ARHGEF9

Summary

ARHGEF9 (Cdc42 guanine nucleotide exchange factor 9, HGNC:14561) is a protein-coding gene on chromosome Xq11.1, encoding Rho guanine nucleotide exchange factor 9 (O43307). Acts as a guanine nucleotide exchange factor (GEF) for CDC42. It is haploinsufficient (ClinGen: sufficient evidence).

The protein encoded by this gene is a Rho-like GTPase that switches between the active (GTP-bound) state and inactive (GDP-bound) state to regulate CDC42 and other genes. This brain-specific protein also acts as an adaptor protein for the recruitment of gephyrin and together these proteins facilitate receceptor recruitement in GABAnergic and glycinergic synapses. Defects in this gene are the cause of startle disease with epilepsy (STHEE), also known as hyperekplexia with epilepsy, as well as several other types of cognitive disability. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 23229 — RefSeq curated summary.

At a glance

• Gene–disease (curated): X-linked complex neurodevelopmental disorder (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 1
• Clinical variants (ClinVar): 577 total — 31 pathogenic, 20 likely-pathogenic
• Phenotypes (HPO): 20
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• MANE Select transcript: NM_001353921

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:14561
Approved symbol	ARHGEF9
Name	Cdc42 guanine nucleotide exchange factor 9
Location	Xq11.1
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0424, PEM-2
Ensembl gene	ENSG00000131089
Ensembl biotype	protein_coding
OMIM	300429
Entrez	23229

Gene structure

Transcript identifiers

Ensembl transcripts: 48 — 37 protein_coding, 5 protein_coding_CDS_not_defined, 4 nonsense_mediated_decay, 2 retained_intron

ENST00000253401, ENST00000374870, ENST00000374872, ENST00000374878, ENST00000437457, ENST00000466925, ENST00000495564, ENST00000498761, ENST00000623417, ENST00000623517, ENST00000623566, ENST00000623951, ENST00000624210, ENST00000624355, ENST00000624387, ENST00000624538, ENST00000624783, ENST00000624843, ENST00000625116, ENST00000635729, ENST00000635967, ENST00000636048, ENST00000636102, ENST00000636145, ENST00000636276, ENST00000636392, ENST00000636539, ENST00000636926, ENST00000637040, ENST00000637178, ENST00000637391, ENST00000637417, ENST00000637520, ENST00000637557, ENST00000637723, ENST00000637855, ENST00000638021, ENST00000639092, ENST00000671741, ENST00000671907, ENST00000672194, ENST00000672467, ENST00000672513, ENST00000922913, ENST00000922914, ENST00000922915, ENST00000922916, ENST00000943364

RefSeq mRNA: 27 — MANE Select: NM_001353921 NM_001173479, NM_001173480, NM_001330495, NM_001353921, NM_001353922, NM_001353923, NM_001353924, NM_001353926, NM_001353927, NM_001353928, NM_001369030, NM_001369031, NM_001369032, NM_001369033, NM_001369034, NM_001369035, NM_001369036, NM_001369037, NM_001369038, NM_001369039, NM_001369040, NM_001369041, NM_001369042, NM_001369043, NM_001369044, NM_001369045, NM_015185

CCDS: CCDS35315, CCDS55429, CCDS55430, CCDS83477, CCDS87753, CCDS94618, CCDS94619

Canonical transcript exons

ENST00000671741 — 10 exons

Exon	Start	End
ENSE00001844608	63634967	63638209
ENSE00003481133	63724532	63724711
ENSE00003512222	63655494	63655737
ENSE00003576950	63674038	63674167
ENSE00003590334	63678340	63678572
ENSE00003611168	63643980	63644048
ENSE00003692041	63697125	63697304
ENSE00003755869	63706258	63706449
ENSE00003758605	63665886	63666017
ENSE00003894276	63785116	63785214

Expression profiles

Bgee: expression breadth ubiquitous, 264 present calls, max score 96.81.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 10.3661 / max 401.9012, expressed in 1521 samples.

FANTOM5 promoters (14 alternative TSS)

Promoter ID	TPM avg	Samples expressed
199465	4.7566	1370
199467	3.0583	470
199463	0.6376	202
199470	0.4100	195
199462	0.3692	122
199468	0.2772	157
199466	0.2151	83
199464	0.1917	78
199469	0.1452	77
199460	0.1011	54

