jm070312d: “Discovery of Potent and Muscle Selective Androgen Receptor Modulators through Scaffold Modifications.”	ki	0.0009	uM
4-[(1R,7S,7aR)-7-hydroxy-3-oxo-1-(trifluoromethyl)-5,6,7,7a-tetrahydro-1H-pyrrolo[1,2-c]imidazol-2-yl]-2-chloro-3-methylbenzonitrile	1797702: Receptor Binding and Transactivation Assay from Article 10.1021/jm070312d: “Discovery of Potent and Muscle Selective Androgen Receptor Modulators through Scaffold Modifications.”	ki	0.0009	uM
4-[(4S)-4-(4-hydroxyphenyl)-4-methyl-2,5-dioxoimidazolidin-1-yl]-2-(trifluoromethyl)benzonitrile	1885053: Partial agonist activity at human Androgen receptor	ic50	0.0009	uM
4-(trifluoromethyl)-6,7,8,9-tetrahydropyrano[3,2-g]quinolin-2-one	38985: In vitro binding affinity at human androgen receptor transfected into COS cells.	ic50	0.0010	uM
2-chloro-4-(3-hydroxy-3-methyl-8-azabicyclo[3.2.1]octan-8-yl)-3-methylbenzonitrile	1885021: Binding affinity to human Androgen receptor	ic50	0.0010	uM
N-[(3aR,4R,5R,7S,7aS)-2-[4-cyano-3-(trifluoromethyl)phenyl]-4,7-dimethyl-1,3-dioxo-3a,5,6,7a-tetrahydro-4,7-epoxyisoindol-5-yl]benzenesulfonamide	1249995: Antagonist activity at androgen receptor in human MDA-MB-453 cells assessed as inhibition of DHT-induced PSA expression by alkaline phosphatase reporter gene assay	ic50	0.0010	uM
N-[(3aR,4R,5R,7S,7aS)-2-[4-cyano-3-(trifluoromethyl)phenyl]-4,7-dimethyl-1,3-dioxo-3a,5,6,7a-tetrahydro-4,7-epoxyisoindol-5-yl]-2-fluorobenzenesulfonamide	1249994: Displacement of [3H]-DHT from androgen receptor in human MDA-MB-453 cells after 90 mins by TopCount analysis	ki	0.0010	uM
N-[4-(3-chloro-4-cyanophenoxy)cyclohexyl]-6-[4-[[4-[2-(2,6-dioxopiperidin-3-yl)-6-fluoro-1,3-dioxoisoindol-5-yl]piperazin-1-yl]methyl]piperidin-1-yl]pyridazine-3-carboxamide	1872331: Protac activity at CRBN/AR in human castration-resistant prostate cancer cells assessed as induction of androgen receptor degradation	ec50	0.0010	uM
4-[(1R,7R,7aR)-7-hydroxy-3-oxo-1-(trifluoromethyl)-5,6,7,7a-tetrahydro-1H-pyrrolo[1,2-c]imidazol-2-yl]-2-chloro-3-methylbenzonitrile	1797702: Receptor Binding and Transactivation Assay from Article 10.1021/jm070312d: “Discovery of Potent and Muscle Selective Androgen Receptor Modulators through Scaffold Modifications.”	ki	0.0010	uM
tert-butyl 2,5-dioxo-4-(trifluoromethyl)-1H-chromeno[3,4-f]quinoline-10-carboxylate	1885023: Agonist activity at human Androgen receptor	ec50	0.0011	uM
4-[2,2,2-trifluoro-1-hydroxy-1-(1,3-oxazol-4-yl)ethyl]-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0013	uM
4-[2,2,2-trifluoro-1-(furan-2-yl)-1-hydroxyethyl]-2-(trifluoromethyl)benzonitrile	1307766: Modulation of human androgen receptor expressed in African green monkey CV1 cells after 24 hrs by luciferase reporter gene assay	ec50	0.0013	uM
(4Z)-3-(2-fluorophenyl)-4-[(4-pyrrolidin-1-ylphenyl)methylidene]-1,2-oxazol-5-one	39000: Dissociation constant against GST-hARLBD was measured in SC-3 cell by using [3H]testosterone as radioligand	kd	0.0014	uM

