ARIH1

Summary

ARIH1 (ariadne RBR E3 ubiquitin protein ligase 1, HGNC:689) is a protein-coding gene on chromosome 15q24.1, encoding E3 ubiquitin-protein ligase ARIH1 (Q9Y4X5). E3 ubiquitin-protein ligase, which catalyzes ubiquitination of target proteins together with ubiquitin-conjugating enzyme E2 UBE2L3. It is a common-essential gene (DepMap: required in 98.0% of cancer cell lines).

Enables enzyme binding activity; ubiquitin-protein transferase activity; and zinc ion binding activity. Involved in protein ubiquitination. Located in several cellular components, including Lewy body; cullin-RING ubiquitin ligase complex; and nuclear body.

Source: NCBI Gene 25820 — RefSeq curated summary.

At a glance

• Gene–disease (curated): thoracic aortic aneurysm (Strong, GenCC)
• Clinical variants (ClinVar): 314 total
• Phenotypes (HPO): 1
• Cancer dependency (DepMap): dependent in 98.0% of screened cell lines (common-essential)
• MANE Select transcript: NM_005744

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:689
Approved symbol	ARIH1
Name	ariadne RBR E3 ubiquitin protein ligase 1
Location	15q24.1
Locus type	gene with protein product
Status	Approved
Aliases	HARI, HHARI, UBCH7BP, ARI
Ensembl gene	ENSG00000166233
Ensembl biotype	protein_coding
OMIM	605624
Entrez	25820

Gene structure

Transcript identifiers

Ensembl transcripts: 17 — 10 protein_coding, 4 retained_intron, 2 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000379887, ENST00000561770, ENST00000561987, ENST00000562891, ENST00000563310, ENST00000564062, ENST00000565950, ENST00000566063, ENST00000567762, ENST00000570085, ENST00000891024, ENST00000915024, ENST00000915025, ENST00000915026, ENST00000915027, ENST00000954374, ENST00000954375

RefSeq mRNA: 1 — MANE Select: NM_005744 NM_005744

CCDS: CCDS10244

Canonical transcript exons

ENST00000379887 — 14 exons

Exon	Start	End
ENSE00001101249	72561483	72561549
ENSE00001101256	72544820	72544964
ENSE00001101274	72566563	72566605
ENSE00001179017	72474330	72475014
ENSE00001250190	72570177	72570307
ENSE00001907796	72583208	72602987
ENSE00003462015	72582075	72582187
ENSE00003495965	72567106	72567177
ENSE00003554469	72518067	72518134
ENSE00003568289	72580731	72580991
ENSE00003657854	72572108	72572165
ENSE00003679493	72555271	72555363
ENSE00003687059	72555852	72555907
ENSE00003790024	72563394	72563500

Expression profiles

Bgee: expression breadth ubiquitous, 292 present calls, max score 99.15.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 53.8402 / max 620.6271, expressed in 1824 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
147579	51.2976	1823
147580	2.5426	916

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	99.15	gold quality
oocyte	CL:0000023	99.06	gold quality
cortical plate	UBERON:0005343	98.41	gold quality
left testis	UBERON:0004533	98.40	gold quality
right testis	UBERON:0004534	98.29	gold quality
ventricular zone	UBERON:0003053	98.16	gold quality
sural nerve	UBERON:0015488	98.10	gold quality
ganglionic eminence	UBERON:0004023	98.08	gold quality
colonic epithelium	UBERON:0000397	97.53	gold quality
stromal cell of endometrium	CL:0002255	97.39	gold quality
hindlimb stylopod muscle	UBERON:0004252	97.33	gold quality
calcaneal tendon	UBERON:0003701	97.13	gold quality
buccal mucosa cell	CL:0002336	97.12	gold quality
testis	UBERON:0000473	97.09	gold quality
tendon	UBERON:0000043	96.76	gold quality
adrenal tissue	UBERON:0018303	96.51	gold quality
tendon of biceps brachii	UBERON:0008188	96.20	gold quality
gastrocnemius	UBERON:0001388	96.16	gold quality
muscle of leg	UBERON:0001383	96.12	gold quality
gluteal muscle	UBERON:0002000	95.86	gold quality
popliteal artery	UBERON:0002250	95.50	gold quality
tibial artery	UBERON:0007610	95.49	gold quality
muscle organ	UBERON:0001630	95.28	gold quality
skin of abdomen	UBERON:0001416	95.21	gold quality
skin of leg	UBERON:0001511	95.12	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	94.99	gold quality
left ovary	UBERON:0002119	94.90	gold quality
medial globus pallidus	UBERON:0002477	94.78	gold quality
zone of skin	UBERON:0000014	94.74	gold quality
aorta	UBERON:0000947	94.69	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