Top tissues by expression

292 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
Brodmann (1909) area 46	UBERON:0006483	96.81	gold quality
prefrontal cortex	UBERON:0000451	96.00	gold quality
CA1 field of hippocampus	UBERON:0003881	95.90	gold quality
nucleus accumbens	UBERON:0001882	95.67	gold quality
lateral nuclear group of thalamus	UBERON:0002736	95.64	gold quality
parietal lobe	UBERON:0001872	95.63	gold quality
superior frontal gyrus	UBERON:0002661	95.62	gold quality
postcentral gyrus	UBERON:0002581	95.56	gold quality
cortical plate	UBERON:0005343	95.21	gold quality
frontal cortex	UBERON:0001870	95.18	gold quality
right frontal lobe	UBERON:0002810	95.14	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	95.08	gold quality
lateral globus pallidus	UBERON:0002476	94.88	gold quality
neocortex	UBERON:0001950	94.69	gold quality
Brodmann (1909) area 9	UBERON:0013540	94.69	gold quality
cerebral cortex	UBERON:0000956	94.54	gold quality
telencephalon	UBERON:0001893	94.42	gold quality
pons	UBERON:0000988	94.31	gold quality
caudate nucleus	UBERON:0001873	94.27	gold quality
orbitofrontal cortex	UBERON:0004167	94.17	gold quality
right coronary artery	UBERON:0001625	94.12	gold quality
Ammon’s horn	UBERON:0001954	94.11	gold quality
superior vestibular nucleus	UBERON:0007227	93.97	gold quality
putamen	UBERON:0001874	93.90	gold quality
right atrium auricular region	UBERON:0006631	93.85	gold quality
cingulate cortex	UBERON:0003027	93.81	gold quality
forebrain	UBERON:0001890	93.75	gold quality
cardiac atrium	UBERON:0002081	93.67	gold quality
hypothalamus	UBERON:0001898	93.65	gold quality
anterior cingulate cortex	UBERON:0009835	93.63	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.70

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

111 targeting ARHGEF9, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-12118	100.00	65.88	1270
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-6891-5P	99.98	66.53	1372
HSA-MIR-3173-3P	99.98	66.49	1217
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-9983-3P	99.94	71.48	3631
HSA-MIR-3682-5P	99.93	67.97	1163
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-3671	99.90	73.04	3897
HSA-MIR-548E-5P	99.89	72.73	4486
HSA-MIR-6783-3P	99.89	67.92	2059
HSA-MIR-1343-3P	99.89	66.78	1815
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-345-3P	99.89	70.23	1421
HSA-MIR-1321	99.84	65.30	1811

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 20)

• Here we identified residues critical for interaction with gephyrin in the linker region between the SH3 and the DH domains of collybistin. (PMID:11727829)
• translocates gephyrin to submembrane microaggregates; collybistin mutation (G55A)is found in exon 2 of the ARHGEF9 gene in a patient with clinical symptoms of both hyperekplexia and epilepsy (PMID:15215304)
• Results show that hPEM-2 is a target protein of Smurf1. (PMID:18208356)
• Study propose that the collybistin-gephyrin complex has an intimate role in the clustering of GABA(A)Rs containing the alpha2 subunit. (PMID:20622020)
• Data indicate that ARHGEF9 is likely to be responsible for syndromic X-linked mental retardation associated with epilepsy. (PMID:21633362)
• major regulator of GABAergic postsynaptic gephyrin clustering (PMID:21807943)
• These results reveal that G(s) and G(q) signalings regulate hPEM-2 functions through PKA and c-Src in Neuro-2a neuroblastoma cells, respectively. (PMID:22033413)
• Phosphorylation of gephyrin in hippocampal neurons by cyclin-dependent kinase CDK5 at Ser-270 is dependent on collybistin. (PMID:22778260)
• The enhancement of Cb-induced gephyrin clustering by GTP-TC10 does not depend on the guanine nucleotide exchange activity of Cb but involves an interaction that resembles reported interactions of other small GTPases with their effectors (PMID:24297911)
• Impairment of the membrane lipid binding activity of Collybistin R290H and a consequent defect in inhibitory synapse maturation represent a likely molecular pathomechanism of epilepsy and mental retardation in humans. (PMID:25678704)
• Collybistin forms a complex with mTOR and eIF3 and by sequestering these proteins downregulates mTORC1 signaling and protein synthesis potentially contributing to intellectual disability and autism. (PMID:25898924)
• Autism spectrum disorder patient with the smallest inactivating deletion in the collybistin gene. (PMID:27238888)
• Study identified a novel mutation in ARHGEF9, c.868C > T/p.R290C, which co-segregated with epileptic encephalopathy, and validated its association with epileptic encephalopathy. Further analysis revealed that all ARHGEF9 mutations were associated with intellectual disability. (PMID:29130122)
• Identification of TAF1, SAT1, and ARHGEF9 as DNA methylation biomarkers for hepatocellular carcinoma. (PMID:31283007)
• Clinical and Molecular Characterization of Three Novel ARHGEF9 Mutations in Patients with Developmental Delay and Epilepsy. (PMID:31942680)
• De novo ARHGEF9 missense variants associated with neurodevelopmental disorder in females: expanding the genotypic and phenotypic spectrum of ARHGEF9 disease in females. (PMID:32939676)
• Loss-of-function variants in ARHGEF9 are associated with an X-linked intellectual disability dominant disorder. (PMID:33600053)
• Human ARHGEF9 intellectual disability syndrome is phenocopied by a mutation that disrupts collybistin binding to the GABAA receptor alpha2 subunit. (PMID:35169261)
• ARHGEF9 gene variant leads to developmental and epileptic encephalopathy: Genotypic phenotype analysis and treatment exploration. (PMID:35638461)
• LncRNA-p21 suppresses cell proliferation and induces apoptosis in gastric cancer by sponging miR-514b-3p and up-regulating ARHGEF9 expression. (PMID:35947460)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	arhgef9b	ENSDARG00000078624
mus_musculus	Arhgef9	ENSMUSG00000025656
rattus_norvegicus	Arhgef9	ENSRNOG00000007733