CTD chemical–gene interactions

772 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Dihydrotestosterone	affects reaction, increases phosphorylation, increases stability, increases response to substance, affects cotreatment (+12 more)	137
Metribolone	increases folding, decreases activity, affects reaction, increases secretion, decreases expression (+11 more)	51
bicalutamide	decreases activity, decreases reaction, affects cotreatment, increases phosphorylation, decreases response to substance (+13 more)	49
Flutamide	decreases reaction, increases activity, affects binding, affects cotreatment, increases abundance (+3 more)	42
bisphenol A	decreases activity, decreases response to substance, increases expression, decreases expression, increases reaction (+9 more)	41
Testosterone	affects binding, affects abundance, decreases activity, decreases reaction, increases activity (+10 more)	39
Estradiol	decreases expression, affects binding, increases localization, affects reaction, affects cotreatment (+6 more)	31
vinclozolin	decreases reaction, increases activity, decreases activity, increases phosphorylation, affects reaction (+4 more)	30
hydroxyflutamide	increases activity, affects activity, affects cotreatment, decreases reaction, decreases expression (+7 more)	24
Dichlorodiphenyl Dichloroethylene	affects cotreatment, decreases reaction, increases activity, affects reaction, increases expression (+6 more)	23
Cyproterone Acetate	increases expression, affects localization, affects reaction, decreases activity, affects cotreatment (+7 more)	17
Methoxychlor	decreases activity, affects cotreatment, decreases reaction, increases activity, affects reaction (+2 more)	15
Benzo(a)pyrene	affects activity, affects methylation, affects binding, decreases activity, decreases expression (+4 more)	13
o,p’-DDT	decreases reaction, increases activity, affects binding, decreases activity, affects cotreatment (+1 more)	12
mibolerone	increases localization, increases phosphorylation, affects reaction, affects cotreatment, increases activity (+5 more)	11
enzalutamide	decreases activity, decreases localization, decreases reaction, decreases expression, affects localization (+7 more)	11
Linuron	affects cotreatment, increases expression, decreases reaction, increases activity, affects activity (+2 more)	11
2,2-bis(4-hydroxyphenyl)-1,1,1-trichloroethane	decreases activity, affects cotreatment, decreases reaction, increases activity, affects binding	10
Progesterone	increases activity, decreases reaction, decreases expression, affects activity, affects binding (+1 more)	10
procymidone	decreases reaction, increases activity, affects cotreatment, affects binding, increases expression (+1 more)	9
prochloraz	increases activity, affects binding, decreases activity, decreases reaction, affects cotreatment (+3 more)	9
DDT	affects cotreatment, decreases reaction, affects binding, increases activity, affects localization (+4 more)	9
nilutamide	increases activity, affects binding, affects localization, increases expression, increases response to substance (+3 more)	8
bisphenol AF	decreases activity, affects folding, decreases response to substance, affects cotreatment, increases activity (+4 more)	8
Resveratrol	decreases reaction, increases activity, increases reaction, decreases activity, increases expression (+4 more)	8
Fenitrothion	decreases activity, affects cotreatment, increases expression, decreases reaction, increases activity (+1 more)	8
Quercetin	affects reaction, increases expression, decreases reaction, decreases expression, decreases methylation (+8 more)	8
4,4’-bisphenol F	increases activity, increases expression, decreases activity, affects binding, decreases reaction	7
pentabrominated diphenyl ether 100	decreases activity, decreases reaction, increases activity, increases reaction, affects binding	7
Dibutyl Phthalate	decreases activity, decreases expression, decreases localization, affects binding, affects cotreatment (+2 more)	7

ChEMBL screening assays

2100 unique, capped per target: 1727 binding, 339 functional, 33 admet, 1 unclassified