298 targeting ARIH1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-3065-5P	99.97	71.56	3281

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 98.0% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 13)

• the structure of the RING2 from the RING-IBR-RING motif of HHARI and showed that RING2 has a completely distinct topology from classical RINGs (PMID:15236971)
• UBCH7 exhibits activity with the RING-in-between-RING (RBR) family of E3s that includes parkin (also known as PARK2) and human homologue of ariadne (HHARI; also known as ARIH1) (PMID:21532592)
• Both parkin and HHARI bind the same substrate proteins in cells and induce the formation of aggresomes. (PMID:21590270)
• HHARI is a marker of cellular proliferation associated with nuclear bodies. (PMID:23059369)
• Determined is the three-dimensional solution structure of the catalytic RING2 domain from HHARI. It shows glimpses of a HECT E3 ligase. (PMID:24058416)
• TRIAD1 and HHARI bind to and are activated by distinct neddylated Cullin-RING ligase complexes. (PMID:24076655)
• DNA damage induces an increase in ARIH1 protein levels and association of ARIH1 with 4EHP. In turn, this causes 4EHP recruitment to the mRNA cap, where it is known to compete with eIF4E. (PMID:25624349)
• Crystal structure of HHARI and UbcH7 reveals UbcH7 approximately Ub binding RING1 domain of auto-inhibited HHARI.HHARI UBA-L domain has Ub binding properties. (PMID:28552575)
• HHARI prevents spurious discharge of Ub from E2 to lysine residues by harboring structural elements that block E2 ~ Ub from adopting a ‘closed’ conformation. (PMID:28790309)
• ARIH1-mediated mitophagy promotes therapeutic resistance. (PMID:28930681)
• Variants in ARIH1 are associated with developing aortic aneurysms. (PMID:29689197)
• ubiquitin-associated (UBA) domain-containing DCNL1 is monoubiquitylated when bound to CRLs and that this monoubiquitylation depends on the CRL-associated Ariadne RBR ligases TRIAD1 (ARIH2) and HHARI (ARIH1) and strictly requires the DCNL1’s UBA domain. (PMID:30587576)
• ARIH1 signaling promotes anti-tumor immunity by targeting PD-L1 for proteasomal degradation. (PMID:33879767)

Cross-species orthologs

10 orthologs

Organism	Symbol	Gene ID
danio_rerio	arih1	ENSDARG00000003616
danio_rerio	arih1l	ENSDARG00000036870
mus_musculus	Arih1	ENSMUSG00000025234
rattus_norvegicus	Arih1	ENSRNOG00000009887
drosophila_melanogaster	ari-1	FBGN0017418
caenorhabditis_elegans		WBGENE00013538
caenorhabditis_elegans		WBGENE00015924
caenorhabditis_elegans	ari-1.3	WBGENE00016156
caenorhabditis_elegans	ari-1.2	WBGENE00016157
caenorhabditis_elegans	ari-1.1	WBGENE00016158

Paralogs (9): ANKIB1 (ENSG00000001629), RNF14 (ENSG00000013561), RNF19A (ENSG00000034677), RNF19B (ENSG00000116514), RNF144B (ENSG00000137393), RNF217 (ENSG00000146373), RNF144A (ENSG00000151692), ARIH2 (ENSG00000177479), PRKN (ENSG00000185345)

Protein

Protein identifiers

E3 ubiquitin-protein ligase ARIH1 — Q9Y4X5 (reviewed: Q9Y4X5)

Alternative names: H7-AP2, HHARI, Monocyte protein 6, Protein ariadne-1 homolog, UbcH7-binding protein, UbcM4-interacting protein, Ubiquitin-conjugating enzyme E2-binding protein 1

All UniProt accessions (5): A0A087WT96, Q9Y4X5, H3BNB9, H3BSK4, H3BUS0

UniProt curated annotations — full annotation on UniProt →

Function. E3 ubiquitin-protein ligase, which catalyzes ubiquitination of target proteins together with ubiquitin-conjugating enzyme E2 UBE2L3. Acts as an atypical E3 ubiquitin-protein ligase by working together with cullin-RING ubiquitin ligase (CRL) complexes and initiating ubiquitination of CRL substrates: associates with CRL complexes and specifically mediates addition of the first ubiquitin on CRLs targets. The initial ubiquitin is then elongated by CDC34/UBE2R1 and UBE2R2. E3 ubiquitin-protein ligase activity is activated upon binding to neddylated cullin-RING ubiquitin ligase complexes. Plays a role in protein translation in response to DNA damage by mediating ubiquitination of EIF4E2, the consequences of EIF4E2 ubiquitination are however unclear. According to a report, EIF4E2 ubiquitination leads to promote EIF4E2 cap-binding and protein translation arrest. According to another report EIF4E2 ubiquitination leads to its subsequent degradation. Acts as the ligase involved in ISGylation of EIF4E2. In vitro, controls the degradation of the LINC (LInker of Nucleoskeleton and Cytoskeleton) complex member SUN2 and may therefore have a role in the formation and localization of the LINC complex, and as a consequence, nuclear subcellular localization and nuclear morphology.

