ARMC5

Summary

ARMC5 (armadillo repeat containing 5, HGNC:25781) is a protein-coding gene on chromosome 16p11.2, encoding Armadillo repeat-containing protein 5 (Q96C12). Substrate-recognition component of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex that terminates RNA polymerase II (Pol II) transcription in the promoter-proximal region of genes. It is a selective cancer dependency (DepMap: 29.3% of cell lines).

This gene encodes a member of the ARM (armadillo/beta-catenin-like repeat) superfamily. The ARM repeat is a tandemly repeated sequence motif with approximately 40 amino acid long. This repeat is implicated in mediating protein-protein interactions. The encoded protein contains seven ARM repeats. Mutations in this gene are associated with primary bilateral macronodular adrenal hyperplasia, which is also known as ACTH-independent macronodular adrenal hyperplasia 2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 79798 — RefSeq curated summary.

At a glance

• Gene–disease (curated): ACTH-independent macronodular adrenal hyperplasia 2 (Definitive, GenCC) — +1 more curated relationship
• Clinical variants (ClinVar): 315 total — 16 pathogenic, 14 likely-pathogenic
• Phenotypes (HPO): 45
• Cancer dependency (DepMap): dependent in 29.3% of screened cell lines
• MANE Select transcript: NM_001105247

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25781
Approved symbol	ARMC5
Name	armadillo repeat containing 5
Location	16p11.2
Locus type	gene with protein product
Status	Approved
Aliases	FLJ13063
Ensembl gene	ENSG00000140691
Ensembl biotype	protein_coding
OMIM	615549
Entrez	79798

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 8 protein_coding, 1 nonsense_mediated_decay, 1 retained_intron

ENST00000268314, ENST00000408912, ENST00000457010, ENST00000563544, ENST00000564514, ENST00000564900, ENST00000570119, ENST00000886859, ENST00000948131, ENST00000948132

RefSeq mRNA: 4 — MANE Select: NM_001105247 NM_001105247, NM_001288767, NM_001301820, NM_024742

CCDS: CCDS42155, CCDS45472, CCDS73874

Canonical transcript exons

ENST00000268314 — 6 exons

Exon	Start	End
ENSE00001112689	31464394	31464887
ENSE00001191517	31465850	31465982
ENSE00001578814	31462131	31462917
ENSE00002232111	31459501	31459999
ENSE00002319775	31466079	31467165
ENSE00003643571	31461922	31462029

Expression profiles

Bgee: expression breadth ubiquitous, 246 present calls, max score 93.52.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 7.6150 / max 142.0891, expressed in 1774 samples.

FANTOM5 promoters (8 alternative TSS)

Promoter ID	TPM avg	Samples expressed
153830	4.9482	1715
153827	0.7149	342
153828	0.6281	193
207844	0.4173	215
153824	0.3765	191
153826	0.2852	110
153829	0.1327	47
153825	0.1121	35

Top tissues by expression

256 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pancreatic ductal cell	CL:0002079	93.52	silver quality
tendon of biceps brachii	UBERON:0008188	93.15	gold quality
vena cava	UBERON:0004087	89.25	gold quality
nasal cavity epithelium	UBERON:0005384	88.73	gold quality
cerebellar vermis	UBERON:0004720	88.29	gold quality
parotid gland	UBERON:0001831	87.88	gold quality
right lobe of liver	UBERON:0001114	87.78	gold quality
upper arm skin	UBERON:0004263	86.81	silver quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	85.46	gold quality
kidney epithelium	UBERON:0004819	84.79	silver quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	84.74	gold quality
gastrocnemius	UBERON:0001388	84.48	gold quality
apex of heart	UBERON:0002098	84.46	gold quality
myocardium	UBERON:0002349	84.41	silver quality
body of tongue	UBERON:0011876	84.40	gold quality
gingival epithelium	UBERON:0001949	83.93	silver quality
granulocyte	CL:0000094	83.36	gold quality
biceps brachii	UBERON:0001507	83.36	gold quality
medial globus pallidus	UBERON:0002477	83.14	gold quality
liver	UBERON:0002107	82.86	gold quality
vastus lateralis	UBERON:0001379	82.85	silver quality
gingiva	UBERON:0001828	82.85	gold quality
right lobe of thyroid gland	UBERON:0001119	82.73	gold quality
muscle of leg	UBERON:0001383	82.68	gold quality
epithelial cell of pancreas	CL:0000083	82.59	silver quality
pons	UBERON:0000988	82.51	gold quality
mucosa of transverse colon	UBERON:0004991	82.42	gold quality
globus pallidus	UBERON:0001875	82.25	gold quality
skeletal muscle tissue	UBERON:0001134	82.20	gold quality
quadriceps femoris	UBERON:0001377	82.17	silver quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	2.82