Paralogs (22): TRIO (ENSG00000038382), MCF2L2 (ENSG00000053524), PLEKHG2 (ENSG00000090924), MCF2 (ENSG00000101977), ARHGEF7 (ENSG00000102606), PLEKHG1 (ENSG00000120278), MCF2L (ENSG00000126217), ARHGEF6 (ENSG00000129675), VAV3 (ENSG00000134215), VAV1 (ENSG00000141968), TIAM2 (ENSG00000146426), KIAA1755 (ENSG00000149633), PLEKHG4B (ENSG00000153404), TIAM1 (ENSG00000156299), KALRN (ENSG00000160145), VAV2 (ENSG00000160293), ARHGEF40 (ENSG00000165801), SPATA13 (ENSG00000182957), SESTD1 (ENSG00000187231), PLEKHN1 (ENSG00000187583), PLEKHG4 (ENSG00000196155), ARHGEF25 (ENSG00000240771)

Protein

Protein identifiers

Rho guanine nucleotide exchange factor 9 — O43307 (reviewed: O43307)

Alternative names: Collybistin, PEM-2 homolog, Rac/Cdc42 guanine nucleotide exchange factor 9

All UniProt accessions (23): O43307, A0A096LNK4, A0A096LNK7, A0A096LNQ4, A0A096LP05, A0A096LPE7, A0A096LPI8, A0A0A6YYB3, A0A0A6YYF8, A0A1B0GTF0, A0A1B0GU85, A0A1B0GV82, A0A1B0GV84, A0A1B0GVC4, A0A1B0GVV2, A0A1B0GVX8, A0A1B0GWI5, A0A1W2PQW9, A0A5F9ZGZ3, A0A5F9ZHY9, A0A5F9ZI31, B1AMR3, B1AMR4

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a guanine nucleotide exchange factor (GEF) for CDC42. Promotes formation of GPHN clusters.

Subunit / interactions. Interacts with GPHN.

Subcellular location. Cytoplasm. Postsynaptic density.

Tissue specificity. Detected in brain. Detected at low levels in heart.

Disease relevance. Developmental and epileptic encephalopathy 8 (DEE8) [MIM:300607] A disorder characterized by hyperekplexia and early infantile epileptic encephalopathy. Neurologic features include exaggerated startle response, seizures, impaired psychomotor development, and intellectual disability. Seizures can be provoked by tactile stimulation or extreme emotion. The disease is caused by variants affecting the gene represented in this entry.

Isoforms (3)

UniProt ID	Names	Canonical?
O43307-1	1, CB3(SH3+)	yes
O43307-2	2, CB3(SH3-)
O43307-3	3

RefSeq proteins (27): NP_001166950, NP_001166951, NP_001317424, NP_001340850, NP_001340851, NP_001340852, NP_001340853, NP_001340855, NP_001340856, NP_001340857, NP_001355959, NP_001355960, NP_001355961, NP_001355962, NP_001355963, NP_001355964, NP_001355965, NP_001355966, NP_001355967, NP_001355968, NP_001355969, NP_001355970, NP_001355971, NP_001355972, NP_001355973, NP_001355974, NP_056000 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000219	DH_dom	Domain
IPR001452	SH3_domain	Domain
IPR001849	PH_domain	Domain
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR035728	ARHGEF9_SH3	Domain
IPR035899	DBL_dom_sf	Homologous_superfamily
IPR036028	SH3-like_dom_sf	Homologous_superfamily
IPR055251	SOS1_NGEF_PH	Domain

Pfam: PF00621, PF07653, PF22697

UniProt features (21 total): strand 6, domain 3, sequence variant 3, splice variant 3, region of interest 2, chain 1, sequence conflict 1, helix 1, modified residue 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2YSQ	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O43307-F1	80.79	0.54