Subunit / interactions. Interacts (via the first RING-type zinc finger) with UBE2L3. Associates with cullin-RING ubiquitin ligase (CRL) complexes containing CUL1, CUL2 and CUL3. Interacts with neddylated CUL1. Interacts with neddylated CUL2. Interacts with neddylated CUL3. Interacts with neddylated CUL4A.

Subcellular location. Cytoplasm. Nucleus. Cajal body.

Tissue specificity. Widely expressed.

Disease relevance. Defects in ARIH1 have been found in several individuals with thoracic aortic aneurysms and cerebrovascular disease.

Activity regulation. Autoinhibited by the ariadne domain, which masks the second RING-type zinc finger that contains the active site and inhibits the E3 activity. Inhibition is relieved upon binding to neddylated cullin-RING ubiquitin ligase complexes, which activate the E3 ligase activity of ARIH1.

Domain organisation. Members of the RBR family are atypical E3 ligases. They interact with the E2 conjugating enzyme UBE2L3 and function like HECT-type E3 enzymes: they bind E2s via the first RING-type zinc finger, but require an obligate trans-thiolation step during the ubiquitin transfer, requiring a conserved active site Cys residue in the second RING-type zinc finger. The active site probably forms a thioester intermediate with ubiquitin taken from the active-site cysteine of the E2 before ultimately transferring it to a Lys residue on the substrate. The Ariadne domain inhibits activity by masking the second RING-type zinc finger that contains the active site.

Induction. Up-regulated following DNA damage.

Pathway. Protein modification; protein ubiquitination.

Similarity. Belongs to the RBR family. Ariadne subfamily.

RefSeq proteins (1): NP_005735* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001841	Znf_RING	Domain
IPR002867	IBR_dom	Domain
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR018957	Znf_C3HC4_RING-type	Domain
IPR031127	E3_UB_ligase_RBR	Family
IPR044066	TRIAD_supradom	Domain
IPR045840	Ariadne	Domain
IPR048962	ARIH1-like_UBL	Domain

Pfam: PF00097, PF01485, PF19422, PF21235, PF22191

Enzyme classification (BRENDA):

• EC 2.3.2.27 — RING-type E3 ubiquitin transferase (BRENDA: 28 organisms, 138 substrates, 10 inhibitors, 1 Km, 1 kcat entries)
• EC 2.3.2.31 — RBR-type E3 ubiquitin transferase (BRENDA: 4 organisms, 35 substrates, 4 inhibitors, 0 Km, 0 kcat entries)

Substrate kinetics (BRENDA)

1 substrates with measured Km, best-characterized 1. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
[UBE2W]-S-UBIQUITINYL-L-CYSTEINE	0.3014	1

UniProt features (123 total): mutagenesis site 38, binding site 24, strand 17, helix 15, turn 8, sequence conflict 6, region of interest 4, zinc finger region 3, sequence variant 3, compositionally biased region 2, chain 1, active site 1, modified residue 1

Structure

Experimental structures (PDB)

10 structures.

PDB	Method	Resolution (Å)
5UDH	X-RAY DIFFRACTION	3.24
4KBL	X-RAY DIFFRACTION	3.3
5TTE	X-RAY DIFFRACTION	3.5
7B5N	ELECTRON MICROSCOPY	3.6
7B5S	ELECTRON MICROSCOPY	3.6
4KC9	X-RAY DIFFRACTION	3.6
7B5L	ELECTRON MICROSCOPY	3.8
7B5M	ELECTRON MICROSCOPY	3.91
1WD2	SOLUTION NMR
2M9Y	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y4X5-F1	81.71	0.61

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 357

Ligand- & substrate-binding residues (24): 186; 189; 203; 205; 208; 211; 231; 236; 276; 281; 297; 299 …

Post-translational modifications (1): 142

Mutagenesis-validated functional residues (38):