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

61 targeting ARMC5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-338-5P	99.92	72.34	2951
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-369-3P	99.85	70.52	2264
HSA-MIR-374C-5P	99.80	72.06	2910
HSA-MIR-655-3P	99.80	72.19	2909
HSA-MIR-6842-5P	99.80	67.54	1587
HSA-MIR-7110-5P	99.80	67.84	1712
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-378G	99.71	64.90	1106
HSA-MIR-4530	99.69	66.47	1509
HSA-MIR-6752-5P	99.59	67.32	1243
HSA-MIR-1915-3P	99.58	66.79	1988
HSA-MIR-216A-5P	99.50	68.02	1288
HSA-MIR-1207-5P	99.49	69.11	2983
HSA-MIR-519D-5P	99.41	69.30	2057
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-5787	99.22	67.86	2628
HSA-MIR-4763-3P	99.10	67.83	2649
HSA-MIR-3619-5P	99.00	68.87	2308
HSA-MIR-330-5P	98.73	67.63	1788
HSA-MIR-7851-3P	98.72	64.88	980
HSA-MIR-214-3P	98.71	68.12	2128
HSA-MIR-761	98.71	68.07	2051
HSA-MIR-7155-5P	98.65	66.14	1290

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 29.3% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 31)

• Some cases of corticotropin-independent macronodular adrenal hyperplasia appear to be genetic, most often with inactivating mutations of ARMC5. (PMID:24283224)
• ARMC5 mutations are implicated in clinically severe Cushing’s syndrome associated with Macronodular adrenal hyperplasia. (PMID:24601692)
• Inherited autosomal dominant mutations in the ARMC5 gene are a frequent cause of primary macronodular adrenal hyperplasia. Biallelic inactivation of ARMC5 is consistent with its role as a potential tumor suppressor gene. (PMID:24708098)
• Our studies have detected ARMC5 mutations in 4 of 5 bilateral macronodular adrenal hyperplasia families tested. (PMID:24905064)
• Germline ARMC5 variants may be associated with primary aldosteronism. (PMID:25822102)
• ARMC5 germline mutations are common in primary macronodular adrenal hyperplasia(PBMAH).ARMC5 genotyping may help to identify clinical forms of PBMAH better and may also allow earlier diagnosis of this disease. (PMID:25853793)
• This is the first report demonstrating germline deletion of ARMC5 in familial primary macronodular adrenal hyperplasia. (PMID:26214113)
• ARMC5 mutations are not present in a fairly large series of Caucasian patients with primary aldosteronism associated with bilateral adrenal disease. (PMID:26446392)
• study describes members of a French-Canadian bilateral macronodular adrenal hyperplasia kindred with beta-adrenergic and V1-vasopressin regulation of cortisol including 7 with subclinical and 2 with clinical Cushing syndrome; a heterozygous germline ARMC5 mutation was identified in the index case that segregates with the disease (PMID:26604299)
• ARMC5 mutations are frequent in cortisol-secreting primary bilateral macronodular adrenal hyperplasia and seem to be associated with a particular pattern of the adrenal masses. (PMID:27094308)
• ARMC5 expression pattern in human tissues is reported. (PMID:27568465)
• the involvement of ARMC5 in controlling proliferation and regulating cell cycle in primary macronodular adrenocortical hyperplasia cell cultures. (PMID:28676429)