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 502

Function

Pathways and Gene Ontology

Reactome pathways

17 pathways

ID	Pathway
R-HSA-193648	NRAGE signals death through JNK
R-HSA-416482	G alpha (12/13) signalling events
R-HSA-9013148	CDC42 GTPase cycle
R-HSA-9013406	RHOQ GTPase cycle
R-HSA-977443	GABA receptor activation
R-HSA-112314	Neurotransmitter receptors and postsynaptic signal transmission
R-HSA-112315	Transmission across Chemical Synapses
R-HSA-112316	Neuronal System
R-HSA-162582	Signal Transduction
R-HSA-193704	p75 NTR receptor-mediated signalling
R-HSA-194315	Signaling by Rho GTPases
R-HSA-204998	Cell death signalling via NRAGE, NRIF and NADE
R-HSA-372790	Signaling by GPCR
R-HSA-388396	GPCR downstream signalling
R-HSA-73887	Death Receptor Signaling
R-HSA-9012999	RHO GTPase cycle
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3

MSigDB gene sets: 177 (showing top): TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, GOBP_SYNAPSE_ASSEMBLY, GOBP_REGULATION_OF_SMALL_GTPASE_MEDIATED_SIGNAL_TRANSDUCTION, REACTOME_NRAGE_SIGNALS_DEATH_THROUGH_JNK, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, BILD_HRAS_ONCOGENIC_SIGNATURE, GOBP_CELL_JUNCTION_ORGANIZATION, YANG_BREAST_CANCER_ESR1_DN, CCTGTGA_MIR513, TURASHVILI_BREAST_NORMAL_DUCTAL_VS_LOBULAR_DN, GOBP_ORGANELLE_ASSEMBLY, BROWNE_HCMV_INFECTION_24HR_DN, GOBP_CELL_JUNCTION_ASSEMBLY, GOBP_REGULATION_OF_ORGANELLE_ASSEMBLY, REACTOME_TRANSMISSION_ACROSS_CHEMICAL_SYNAPSES

GO Biological Process (2): regulation of small GTPase mediated signal transduction (GO:0051056), regulation of postsynaptic specialization assembly (GO:0099150)

GO Molecular Function (2): guanyl-nucleotide exchange factor activity (GO:0005085), protein binding (GO:0005515)

GO Cellular Component (6): cytosol (GO:0005829), postsynaptic density (GO:0014069), GABA-ergic synapse (GO:0098982), postsynaptic specialization (GO:0099572), cytoplasm (GO:0005737), synapse (GO:0045202)

Reactome top-level categories

Rollup of top-12 pathways:

Category	Pathways
Signal Transduction	3
RHO GTPase cycle	2
Cell death signalling via NRAGE, NRIF and NADE	1
GPCR downstream signalling	1
Neurotransmitter receptors and postsynaptic signal transmission	1
Transmission across Chemical Synapses	1
Neuronal System	1
Death Receptor Signaling	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
p75 NTR receptor-mediated signalling	1
Signaling by GPCR	1
Signaling by Rho GTPases	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
small GTPase-mediated signal transduction	1
regulation of intracellular signal transduction	1
postsynaptic specialization assembly	1
regulation of organelle assembly	1
GTP binding	1
GDP binding	1
GTPase regulator activity	1
binding	1
cytoplasm	1
asymmetric synapse	1
postsynaptic specialization	1
synapse	1
organelle	1
postsynapse	1
intracellular anatomical structure	1
cell junction	1

Protein interactions and networks

STRING

1568 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ARHGEF9	GPHN	Q9NQX3	997
ARHGEF9	NLGN2	Q8NFZ4	949
ARHGEF9	GLRB	P48167	900
ARHGEF9	SLC6A5	Q9Y345	847
ARHGEF9	GLRA1	P23415	809
ARHGEF9	PCDH19	Q8TAB3	781
ARHGEF9	SLC25A22	Q9H936	763
ARHGEF9	PCDH10	Q9P2E7	733
ARHGEF9	PNKP	Q96T60	714
ARHGEF9	NLGN4X	Q8N0W4	700
ARHGEF9	STXBP1	P61764	695
ARHGEF9	CDKL5	O76039	693
ARHGEF9	CDC42	P21181	692
ARHGEF9	ARX	Q96QS3	682
ARHGEF9	PLEK	P08567	677

IntAct

47 interactions, top by confidence:

A	B	Type	Score
ZNF410	ARHGEF9	psi-mi:“MI:0915”(physical association)	0.560
FANCL	ARHGEF9	psi-mi:“MI:0915”(physical association)	0.560
VEZF1	ARHGEF9	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	ZNF410	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	FANCL	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	VEZF1	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	TBC1D22B	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	TSGA10IP	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	FAM90A1	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	YWHAG	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	SETDB1	psi-mi:“MI:0915”(physical association)	0.560
KAT5	ARHGEF9	psi-mi:“MI:0915”(physical association)	0.560
LMO3	ARHGEF9	psi-mi:“MI:0915”(physical association)	0.560
ARHGEF9	IHO1	psi-mi:“MI:0915”(physical association)	0.490
ARHGEF9	BCL6	psi-mi:“MI:0915”(physical association)	0.490
ARHGEF9	TFIP11	psi-mi:“MI:0915”(physical association)	0.490