Position	Phenotype
123	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
150	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
156–158	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
187–188	no loss of interaction with ube2l3.
188	loss of interaction with ube2l3. decreased e3 ligase activity. strongly decreased ability to initiate ubiquitination of
205	impaired interaction with ube2l3 without affecting interaction with neddylated cullin-ring complexes.
208	loss of interaction with ube2l3.
257–258	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
258	no loss of interaction with ube2l3.
265–267	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
340–341	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
342–343	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
347	impairs zinc-binding and folding. abolishes e3 ubiquitin-protein ligase activity.
351–352	strongly decreased ability to initiate ubiquitination of cullin-ring complexes.
351	disrupts the hydrophobic network. abolishes e3 ubiquitin-protein ligase activity.
357	does not affect zinc binding and folding. abolishes ability to transfer ubiquitin and e3 ubiquitin-protein ligase activi
358	defects in ligation.
359	defects in ligation. does not affect zinc binding, folding. does not impair e3 ubiquitin-protein ligase activity.
367	impairs zinc-binding and folding. abolishes e3 ubiquitin-protein ligase activity.
371	disrupts the hydrophobic network. abolishes e3 ubiquitin-protein ligase activity.
372	impairs e3 ubiquitin-protein ligase activity.
373	abolishes e3 ubiquitin-protein ligase activity.
378–379	defects in ligation.
379	does not affect e3 ubiquitin-protein ligase activity.
383–385	defects in ligation.

Function

Pathways and Gene Ontology

Reactome pathways

12 pathways

ID	Pathway
R-HSA-1169408	ISG15 antiviral mechanism
R-HSA-9833110	RSV-host interactions
R-HSA-9833482	PKR-mediated signaling
R-HSA-9909505	Modulation of host responses by IFN-stimulated genes
R-HSA-1169410	Antimicrobial mechanism of IFN-stimulated genes
R-HSA-1280215	Cytokine Signaling in Immune system
R-HSA-1643685	Disease
R-HSA-168256	Immune System
R-HSA-5663205	Infectious disease
R-HSA-913531	Interferon Signaling
R-HSA-9820952	Respiratory Syncytial Virus Infection Pathway
R-HSA-9824446	Viral Infection Pathways

MSigDB gene sets: 289 (showing top): RNGTGGGC_UNKNOWN, YAGI_AML_WITH_INV_16_TRANSLOCATION, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, PEREZ_TP63_TARGETS, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, LINDGREN_BLADDER_CANCER_CLUSTER_3_DN, WONG_PROTEASOME_GENE_MODULE, BILD_SRC_ONCOGENIC_SIGNATURE, AGGCACT_MIR5153P, TGCTGAY_UNKNOWN, BACH2_01, DACOSTA_UV_RESPONSE_VIA_ERCC3_COMMON_DN, MCCABE_HOXC6_TARGETS_CANCER_DN, TGANTCA_AP1_C

GO Biological Process (3): ubiquitin-dependent protein catabolic process (GO:0006511), protein ubiquitination (GO:0016567), PKR/eIFalpha signaling (GO:0039585)

GO Molecular Function (9): ubiquitin-protein transferase activity (GO:0004842), zinc ion binding (GO:0008270), ubiquitin-like protein transferase activity (GO:0019787), ubiquitin conjugating enzyme binding (GO:0031624), ubiquitin protein ligase binding (GO:0031625), ubiquitin protein ligase activity (GO:0061630), protein binding (GO:0005515), transferase activity (GO:0016740), metal ion binding (GO:0046872)

GO Cellular Component (12): ubiquitin ligase complex (GO:0000151), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), Cajal body (GO:0015030), nuclear body (GO:0016604), Lewy body (GO:0097413), SCF ubiquitin ligase complex (GO:0019005), Cul2-RING ubiquitin ligase complex (GO:0031462), Cul3-RING ubiquitin ligase complex (GO:0031463), Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)

Reactome top-level categories

Rollup of top-8 pathways:

Category	Pathways
Antimicrobial mechanism of IFN-stimulated genes	2
Interferon Signaling	2
Respiratory Syncytial Virus Infection Pathway	1
Immune System	1
Disease	1
Cytokine Signaling in Immune system	1
Viral Infection Pathways	1
Infectious disease	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
cullin-RING ubiquitin ligase complex	3
protein ubiquitination	1
modification-dependent protein catabolic process	1
protein modification by small protein conjugation	1
integrated stress response signaling	1
ubiquitin-like protein transferase activity	1
transition metal ion binding	1
aminoacyltransferase activity	1
catalytic activity, acting on a protein	1
ubiquitin-like protein conjugating enzyme binding	1
ubiquitin-like protein ligase binding	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein ligase activity	1
binding	1
catalytic activity	1
cation binding	1
intracellular protein-containing complex	1
transferase complex	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
cytoplasm	1
nuclear ribonucleoprotein granule	1
nucleoplasm	1
intracellular membraneless organelle	1
inclusion body	1
Cul4-RING E3 ubiquitin ligase complex	1