• Research Letter: familial hyperaldosteronism type II does not appear to be caused by germline ARMC5 variants. (PMID:29022889)
• The ARMC5 germline alterations c.1214delG (p.(Gly405Alafs*56)), c.318delG (p.(Ser107Argfs*30)), c.2564delT (p.(Val855Glyfs*62)), c.622_623insC (p.(Gln208Profs*15)) and c.523delG (p.(Ala175Profs*7)) were identified in 5 out of the 23 (21.7%) sporadic primary bilateral macronodular adrenal hyperplasia patients. (PMID:29370219)
• ARMC 5 Variants and Risk of Hypertension in Blacks: MH- GRID Study. (PMID:31266387)
• Cullin 3 targets the tumor suppressor gene ARMC5 for ubiquitination and degradation. (PMID:32023208)
• Allelic Variants of ARMC5 in Patients With Adrenal Incidentalomas and in Patients With Cushing’s Syndrome Associated With Bilateral Adrenal Nodules. (PMID:32117062)
• ARMC5 mutations are associated with high levels of proliferating cell nuclear antigen and the presence of the serotonin receptor 5HT4R in PMAH nodules. (PMID:32267363)
• The Association of ARMC5 with the Renin-Angiotensin-Aldosterone System, Blood Pressure, and Glycemia in African Americans. (PMID:32436940)
• ARMC5 variants in PRKAR1A-mutated patients modify cortisol levels and Cushing’s syndrome. (PMID:32638579)
• ARMC5 Alterations in Patients With Sporadic Neuroendocrine Tumors and Multiple Endocrine Neoplasia Type 1 (MEN1). (PMID:32901291)
• Deubiquitylation and stabilization of ARMC5 by ubiquitin-specific processing protease 7 (USP7) are critical for RCC proliferation. (PMID:33544460)
• Identification of predictive criteria for pathogenic variants of primary bilateral macronodular adrenal hyperplasia (PBMAH) gene ARMC5 in 352 unselected patients. (PMID:35521700)
• ARMC5 is part of an RPB1-specific ubiquitin ligase implicated in adrenal hyperplasia. (PMID:35687106)
• Tumor suppressor gene ARMC5 controls adrenal redox state through NRF1 turnover. (PMID:36040830)
• New pathogenic variants in ARMC5 gene in a series of Italian patients affected by primary bilateral macronodular adrenocortical hyperplasia (PBMAH). (PMID:36727580)
• Morphological Harbingers of ARMC5-Pathogenic Variant-Related Bilateral Macronodular Adrenocortical Disease. (PMID:37043100)
• Prevalence and clinical features of armadillo repeat-containing 5 mutations carriers in a single center cohort of patients with bilateral adrenal incidentalomas. (PMID:37625448)
• ARMC5 controls the degradation of most Pol II subunits, and ARMC5 mutation increases neural tube defect risks in mice and humans. (PMID:38225631)
• Familial bilateral macronodular adrenal hyperplasia due to a novel ARMC 5 germline mutation: Clinical status and possible association with other neoplasms. (PMID:38555108)
• Neuroradiological features of patients with bilateral macronodular adrenocortical disease and meningiomas associated or not with genetic variants of ARMC5- a case series. (PMID:38630387)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	armc5	ENSDARG00000078083
mus_musculus	Armc5	ENSMUSG00000042178
rattus_norvegicus	Armc5	ENSRNOG00000019935
drosophila_melanogaster	Rnb	FBGN0039696
caenorhabditis_elegans	T28F4.4	WBGENE00012139

Protein

Protein identifiers

Armadillo repeat-containing protein 5 — Q96C12 (reviewed: Q96C12)