BioGRID (33): ARHGEF9 (Two-hybrid), ARHGEF9 (Affinity Capture-RNA), CCDC36 (Two-hybrid), TFIP11 (Two-hybrid), BCL6 (Two-hybrid), ARHGEF9 (Two-hybrid), FAM90A1 (Two-hybrid), TSGA10IP (Two-hybrid), NPM1 (Proximity Label-MS), ARHGEF9 (Affinity Capture-MS), ARHGEF9 (Affinity Capture-Western), ARHGEF9 (FRET), ARHGEF9 (Affinity Capture-MS), CPVL (Affinity Capture-MS), GPHN (Affinity Capture-MS)

ESM2 similar proteins: A2CEA7, A4IF90, B0S6J3, D3ZGS3, D4A208, F1LYQ8, F1M386, F1MSG6, F1P065, F1PBJ0, G5EDB9, H2KZZ6, O14827, O43295, O43307, O75044, P27671, P28818, P46941, P70392, Q13972, Q15057, Q3UTH8, Q45FX5, Q53QZ3, Q58DL7, Q5DU57, Q5FVC7, Q5ZMM3, Q6AYC5, Q6IVG4, Q6ZQK5, Q7Z6B7, Q811M1, Q812A2, Q8C0D4, Q8CHG7, Q8IWW6, Q8T0G4, Q8TEU7

Diamond homologs: A0JNJ1, A1CEK6, A1DFN5, A2QW93, A4RF61, A6QLK6, A7A261, F1LRS8, O35179, O35964, O43307, O74749, O75791, O75886, O88811, O89100, O93436, P02549, P07751, P09215, P09216, P10830, P13395, P16054, P16086, P16546, P23298, P24723, P28867, P29355, P32793, P34885, P38753, P43603, P53281, P62993, P62994, P70297, P87379, P97306

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
ARHGEF9	“up-regulates activity”	CDC42	“guanine nucleotide exchange factor”
GPHN	“up-regulates activity”	ARHGEF9	binding
ARHGEF9	up-regulates	Synaptic_plasticity

Disease & clinical

Clinical variants and AI predictions

ClinVar

577 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	31
Likely pathogenic	20
Uncertain significance	222
Likely benign	172
Benign	27

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1076014	NM_001353921.2(ARHGEF9):c.1150G>T (p.Glu384Ter)	Pathogenic
11049	NM_001353921.2(ARHGEF9):c.185G>C (p.Gly62Ala)	Pathogenic
1327405	NM_001353921.2(ARHGEF9):c.1409C>G (p.Ser470Ter)	Pathogenic
1358350	NM_001353921.2(ARHGEF9):c.982_983dup (p.Gly330fs)	Pathogenic
1453910	NM_001353921.2(ARHGEF9):c.942G>A (p.Trp314Ter)	Pathogenic
148296	GRCh38/hg38 Xp11.21-q11.2(chrX:56127875-63867853)x2	Pathogenic
1736413	NM_001353921.2(ARHGEF9):c.415C>T (p.Gln139Ter)	Pathogenic
2020245	NM_001353921.2(ARHGEF9):c.1030C>T (p.Gln344Ter)	Pathogenic
2086900	NM_001353921.2(ARHGEF9):c.1423dup (p.Tyr475fs)	Pathogenic
2104534	NM_001353921.2(ARHGEF9):c.1269G>A (p.Trp423Ter)	Pathogenic
2501758	NM_001353921.2(ARHGEF9):c.928_935del (p.Ser310fs)	Pathogenic
2584339	NM_001353921.2(ARHGEF9):c.813_814del (p.His271fs)	Pathogenic
2584341	NM_001353921.2(ARHGEF9):c.402+1G>C	Pathogenic
2820386	NM_001353921.2(ARHGEF9):c.775C>T (p.Gln259Ter)	Pathogenic
2856404	NM_001353921.2(ARHGEF9):c.216G>A (p.Trp72Ter)	Pathogenic
29968	NM_001353921.2(ARHGEF9):c.4C>T (p.Gln2Ter)	Pathogenic
3244596	NC_000023.10:g.(?62875354)(62875637_?)del	Pathogenic
3244607	NC_000023.10:g.(?62857908)(62863948_?)del	Pathogenic
431121	NM_001353921.2(ARHGEF9):c.886C>T (p.Arg296Ter)	Pathogenic
4494822	NM_001353921.2(ARHGEF9):c.1321+1G>A	Pathogenic
4795916	NM_001353921.2(ARHGEF9):c.1099del (p.Leu367fs)	Pathogenic
4813417	NM_001353921.2(ARHGEF9):c.1138_1141del (p.Val380fs)	Pathogenic
545451	NM_001353921.2(ARHGEF9):c.920G>A (p.Trp307Ter)	Pathogenic
568396	NM_001353921.2(ARHGEF9):c.922C>T (p.Gln308Ter)	Pathogenic
804015	NM_001353921.2(ARHGEF9):c.178G>T (p.Glu60Ter)	Pathogenic
804241	NM_001353921.2(ARHGEF9):c.1306del (p.Glu436fs)	Pathogenic
813791	NM_001353921.2(ARHGEF9):c.1351C>T (p.Gln451Ter)	Pathogenic
817527	NM_001353921.2(ARHGEF9):c.215G>A (p.Trp72Ter)	Pathogenic
837954	NM_001353921.2(ARHGEF9):c.945G>A (p.Glu315=)	Pathogenic
985369	NM_001353921.2(ARHGEF9):c.875del (p.Asn292fs)	Pathogenic