Protein interactions and networks

STRING

1846 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ARIH1	UBE2L6	O14933	880
ARIH1	UBA1	P22314	813
ARIH1	EIF4E2	O60573	794
ARIH1	PSMD11	O00231	755
ARIH1	UBE2E2	Q96LR5	724
ARIH1	UBE2A	P49459	684
ARIH1	UBE2D1	P51668	679
ARIH1	UBE3A	P78355	674
ARIH1	UBE2K	P27924	640
ARIH1	UBE2N	P61088	640
ARIH1	RBX1	P62877	635
ARIH1	UBE2S	Q16763	633
ARIH1	UBE2E1	P51965	630
ARIH1	TRIM25	Q14258	628
ARIH1	RING1	Q06587	615

IntAct

104 interactions, top by confidence:

A	B	Type	Score
ATF2	JUN	psi-mi:“MI:0914”(association)	0.950
FBXO3	SKP1	psi-mi:“MI:0914”(association)	0.920
KLHL12	KLHL2	psi-mi:“MI:0914”(association)	0.850
FBXL15	SKP1	psi-mi:“MI:0914”(association)	0.840
FBXL15	CUL1	psi-mi:“MI:0914”(association)	0.840
CUL1	ARIH1	psi-mi:“MI:0915”(physical association)	0.770
ARIH1	CUL1	psi-mi:“MI:0915”(physical association)	0.770
SRP9	SRP72	psi-mi:“MI:0914”(association)	0.730
ARIH1	UBE2L3	psi-mi:“MI:0407”(direct interaction)	0.680
TGIF2LY	PGP	psi-mi:“MI:0914”(association)	0.640
SPANXN3	SUOX	psi-mi:“MI:0914”(association)	0.640
CUL3	ENC1	psi-mi:“MI:0914”(association)	0.640
PRPF31	PRPF4	psi-mi:“MI:0914”(association)	0.640
SKP1	MYCBP2	psi-mi:“MI:0914”(association)	0.640
ARIH1	UBE2L3	psi-mi:“MI:0914”(association)	0.640
ZNF35	ARIH1	psi-mi:“MI:0915”(physical association)	0.590
MAGEE2	ARIH1	psi-mi:“MI:0915”(physical association)	0.560
TNFAIP3	UBB	psi-mi:“MI:0914”(association)	0.530
ARIH1	SPOP	psi-mi:“MI:0914”(association)	0.530
KLHDC2	PFDN1	psi-mi:“MI:0914”(association)	0.530

BioGRID (472): UBE2E2 (Reconstituted Complex), ARIH1 (Reconstituted Complex), ARIH1 (Affinity Capture-MS), UBE2L3 (Affinity Capture-Western), CUL2 (Affinity Capture-Western), CUL3 (Affinity Capture-Western), CUL4A (Affinity Capture-Western), ARIH1 (Affinity Capture-MS), ARIH1 (Affinity Capture-MS), ARIH1 (Affinity Capture-MS), ARIH1 (Affinity Capture-MS), ARIH1 (Affinity Capture-MS), ARIH1 (Affinity Capture-MS), ARIH1 (Affinity Capture-MS), ARIH1 (Two-hybrid)

ESM2 similar proteins: A2VEA3, B1H1E4, D3Z7P3, F1LSG8, O89050, O94925, P13264, P50876, P97834, Q07G17, Q08211, Q12800, Q13042, Q28141, Q28D01, Q2NL67, Q32NS4, Q3MHJ2, Q4R9A8, Q4VC33, Q5F398, Q5NVP9, Q5R532, Q5R874, Q5RB35, Q5RBB8, Q5RBN9, Q5RKJ1, Q6AYU1, Q6GR10, Q6NRT5, Q6NW85, Q6PFJ9, Q7L5Y9, Q7SXR3, Q7Z6J6, Q86TJ2, Q8C6G8, Q8CI71, Q8R349

Diamond homologs: A2VEA3, A5PK27, B1H1E4, O01965, O76924, O95376, P0C8K8, P36113, P50876, Q22431, Q32NS4, Q54CX4, Q5UQ35, Q6NW85, Q6PFJ9, Q6T486, Q7Z419, Q84RQ8, Q84RR0, Q84RR2, Q8BKD6, Q8L829, Q8W468, Q925F3, Q94981, Q949V6, Q9C5A4, Q9LVW9, Q9LVX0, Q9P3U4, Q9SKC2, Q9SKC3, Q9SKC4, Q9Y4X5, Q9Z1K5, Q9Z1K6, A4IIY1, Q5RFV4, Q6DH94, A1Z9L3

SIGNOR signaling

8 interactions.