All UniProt accessions (4): Q96C12, A0A1D5RMU3, H3BS74, J3KQ26

UniProt curated annotations — full annotation on UniProt →

Function. Substrate-recognition component of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex that terminates RNA polymerase II (Pol II) transcription in the promoter-proximal region of genes. The BCR(ARMC5) complex provides a quality checkpoint during transcription elongation by driving premature transcription termination of transcripts that are unfavorably configured for transcriptional elongation: the BCR(ARMC5) complex acts by mediating ubiquitination of Pol II subunit POLR2A phosphorylated at ‘Ser-5’ of the C-terminal domain (CTD), leading to POLR2A degradation. The BCR(ARMC5) complex acts in parallel of the integrator complex and is specific for RNA Pol II originating from the promoter-proximal zone: it does not ubiquitinate elongation-stalled RNA Pol II. The BCR(ARMC5) complex also acts as a regulator of fatty acid desaturation by mediating ubiquitination and degradation of SCAP-free SREBF1 and SREBF2. Involved in fetal development, T-cell function and adrenal gland growth homeostasis. Plays a role in steroidogenesis, modulates steroidogenic enzymes expression and cortisol production.

Subunit / interactions. Substrate-recognition component of the BCR(ARMC5) E3 ubiquitin ligase complex, at least composed of CUL3, ARMC5 and RBX1.

Subcellular location. Nucleus. Chromosome. Cytoplasm.

Post-translational modifications. Ubiquitinated by a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex, leading to its degradation. Deubiquitinated by USP7.

Disease relevance. ACTH-independent macronodular adrenal hyperplasia 2 (AIMAH2) [MIM:615954] A form of macronodular adrenal hyperplasia characterized by multiple, bilateral, non-pigmented, benign, adrenocortical nodules. It results in excessive production of cortisol leading to ACTH-independent Cushing syndrome. Clinical manifestations of Cushing syndrome include facial and truncal obesity, abdominal striae, muscular weakness, osteoporosis, arterial hypertension, diabetes. The disease is caused by variants affecting the gene represented in this entry.

Pathway. Protein modification; protein ubiquitination.

Isoforms (4)

UniProt ID	Names	Canonical?
Q96C12-1	1	yes
Q96C12-2	2
Q96C12-3	3
Q96C12-4	4

RefSeq proteins (4): NP_001098717, NP_001275696, NP_001288749, NP_079018 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000210	BTB/POZ_dom	Domain
IPR000225	Armadillo	Repeat
IPR011333	SKP1/BTB/POZ_sf	Homologous_superfamily
IPR011989	ARM-like	Homologous_superfamily
IPR016024	ARM-type_fold	Homologous_superfamily
IPR055445	ARM_ARMC5	Domain

Pfam: PF24768

UniProt features (80 total): sequence variant 60, repeat 7, splice variant 4, region of interest 3, compositionally biased region 3, chain 1, modified residue 1, domain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96C12-F1	81.27	0.59

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 341

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 236 (showing top): GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, GOBP_FORMATION_OF_PRIMARY_GERM_LAYER, GOBP_ALPHA_BETA_T_CELL_DIFFERENTIATION, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS, CAGCTG_AP4_Q5, GOBP_ORGANIC_ACID_BIOSYNTHETIC_PROCESS, GOBP_REGULATION_OF_LIPID_BIOSYNTHETIC_PROCESS, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, GOBP_REGULATION_OF_LIPID_METABOLIC_PROCESS, GOBP_RNA_SURVEILLANCE, GOBP_CD4_POSITIVE_ALPHA_BETA_T_CELL_ACTIVATION, GOBP_LEUKOCYTE_PROLIFERATION

GO Biological Process (14): in utero embryonic development (GO:0001701), mesoderm formation (GO:0001707), anatomical structure morphogenesis (GO:0009653), adrenal cortex development (GO:0035801), T cell proliferation (GO:0042098), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), CD4-positive, alpha-beta T cell differentiation (GO:0043367), regulation of steroid biosynthetic process (GO:0050810), defense response to virus (GO:0051607), RNA polymerase II transcription initiation surveillance (GO:0160240), transcription by RNA polymerase II (GO:0006366), transcription elongation by RNA polymerase II (GO:0006368), gastrulation (GO:0007369), hemopoiesis (GO:0030097)