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1013140	Binding	Displacement of [3H]testosterone from wild type human androgen receptor	4-(Anilino)pyrrole-2-carboxamides: Novel non-steroidal/non-anilide type androgen antagonists effective upon human prostate tumor LNCaP cells with mutated nuclear androgen receptor. — *Bioorg Med Chem*
CHEMBL1013144	Functional	Antagonist activity at wild type human recombinant androgen receptor assessed as inhibition of testosterone-induced growth of mouse androgen dependent SC3 cells by WST-1 method	4-(Anilino)pyrrole-2-carboxamides: Novel non-steroidal/non-anilide type androgen antagonists effective upon human prostate tumor LNCaP cells with mutated nuclear androgen receptor. — *Bioorg Med Chem*
CHEMBL3243253	ADMET	Binding affinity to human AR NTD (1 to 561 aa) expressed in CV1 cells coexpressing human AR-LBD (644-919 aa) assessed as N/C-termini interaction by androgenic assay	1-(2-Hydroxy-2-methyl-3-phenoxypropanoyl)indoline-4-carbonitrile derivatives as potent and tissue selective androgen receptor modulators. — *J Med Chem*

Cellosaurus cell lines

146 cell lines: 112 cancer cell line, 18 induced pluripotent stem cell, 7 transformed cell line, 6 embryonic stem cell, 3 spontaneously immortalized cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0046	HTh83	Cancer cell line	Male
CVCL_0395	LNCaP	Cancer cell line	Male
CVCL_0418	MDA-MB-453	Cancer cell line	Female
CVCL_1379	LNCaP clone FGC	Cancer cell line	Male
CVCL_2821	4-11	Cancer cell line	Female
CVCL_3872	LNCaP-CL1	Cancer cell line	Male
CVCL_3967	CWR22	Cancer cell line	Male
CVCL_4782	LNCaP C4-2	Cancer cell line	Male
CVCL_4783	LNCaP C4	Cancer cell line	Male
CVCL_4784	LNCaP C4-2B	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 302 trials:

NCT	Phase	Status	Title
NCT00851461	Phase 4	COMPLETED	Effect of Goserelin (Zoladex®) in Spinal and Bulbar Muscular Atrophy
NCT00190697	Phase 4	COMPLETED	A Study of LY353381 (Arzoxifene) for Patients Who Benefitted From This Drug in Other Oncology Trials and Wished to Continue Treatment
NCT00277160	Phase 4	COMPLETED	A Study of Primary Prophylaxis With Neulasta (Pegfilgrastim) Versus Secondary Prophylaxis After Chemotherapy in Elderly Subjects (>/= 65 Years Old) With Cancer
NCT00727961	Phase 4	COMPLETED	A Study to Evaluate Efficacy and Tolerance of Caelyx in Patients With Epithelial Ovarian Cancer. (Study P04072)(COMPLETED)
NCT00740116	Phase 4	COMPLETED	Tranexamic Acid in Surgery of Advanced Ovarian Cancer
NCT00817479	Phase 4	COMPLETED	Tumor Gene Expression in Women With Ovarian Cancer
NCT01432015	Phase 4	COMPLETED	Fosaprepitant Versus Aprepitant in the Prevention of Chemotherapy Induced Nausea and Vomiting
NCT01706120	Phase 4	UNKNOWN	Study of Clinical and Biological Prognostic Factors in Patients With Ovarian Cancer Receiving Carboplatin +Paclitaxel With Bevacizumab
NCT01932125	Phase 4	COMPLETED	An Interventional Study of Avastin (Bevacizumab) in Patients With Advanced/Metastatic Epithelial Ovarian Cancer, Fallopian Tube Cancer or Primary Peritoneal Cancer
NCT01953107	Phase 4	COMPLETED	Oral Iron vs. Placebo in Newly Diagnosed Gynecologic Oncology Patients Who Are Surgical Candidates.
NCT02035345	Phase 4	TERMINATED	Slowed Carboplatin Infusion for Ovarian Cancer Patients Receiving Carboplatin Re-Treatment
NCT02243059	Phase 4	WITHDRAWN	Magnetic Resonance Imaging for Lymph Node Staging in Ovarian Cancer
NCT03164980	Phase 4	TERMINATED	QoL-Comparison Between Trabectedin/PLD and Pt-based Therapy in Patients With Pt-sensitive Recurrent Ovarian Cancer
NCT03384511	Phase 4	COMPLETED	The Use of 18F-ALF-NOTA-PRGD2 PET/CT Scan to Predict the Efficacy and Adverse Events of Apatinib in Malignancies.
NCT03543462	Phase 4	COMPLETED	Diaphragmatic Resection And Gynecological Ovarian Neoplasm
NCT03752216	Phase 4	COMPLETED	NIraparib and Quality of LifE is a Longitudinal Study Evaluating in Real Life the Tolerability of Niraparib.
NCT03858166	Phase 4	TERMINATED	Efficacy and Safety of PEG-rhG-CSF Secondary Prophylaxis vs. Therapeutic Administration in Patients With Ovarian Cancer
NCT04024254	Phase 4	COMPLETED	A Study of Serum Folate Levels in Patients Treated With Olaparib
NCT04330040	Phase 4	COMPLETED	Prospective Multicentre Phase-IV Clinical Trial of Olaparib in Indian Patients With Ovarian and Metastatic Breast Cancer
NCT04352439	Phase 4	COMPLETED	Aspirin for Prevention of Venous Thromboembolism Among Ovarian Cancer Patients Receiving Neoadjuvant Chemotherapy
NCT05187208	Phase 4	UNKNOWN	PARP Inhibitor Oral Maintenance in Low-Risk Ovarian Cancer
NCT05606692	Phase 4	RECRUITING	Influences of Propofol and Sevoflurane Anesthesia in Ovarian Cancer (Anesthetics)
NCT05926336	Phase 4	UNKNOWN	The Effects of Using Different Anesthetics on the Prognosis of Primary Tumors and Its Mechanism of Action
NCT06412120	Phase 4	RECRUITING	Study Evaluating Safety, Tolerability, and Metabolism of Niraparib
NCT06871787	Phase 4	NOT_YET_RECRUITING	Near-Infrared Fluorescence Imaging With Indocyanine Green to Evaluate Bowel Anastomoses in Gynecologic Oncology Surgery
NCT06887933	Phase 4	NOT_YET_RECRUITING	A Trial to Evaluate the Safety of Niraparib Tablets in Adult Female Participants With Advanced or Relapsed Epithelial Ovarian Cancer
NCT07469202	Phase 4	NOT_YET_RECRUITING	CYTALUX Dose Extension Study
NCT04422366	Phase 3	RECRUITING	Evaluate the Efficacy, Immunogenicity and Safety of 9-valent HPV Recombinant Vaccine in Chinese Healthy Females
NCT04425291	Phase 3	COMPLETED	Evaluate the Immunogenicity and Safety of 4-valent and 9-valent HPV Recombinant Vaccine in Chinese Healthy Females
NCT04895020	Phase 3	UNKNOWN	Immunobridging Study of 9-valent Human Papillomavirus Recombinant Vaccine in Chinese Females Aged 9 to 19 Years
NCT05372016	Phase 3	COMPLETED	Evaluate the Immunogenicity and Safety of 9-valent HPV Recombinant Vaccine in Chinese Healthy Females
NCT05584332	Phase 3	TERMINATED	A Phase Ⅲ Study to Evaluate the Efficacy, Immunogenicity, Safety of Quadrivalent HPV Recombinant Vaccine in Chinese Healthy Females