A	Effect	B	Mechanism
CUL1	“up-regulates activity”	ARIH1	binding
CUL2	“up-regulates activity”	ARIH1	binding
CUL3	“up-regulates activity”	ARIH1	binding
CUL4A	“up-regulates activity”	ARIH1	binding
ARIH1	“down-regulates quantity by destabilization”	EIF4E2	ubiquitination
Ub:E2	“up-regulates activity”	ARIH1	ubiquitination
ARIH1	“down-regulates quantity by destabilization”	CD274	polyubiquitination
ARIH1	“down-regulates quantity by destabilization”	CD274	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 117 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
MAP3K8 (TPL2)-dependent MAPK1/3 activation	5	42.5×	1e-05
Iron uptake and transport	5	20.6×	1e-04
Nuclear events stimulated by ALK signaling in cancer	5	19.4×	2e-04
Degradation of CRY and PER proteins	7	18.3×	1e-05
GSK3B and BTRC:CUL1-mediated-degradation of NFE2L2	6	17.7×	7e-05
Ubiquitin-Mediated Degradation of Phosphorylated Cdc25A	7	17.0×	2e-05
GSK3B-mediated proteasomal degradation of PD-L1(CD274)	6	17.0×	7e-05
NIK–>noncanonical NF-kB signaling	6	16.3×	7e-05

GO biological processes:

GO term	Partners	Fold	FDR
SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	8	27.5×	2e-07
protein monoubiquitination	5	15.8×	3e-03
protein K48-linked ubiquitination	7	10.8×	9e-04
protein polyubiquitination	7	7.4×	6e-03
protein ubiquitination	19	7.2×	1e-08
Wnt signaling pathway	7	6.4×	1e-02
proteasome-mediated ubiquitin-dependent protein catabolic process	13	6.2×	5e-05
ubiquitin-dependent protein catabolic process	8	5.5×	1e-02

Disease & clinical

Clinical variants and AI predictions

ClinVar

314 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	131
Likely benign	144
Benign	13

Top pathogenic / likely-pathogenic (0)

SpliceAI

2984 predictions. Top by Δscore:

Variant	Effect	Δscore
15:72518062:TTTA:T	acceptor_loss	1.0000
15:72518064:TAG:T	acceptor_loss	1.0000
15:72518064:TAGAA:T	acceptor_gain	1.0000
15:72518065:A:AG	acceptor_gain	1.0000
15:72518066:G:GG	acceptor_gain	1.0000
15:72518066:GA:G	acceptor_gain	1.0000
15:72518132:AAGGT:A	donor_loss	1.0000
15:72518133:AGGT:A	donor_loss	1.0000
15:72518135:GTAA:G	donor_loss	1.0000
15:72518136:T:G	donor_loss	1.0000
15:72544962:TCGG:T	donor_loss	1.0000
15:72544963:CGGT:C	donor_loss	1.0000
15:72544964:GGT:G	donor_loss	1.0000
15:72544965:G:GA	donor_loss	1.0000
15:72544966:T:A	donor_loss	1.0000
15:72544967:GAGTA:G	donor_loss	1.0000
15:72555265:TTACA:T	acceptor_loss	1.0000
15:72555266:TACAG:T	acceptor_loss	1.0000
15:72555267:ACAG:A	acceptor_loss	1.0000
15:72555268:CAGT:C	acceptor_loss	1.0000
15:72555269:A:AG	acceptor_gain	1.0000
15:72555269:AGTA:A	acceptor_loss	1.0000
15:72555270:G:GA	acceptor_gain	1.0000
15:72555270:GT:G	acceptor_gain	1.0000
15:72555270:GTAT:G	acceptor_gain	1.0000
15:72555270:GTATT:G	acceptor_gain	1.0000
15:72555360:TCAG:T	donor_loss	1.0000
15:72555361:CAG:C	donor_loss	1.0000
15:72555362:AGGTA:A	donor_loss	1.0000
15:72555364:GT:G	donor_loss	1.0000

AlphaMissense

3744 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:72474978:G:A	M113I	1.000
15:72474978:G:C	M113I	1.000
15:72474978:G:T	M113I	1.000
15:72518086:G:C	R132T	1.000
15:72518086:G:T	R132I	1.000
15:72518087:A:C	R132S	1.000
15:72518087:A:T	R132S	1.000
15:72518092:T:C	L134P	1.000
15:72518095:T:A	L135H	1.000
15:72518095:T:C	L135P	1.000
15:72518109:T:A	W140R	1.000
15:72518109:T:C	W140R	1.000
15:72518110:G:C	W140S	1.000
15:72518110:G:T	W140L	1.000
15:72518111:G:C	W140C	1.000
15:72518111:G:T	W140C	1.000
15:72518125:T:C	L145P	1.000
15:72544932:T:A	C186S	1.000
15:72544932:T:C	C186R	1.000
15:72544933:G:A	C186Y	1.000
15:72544933:G:C	C186S	1.000
15:72544934:T:G	C186W	1.000
15:72544941:T:A	C189S	1.000
15:72544941:T:C	C189R	1.000
15:72544942:G:A	C189Y	1.000
15:72544942:G:C	C189S	1.000
15:72544943:C:G	C189W	1.000
15:72555289:T:A	C203S	1.000
15:72555289:T:C	C203R	1.000
15:72555290:G:A	C203Y	1.000