SpliceAI

1895 predictions. Top by Δscore:

Variant	Effect	Δscore
X:63665881:GTTAC:G	donor_loss	1.0000
X:63665883:TA:T	donor_loss	1.0000
X:63665884:A:T	donor_loss	1.0000
X:63665885:CCTT:C	donor_gain	1.0000
X:63665888:T:A	donor_gain	1.0000
X:63678334:CCTTA:C	donor_loss	1.0000
X:63678335:CTTAC:C	donor_loss	1.0000
X:63678336:TTA:T	donor_loss	1.0000
X:63678337:TA:T	donor_loss	1.0000
X:63678338:A:AT	donor_loss	1.0000
X:63678393:G:A	donor_gain	1.0000
X:63678570:TTG:T	acceptor_gain	1.0000
X:63678573:C:CC	acceptor_gain	1.0000
X:63678573:CT:C	acceptor_loss	1.0000
X:63678574:T:A	acceptor_loss	1.0000
X:63678575:G:C	acceptor_gain	1.0000
X:63697119:ACTT:A	donor_loss	1.0000
X:63697123:A:AC	donor_gain	1.0000
X:63697123:ACGT:A	donor_loss	1.0000
X:63697123:ACGTG:A	donor_gain	1.0000
X:63697124:C:CA	donor_gain	1.0000
X:63697124:CG:C	donor_gain	1.0000
X:63697124:CGT:C	donor_gain	1.0000
X:63697124:CGTG:C	donor_gain	1.0000
X:63697124:CGTGC:C	donor_gain	1.0000
X:63697300:TAGCC:T	acceptor_gain	1.0000
X:63697301:AGCC:A	acceptor_gain	1.0000
X:63697302:GCC:G	acceptor_gain	1.0000
X:63697303:CC:C	acceptor_gain	1.0000
X:63697303:CCC:C	acceptor_gain	1.0000

AlphaMissense

3543 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
X:63655548:A:G	W416R	1.000
X:63655548:A:T	W416R	1.000
X:63665889:C:A	K351N	1.000
X:63665889:C:G	K351N	1.000
X:63665892:G:C	C350W	1.000
X:63665893:C:T	C350Y	1.000
X:63665894:A:G	C350R	1.000
X:63665899:A:T	V348D	1.000
X:63665915:A:T	F343I	1.000
X:63665917:A:G	L342P	1.000
X:63665994:G:C	S316R	1.000
X:63665994:G:T	S316R	1.000
X:63665996:T:G	S316R	1.000
X:63674041:C:A	W307C	1.000
X:63674041:C:G	W307C	1.000
X:63674043:A:G	W307R	1.000
X:63674043:A:T	W307R	1.000
X:63674051:A:T	V304D	1.000
X:63674064:A:G	W300R	1.000
X:63674064:A:T	W300R	1.000
X:63674093:C:G	R290P	1.000
X:63674096:C:G	R289P	1.000
X:63674098:C:A	K288N	1.000
X:63674098:C:G	K288N	1.000
X:63674107:G:C	N285K	1.000
X:63674107:G:T	N285K	1.000
X:63674144:G:T	A273D	1.000
X:63674145:C:G	A273P	1.000
X:63678364:A:G	L257P	1.000
X:63678367:A:G	L256P	1.000

dbSNP variants (sampled 300 via entrez): RS10126994 (X:63729663 T>C), RS10449038 (X:63665193 G>A), RS1048041 (X:63635466 A>G), RS1048044 (X:63635465 C>T), RS10482119 (X:63774518 C>G), RS10482124 (X:63775650 G>A), RS10542660 (X:63637846 CTGTGTGTGTGTGTGTGTGTGTGTG>C,CTGTGTG,CTGTGTGTGTG,CTGTGTGTGTGTG,CTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG,CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG), RS1057520158 (X:63655667 A>G), RS1057521807 (X:63655597 A>T), RS1057521815 (X:63678590 A>C), RS1057522301 (X:63697146 T>A,C), RS1057522323 (X:63674049 G>A,T), RS1057522347 (X:63674176 A>G), RS1057522740 (X:63678378 C>T), RS1057523510 (X:63706271 T>C)