GO Molecular Function (2): ubiquitin-like ligase-substrate adaptor activity (GO:1990756), protein binding (GO:0005515)

GO Cellular Component (9): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), focal adhesion (GO:0005925), membrane (GO:0016020), Cul3-RING ubiquitin ligase complex (GO:0031463), chromosome (GO:0005694)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
anatomical structure development	2
chordate embryonic development	1
formation of primary germ layer	1
mesoderm morphogenesis	1
developmental process	1
adrenal gland development	1
T cell activation	1
lymphocyte proliferation	1
ubiquitin-dependent protein catabolic process	1
proteasomal protein catabolic process	1
CD4-positive, alpha-beta T cell activation	1
alpha-beta T cell differentiation	1
steroid biosynthetic process	1
regulation of steroid metabolic process	1
regulation of lipid biosynthetic process	1
defense response	1
response to virus	1
transcription initiation at RNA polymerase II promoter	1
nuclear RNA surveillance	1
DNA-templated transcription	1
DNA-templated transcription elongation	1
transcription by RNA polymerase II	1
ectoderm formation	1
endoderm formation	1
mesoderm formation	1
embryonic morphogenesis	1
cell development	1
enzyme-substrate adaptor activity	1
binding	1
chromosome	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
cytoplasm	1
cell-substrate junction	1
cullin-RING ubiquitin ligase complex	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

426 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ARMC5	PDE11A	Q9HCR9	724
ARMC5	PDE8B	O95263	719
ARMC5	ATP2B3	Q16720	665
ARMC5	PRKAR1A	P10644	663
ARMC5	KCNJ5	P48544	624
ARMC5	ATP1A1	P05023	583
ARMC5	MC2R	Q01718	582
ARMC5	ATP1A4	Q13733	579
ARMC5	CYP11B2	P19099	573
ARMC5	POMC	P01189	571
ARMC5	ATP1A3	P13637	545
ARMC5	CACNA1D	Q01668	541
ARMC5	MEN1	O00255	527
ARMC5	GNAS	Q5JWF2	527
ARMC5	CACNA1H	O95180	507

IntAct

49 interactions, top by confidence:

A	B	Type	Score
POLR2G	RECQL5	psi-mi:“MI:0914”(association)	0.730
RPRD1B	POLR2D	psi-mi:“MI:0914”(association)	0.730
MKRN3	ARMC5	psi-mi:“MI:0915”(physical association)	0.560
ARMC5	SPAG8	psi-mi:“MI:0915”(physical association)	0.560
PRR35	ARMC5	psi-mi:“MI:0915”(physical association)	0.560
USHBP1	ARMC5	psi-mi:“MI:0915”(physical association)	0.560
GLYCTK	ARMC5	psi-mi:“MI:0915”(physical association)	0.560
ARMC5	ENKD1	psi-mi:“MI:0915”(physical association)	0.560
ARMC5	CNOT2	psi-mi:“MI:0915”(physical association)	0.560
TLX3	ARMC5	psi-mi:“MI:0915”(physical association)	0.560
COL8A1	ARMC5	psi-mi:“MI:0915”(physical association)	0.560
CUL3	RHOBTB1	psi-mi:“MI:0914”(association)	0.530
DXO	RECQL5	psi-mi:“MI:0914”(association)	0.530
POLR2J	MED14	psi-mi:“MI:0914”(association)	0.530
ARMC5	HSP90AB1	psi-mi:“MI:0915”(physical association)	0.400
Hacd3	ARMC5	psi-mi:“MI:0915”(physical association)	0.400
ARMC5		psi-mi:“MI:0915”(physical association)	0.400
RIPK4	VWA8	psi-mi:“MI:0914”(association)	0.350
KIE-2	SIAH2	psi-mi:“MI:0914”(association)	0.350
CUL3	PXDNL	psi-mi:“MI:0914”(association)	0.350
CUL3	KLHL2	psi-mi:“MI:0914”(association)	0.350
LMO2	APBB1	psi-mi:“MI:0914”(association)	0.350
LMO2	POLR2D	psi-mi:“MI:0914”(association)	0.350
ARMC5	MYZAP	psi-mi:“MI:0914”(association)	0.350