dbSNP variants (sampled 300 via entrez): RS1000016178 (15:72554633 G>A), RS1000043900 (15:72599485 T>A), RS1000046621 (15:72562374 G>A), RS1000069225 (15:72532745 T>G), RS1000100651 (15:72489870 C>T), RS1000114939 (15:72513642 A>G), RS1000126097 (15:72558651 G>A,T), RS1000138503 (15:72577292 A>G), RS1000146588 (15:72474546 A>C), RS1000148816 (15:72507957 A>C,T), RS1000168854 (15:72513966 C>T), RS1000224857 (15:72580400 AGAGATACCTTTGACATACT>A), RS1000258548 (15:72474200 G>A), RS1000261248 (15:72514215 G>C), RS1000279525 (15:72568860 G>A,T)

Disease associations

OMIM: gene MIM:605624 | disease phenotypes: MIM:607086

GenCC curated gene-disease

Disease	Classification	Inheritance
thoracic aortic aneurysm	Strong	Autosomal dominant

Mondo (3): familial thoracic aortic aneurysm and aortic dissection (MONDO:0019625), aortic aneurysm (MONDO:0005160), thoracic aortic aneurysm (MONDO:0005396)

Orphanet (1): Familial thoracic aortic aneurysm and aortic dissection (Orphanet:91387)

HPO phenotypes

1 total (1 of 1 shown, HPO-id order):

HPO	Term
HP:0004942	Aortic aneurysm

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D001014	Aortic Aneurysm	C14.907.055.239; C14.907.109.139
D017545	Aortic Aneurysm, Thoracic	C14.907.055.239.125; C14.907.109.139.125

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

48 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression, increases methylation	3
sodium arsenite	decreases expression, increases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	2
GSK-J4	increases expression	1
FR900359	increases phosphorylation	1
methylmercuric chloride	increases expression	1
bisphenol A	increases expression	1
sodium arsenate	increases abundance, increases expression	1
tetrahydropalmatine	decreases expression	1
arsenite	affects binding, decreases reaction	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
cobaltous chloride	increases expression	1
di-n-butylphosphoric acid	affects expression	1
benzyloxycarbonylleucyl-leucyl-leucine aldehyde	decreases reaction, increases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
ICG 001	decreases expression	1
2-morpholin-4-yl-6-thianthren-1-yl-pyran-4-one	increases expression, decreases reaction	1
abrine	increases expression	1
bisphenol S	increases expression	1
jinfukang	decreases expression	1
LDN 193189	affects cotreatment, increases expression	1
PCI 5002	affects cotreatment, increases expression	1
Temozolomide	increases expression	1
Acetaminophen	increases expression	1
Air Pollutants	affects expression, increases abundance	1
Arsenic	increases abundance, increases expression	1
Atrazine	increases expression	1
Benzo(a)pyrene	increases expression	1
Cisplatin	increases response to substance, affects binding, increases reaction, affects localization, increases expression	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_SD49	HAP1 ARIH1 (-) 1	Cancer cell line	Male
CVCL_XL50	HAP1 ARIH1 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