Disease associations

OMIM: gene MIM:300429 | disease phenotypes: MIM:300607, MIM:308350, MIM:209850

GenCC curated gene-disease

Disease	Classification	Inheritance
developmental and epileptic encephalopathy, 8	Definitive	X-linked

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
X-linked complex neurodevelopmental disorder	Definitive	XL

Mondo (7): developmental and epileptic encephalopathy, 8 (MONDO:0010375), developmental and epileptic encephalopathy, 1 (MONDO:0010632), autism (MONDO:0005260), autism spectrum disorder (MONDO:0005258), epilepsy (MONDO:0005027), microcephaly (MONDO:0001149), intellectual disability (MONDO:0001071)

Orphanet (4): Hyperekplexia-epilepsy syndrome (Orphanet:163985), X-linked intellectual disability-epilepsy syndrome (Orphanet:2076), NON RARE IN EUROPE: Autism (Orphanet:106), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

20 total (22 of 20 shown, HPO-id order):

HPO	Term
HP:0000243	Trigonocephaly
HP:0001263	Global developmental delay
HP:0001276	Hypertonia
HP:0001419	X-linked recessive inheritance
HP:0001548	Overgrowth
HP:0002069	Bilateral tonic-clonic seizure
HP:0002267	Exaggerated startle response
HP:0002376	Developmental regression
HP:0002384	Focal impaired awareness seizure
HP:0003577	Congenital onset
HP:0003593	Infantile onset
HP:0003819	Death in childhood
HP:0006821	Frontal polymicrogyria
HP:0007333	Hypoplasia of the frontal lobes
HP:0010818	Generalized tonic seizure
HP:0010864	Severe intellectual disability
HP:0011463	Childhood onset
HP:0012018	EEG with temporal focal spikes
HP:0032792	Tonic seizure
HP:0200134	Epileptic encephalopathy
HP:0000717	Autism
HP:0000252	Microcephaly

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST006661_9	Male-pattern baldness	1.000000e-14

MeSH disease descriptors (5)

Descriptor	Name	Tree numbers
D001321	Autistic Disorder	F03.625.164.113.500
D004827	Epilepsy	C10.228.140.490
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500
C564474	Hyperekplexia and Epilepsy (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