NCT07520565	Phase 3	RECRUITING	A Multicentre, Randomised, Double-blind, Placebo-parallel Controlled Phase Ⅲ Clinical Trial Evaluating the Efficacy and Safety of BXOS110 Injection in the Treatment of Acute Ischaemic Stroke Within 3 Hours of Onset.
NCT00001806	Phase 3	COMPLETED	Methods in Education for Breast Cancer Genetics
NCT00002477	Phase 3	UNKNOWN	Adjuvant Chemotherapy Compared With Observation in Treating Patients With Resected Early Stage Ovarian Epithelial Cancer
NCT00002568	Phase 3	COMPLETED	Combination Chemotherapy With or Without Surgery in Treating Patients With Stage III Ovarian Epithelial Cancer
NCT00002641	Phase 3	COMPLETED	Surgery With or Without Chemotherapy in Treating Patients With Soft Tissue Sarcoma
NCT00002717	Phase 3	COMPLETED	Paclitaxel and Cisplatin in Treating Patients With Stage III or Stage IV Ovarian Cancer or Primary Peritoneal Cancer
NCT00002764	Phase 3	COMPLETED	Surgery With or Without Combination Chemotherapy in Treating Patients With Lung Metastases From Soft Tissue Sarcoma
NCT00002819	Phase 3	TERMINATED	Chemotherapy With or Without Peripheral Stem Cell Transplantation in Treating Patients With Persistent Ovarian Epithelial Cancer
NCT00002894	Phase 3	COMPLETED	Platinum-based Chemotherapy With or Without Paclitaxel in Treating Patients With Relapsed Ovarian Cancer
NCT00002895	Phase 3	COMPLETED	Early Chemotherapy Based on CA 125 Level Alone Compared With Delayed Chemotherapy in Treating Patients With Recurrent Ovarian Epithelial , Fallopian Tube, or Primary Peritoneal Cancer
NCT00003120	Phase 3	COMPLETED	S9701 Paclitaxel in Treating Patients With Advanced Ovarian, Fallopian Tube, or Primary Peritoneal Cancer in Remission
NCT00003214	Phase 3	COMPLETED	Chemosensitivity Testing to Assign Treatment for Patients With Stage III or Stage IV Ovarian Cancer
NCT00003322	Phase 3	COMPLETED	Combination Chemotherapy in Treating Patients With Primary Peritoneal or Stage III Epithelial Ovarian Cancer
NCT00003636	Phase 3	COMPLETED	Chemotherapy Plus Surgery in Treating Patients With Stage III or Stage IV Ovarian, Peritoneal, or Fallopian Tube Cancer
NCT00003644	Phase 3	COMPLETED	Carboplatin Plus Paclitaxel With or Without Continued Low-Dose Paclitaxel in Treating Patients With Early-Stage Ovarian Cancer
NCT00003695	Phase 3	COMPLETED	Chemotherapy With or Without Surgery in Treating Patients With Stage II or Stage III Ovarian Cancer
NCT00003998	Phase 3	COMPLETED	Carboplatin Plus Paclitaxel or Docetaxel in Treating Patients With Ovarian Epithelial Cancer
NCT00004115	Phase 3	UNKNOWN	Monoclonal Antibody Therapy in Treating Patients With Ovarian Cancer or Primary Peritoneal Cancer in Remission Following Surgery and Chemotherapy
NCT00004166	Phase 3	COMPLETED	Amifostine in Treating Patients With Ovarian Epithelial Cancer Who Are Receiving Chemotherapy
NCT00004921	Phase 3	COMPLETED	High-Dose Chemotherapy Compared With Standard Chemotherapy in Treating Patients With Stage III or Stage IV Ovarian Epithelial Cancer That Has Been Removed During Surgery
NCT00004934	Phase 3	COMPLETED	Paclitaxel and Carboplatin With or Without Epirubicin in Treating Patients With Stage IIB, Stage III, or Stage IV Invasive Ovarian Epithelial, Fallopian Tube, or Peritoneal Cancer
NCT00005590	Phase 3	COMPLETED	Levofloxacin to Prevent Infection Following Chemotherapy in Treating Patients With Solid Tumors or Lymphoma
NCT00006356	Phase 3	TERMINATED	Chemotherapy With or Without Surgery in Treating Patients With Recurrent Ovarian Cancer
NCT00006453	Phase 3	COMPLETED	Carboplatin With or Without Gemcitabine in Treating Patients With Advanced Ovarian Epithelial Cancer That Has Not Responded to Previous Chemotherapy
NCT00006454	Phase 3	COMPLETED	Paclitaxel Plus Carboplatin With or Without Topotecan in Treating Patients With Stage IIB, Stage III, or Stage IV Ovarian Epithelial Cancer
NCT00011986	Phase 3	COMPLETED	Combination Chemotherapy in Treating Patients With Stage III or Stage IV Ovarian Epithelial Cancer or Primary Peritoneal Cancer
NCT00028743	Phase 3	COMPLETED	Combination Chemotherapy Regimens in Ovarian Epithelial Cancer, Primary Peritoneal Cancer, or Fallopian Tube Cancer
NCT00033605	Phase 3	COMPLETED	Octreotide in Preventing Diarrhea in Patients Who Are Undergoing Radiation Therapy to the Pelvis

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for AR across ~30M SureChEMBL compounds — explore on Sugi Predict.