205 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00339053	PHASE4	UNKNOWN	Immunonutrition and Thoracoabdominal Aorta Aneurysm Repair
NCT02291718	PHASE4	COMPLETED	Thoracoabdominal Arortic CTA Study
NCT00094575	PHASE4	COMPLETED	Standard Open Surgery Versus Endovascular Repair of Abdominal Aortic Aneurysm (AAA)
NCT01033370	PHASE4	TERMINATED	A Safety and Efficacy Study of Blood Pressure Control in Acute Aortic Emergencies - A Pilot Study (PROMPT)
NCT01107366	PHASE4	WITHDRAWN	ATLANTIS:Extensive Type A Dissections and Thoracic/ Thoraco-Abdominal Aneurysms Repair With LupiAe Hybrid TechNique
NCT01354119	PHASE4	TERMINATED	Long-term Benefit of Aortic Stent-graft in Patients With Distal Aortic Dissection
NCT00478803	PHASE3	COMPLETED	Conservative Aortic Valve Surgery for Aortic Insufficiency and Aneurysms of the Aortic Root. CAVIAAR
NCT00671203	PHASE3	COMPLETED	Prevention of Colon Ischemia During Aortic Aneurysm (AAA) Repair
NCT05744219	PHASE3	RECRUITING	Improved Recovery by Iron Following Surgery With Blood Loss, the IRIS-trial
NCT00549354	PHASE2	UNKNOWN	Abdominal Aortic/Aorto-Iliac Aneurysm Endoluminal Graft Study
NCT00701142	PHASE2	COMPLETED	Haemocomplettan® P During Aortic Replacement
NCT01256372	PHASE2	COMPLETED	An Trial of Two Dosing Regimens of AP214 for the Prevention of Kidney Injury in Patients Undergoing Cardiac Surgery
NCT05350683	PHASE2	COMPLETED	Effect of Remote Ischemic Preconditioning on the Incidence of Contrast Induced Nephropathy in Patients Undergoing EVAR
NCT01033214	PHASE1	UNKNOWN	ENTRUST - TAArget® Thoracic Stent Graft Clinical Trial
NCT03998631	PHASE1	UNKNOWN	Comparison of Carbon Dioxide and Saline Flush to Saline Flush in TEVAR and TAVI Procedures to Reduce Cerebral Ischemia
NCT01523262	PHASE1	UNKNOWN	Preventing Myocardial Ischemia by Preconditioning in Elective Operation for Abdominal Aortic Aneurysm
NCT02729064	PHASE1	UNKNOWN	Intraoperative Nasal Insulin Effect on Plasma and CSF Insulin Concentration and Blood Glucose
NCT00604799	PHASE2/PHASE3	COMPLETED	VALOR: The Talent Thoracic Stent Graft System Clinical Study
NCT07483177	PHASE1/PHASE2	NOT_YET_RECRUITING	HEART: Pilot Randomized Controlled Trial
NCT00111176	Not specified	COMPLETED	STARZ-TX2 Clinical Study: Study of Thoracic Aortic Aneurysm Repair With the Zenith TX2 Endovascular Graft
NCT00413231	Not specified	COMPLETED	Valor II: The Valiant Thoracic Stent Graft System Clinical Study
NCT00435942	Not specified	COMPLETED	Phase II Study of the Safety and Efficacy of the Relay Thoracic Stent-Graft
NCT00549315	Not specified	UNKNOWN	Clinical Study of Thoracic Aortic Aneurysm Exclusion
NCT00583817	Not specified	ENROLLING_BY_INVITATION	Endovascular Treatment of Thoracic Aortic Disease
NCT00597870	Not specified	COMPLETED	Physician-Sponsored IDE for the Talent Endoluminal Stent Graft System for the Treatment of Thoracic Lesions
NCT00805948	Not specified	TERMINATED	Post-Approval Clinical Study of the Talent Thoracic Stent Graft to Treat Thoracic Aortic Aneurysms (THRIVE)
NCT01082172	Not specified	COMPLETED	South American Thoracic Stent-Graft Study
NCT01327742	Not specified	APPROVED_FOR_MARKETING	Phase II Clinical Study of the Safety and Efficacy of the Relay Thoracic Stent-Graft
NCT01390181	Not specified	TERMINATED	The Effect of Losartan in Bicuspid Aortic Valve Patients
NCT01480206	Not specified	COMPLETED	Overlay of 3D Scans on Live Fluoroscopy for Endovascular Procedures in the Hybrid OR
NCT01839695	Not specified	COMPLETED	Safety and Efficacy of Valiant Mona LSA Stent Graft System
NCT02010892	Not specified	UNKNOWN	Effective Treatments for Thoracic Aortic Aneurysms (ETTAA Study): A Prospective Cohort Study
NCT02164201	Not specified	COMPLETED	Post Market Surveillance Study Evaluating BioFoam Surgical Matrix in Cardiovascular Surgery
NCT02256163	Not specified	COMPLETED	Identification of Genes and Pathogenesis Involved in Familial Thoracic Aortic Aneurysm
NCT02365454	Not specified	COMPLETED	NEXUS™ Aortic Arch Stent Graft System First In Man Study
NCT02735720	Not specified	TERMINATED	The CardiOvascular Remodeling Following Endovascular Aortic Repair (CORE) Study
NCT03142074	Not specified	RECRUITING	Biomechanical and Microstructural Properties of Ascending Aortic Aneurysms
NCT03440697	Not specified	ACTIVE_NOT_RECRUITING	Pathogenetic Basis of Aortopathy and Aortic Valve Disease
NCT03824626	Not specified	UNKNOWN	Biomechanical Reappraisal of Planning for Thoracic Endovascular Aortic Repair
NCT04083118	Not specified	COMPLETED	Assessment of Risk in Thoracic Aortopathy Using 18F-Sodium Fluoride