44 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases methylation, increases expression, affects cotreatment, decreases expression	3
Benzo(a)pyrene	affects methylation, decreases expression, increases methylation	3
Valproic Acid	decreases expression	3
sodium arsenite	decreases expression, increases expression	2
mercuric bromide	decreases expression, affects cotreatment	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Tobacco Smoke Pollution	decreases expression	2
Aflatoxin B1	affects expression, decreases methylation	2
p-Chloromercuribenzoic Acid	affects cotreatment, decreases expression	2
GSK-J4	decreases expression	1
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, decreases expression, increases abundance	1
sulforaphane	decreases expression	1
butyraldehyde	decreases expression	1
perfluorooctanoic acid	decreases expression	1
potassium chromate(VI)	decreases expression	1
methacrylaldehyde	affects cotreatment, decreases expression, increases abundance	1
pentanal	decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
perfluoro-n-nonanoic acid	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	decreases expression, affects cotreatment	1
perfluorohexanesulfonic acid	decreases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
Fulvestrant	increases methylation	1
Acrolein	affects cotreatment, decreases expression, increases abundance	1
Air Pollutants	affects cotreatment, decreases expression, increases abundance	1
Amiodarone	increases expression	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00211796	PHASE4	COMPLETED	Divalproex Sodium ER in Adult Autism
NCT00391261	PHASE4	COMPLETED	An Open-label Trial of Metformin for Weight Control of Pediatric Patients on Antipsychotic Medications.
NCT00409747	PHASE4	COMPLETED	Minocycline to Treat Childhood Regressive Autism
NCT00576732	PHASE4	COMPLETED	A Study of the Effectiveness and Safety of Two Doses of Risperidone in the Treatment of Children and Adolescents With Autistic Disorder
NCT00844753	PHASE4	COMPLETED	Atomoxetine, Placebo and Parent Management Training in Autism
NCT01028820	PHASE4	COMPLETED	FMRI Brain Activation of Aripiprazole Treatment in Autism Spectrum Disorders
NCT01098383	PHASE4	UNKNOWN	Treatment With Acetyl-Choline Esterase Inhibitors in Children With Autism Spectrum Disorders
NCT01333865	PHASE4	COMPLETED	A Study of Memantine Hydrochloride (Namenda®) for Cognitive and Behavioral Impairment in Adults With Autism Spectrum Disorders
NCT01337700	PHASE4	COMPLETED	Milnacipran in Autism and the Functional Locus Coeruleus and Noradrenergic Model of Autism
NCT01695200	PHASE4	COMPLETED	Omega-3 Fatty Acids in Autism Spectrum Disorders
NCT02069977	PHASE4	UNKNOWN	Study to Evaluate the Efficacy and Safety of Aripiprazole
NCT02096952	PHASE4	COMPLETED	Methylphenidate ER Liquid Formulation in Adults With ASD and ADHD
NCT02199925	PHASE4	UNKNOWN	An Open-Label Study to Evaluate the Efficacy of High-Dose Gammaplex in Children on the Autism Spectrum
NCT02235467	PHASE4	COMPLETED	Multisite Study: Parental Training Using Video Modelling to Develop Social Skills in Children With Autism
NCT02255565	PHASE4	COMPLETED	Dose Response Effects of Quillivant XR in Children With ADHD and Autism: A Pilot Study
NCT02940574	PHASE4	COMPLETED	Neural and Behavioral Effects of Oxytocin in Autism Spectrum Disorders
NCT03333629	PHASE4	COMPLETED	Promoting Positive Outcomes for Individuals With ASD: Linking Early Detection, Treatment, and Long-term Outcomes
NCT03337646	PHASE4	COMPLETED	Evaluation of the Effect and Safety of Lisdexamfetamine in Children Aged 6-12 With ADHD and Autism
NCT03538431	PHASE4	COMPLETED	Improving Driving in Young People With Autism Spectrum Disorders
NCT03757585	PHASE4	COMPLETED	Natural Treatments for the Management of Emotional Dysregulation in Youth With Non-verbal Learning Disability (NVLD) and/or Autism Spectrum Disorders (ASD)
NCT04903353	PHASE4	COMPLETED	Pragmatic Trial Comparing Weight Gain in Children With Autism Taking Risperidone Versus Aripiprazole
NCT05063656	PHASE4	COMPLETED	Biomarker-Driven Pharmacological Treatment of Adolescents With Autism Spectrum Disorder With Gabapentin
NCT05146245	PHASE4	UNKNOWN	Safety and Pharmacokinetics of Antipsychotics in Children 2: Studying TDM in an RCT
NCT05916339	PHASE4	RECRUITING	AWARE: Management of ADHD in Autism Spectrum Disorder
NCT05954052	PHASE4	TERMINATED	A Study of Glutathione in Children With Autism Spectrum Disorder
NCT06853665	PHASE4	RECRUITING	The TEAM Study - Treatment Efficacy for Autism/Attention Using Mixed Amphetamine
NCT07054697	PHASE4	COMPLETED	Pilot-RCT With Individualized Homeopathic Treatment in the Children With Autism Spectrum Disorder
NCT07161804	PHASE4	COMPLETED	Pilot RCT Using Homeopathic Medicines in ASD
NCT07439042	PHASE4	NOT_YET_RECRUITING	Buspirone for Anxiety in Autistic Youth
NCT00036231	PHASE3	TERMINATED	Synthetic Human Secretin in Children With Autism and Gastrointestinal Dysfunction
NCT00036244	PHASE3	COMPLETED	Synthetic Human Secretin in Children With Autism
NCT00065884	PHASE3	UNKNOWN	Valproate Response in Aggressive Autistic Adolescents
NCT00065962	PHASE3	COMPLETED	Secretin for the Treatment of Autism
NCT00252603	PHASE3	COMPLETED	Galantamine Versus Placebo in Childhood Autism
NCT00346736	PHASE3	COMPLETED	Use of Acupuncture In Children With Autistic Spectrum Disorder
NCT00352248	PHASE3	COMPLETED	Randomized Controlled Trial of Acupuncture Versus Sham Acupuncture in Autistic Spectrum Disorder
NCT00352352	PHASE3	COMPLETED	Use of Acupuncture In Children With Autistic Spectrum Disorder
NCT00355329	PHASE3	COMPLETED	Randomized Control Trial of Using Tongue Acupuncture in Autistic Spectrum Disorder Using PET Scan for Clinical Correlation
NCT00498173	PHASE3	COMPLETED	Effectiveness of Atomoxetine in Treating ADHD Symptoms in Children and Adolescents With Autism
NCT00541346	PHASE3	COMPLETED	A Pilot Study of Daytrana TM in Children With Autism Co-Morbid for Attention Deficit Hyperactivity Disorder (ADHD) Symptoms