BioGRID (226): ARMC5 (Affinity Capture-MS), ARMC5 (Affinity Capture-MS), ARMC5 (Affinity Capture-MS), ARMC5 (Affinity Capture-MS), ARMC5 (Affinity Capture-MS), ARMC5 (Affinity Capture-MS), ARMC5 (PCA), ARMC5 (Affinity Capture-RNA), ARMC5 (Two-hybrid), ARMC5 (Two-hybrid), ARMC5 (Two-hybrid), ARMC5 (Two-hybrid), COL8A1 (Two-hybrid), PRR35 (Two-hybrid), TLX3 (Two-hybrid)

ESM2 similar proteins: A1A4I4, A5PKD8, A6NED2, A8MQ27, O35465, O60294, O75808, O94819, O95382, P70268, Q0MW30, Q14318, Q16512, Q2T9J0, Q32NY4, Q32P44, Q3B7U9, Q3MHW0, Q3U5Q7, Q3USL1, Q4R828, Q561R2, Q5EBM0, Q5EBP3, Q5PQP9, Q60806, Q63433, Q6PAT0, Q7T0L4, Q8BNW9, Q8BTU7, Q8BYR1, Q8IYL2, Q8N5A5, Q8NEP7, Q8VC03, Q8VHS5, Q8WXI3, Q91ZT7, Q96C12

Diamond homologs: Q5EBP3, Q5PQP9, Q96C12

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

315 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	16
Likely pathogenic	14
Uncertain significance	177
Likely benign	65
Benign	21

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1323417	NM_001105247.2(ARMC5):c.2290C>T (p.Arg764Ter)	Pathogenic
1339346	NM_001105247.2(ARMC5):c.174dup (p.Glu59fs)	Pathogenic
1339347	NM_001105247.2(ARMC5):c.2025del (p.Leu676fs)	Pathogenic
1341364	NM_001105247.2(ARMC5):c.283_286del (p.Ser95fs)	Pathogenic
144052	NM_001105247.2(ARMC5):c.799C>T (p.Arg267Ter)	Pathogenic
144053	NM_001105247.2(ARMC5):c.2692C>T (p.Arg898Trp)	Pathogenic
144054	NM_001105247.2(ARMC5):c.256C>T (p.Gln86Ter)	Pathogenic
144055	NM_001105247.2(ARMC5):c.1643T>C (p.Leu548Pro)	Pathogenic
144056	NM_001105247.2(ARMC5):c.170del (p.Gly57fs)	Pathogenic
144058	NM_001105247.2(ARMC5):c.1094T>C (p.Leu365Pro)	Pathogenic
1693528	NM_001105247.2(ARMC5):c.2436del (p.Cys813fs)	Pathogenic
1803212	NM_001105247.2(ARMC5):c.1199_1224dup (p.Ala409fs)	Pathogenic
2575996	NM_001105247.2(ARMC5):c.517C>T (p.Arg173Ter)	Pathogenic
3031151	NM_001105247.2(ARMC5):c.327dup (p.Ala110fs)	Pathogenic
3048615	NM_001105247.2(ARMC5):c.1090C>T (p.Arg364Ter)	Pathogenic
4146938	NM_001105247.2(ARMC5):c.595del (p.Leu199fs)	Pathogenic
1162263	NM_001105247.2(ARMC5):c.1724_1753delinsAT (p.Cys575fs)	Likely pathogenic
1339342	NM_001105247.2(ARMC5):c.968G>A (p.Gly323Asp)	Likely pathogenic
1339343	NM_001105247.2(ARMC5):c.1787T>G (p.Leu596Arg)	Likely pathogenic
1339344	NM_001105247.2(ARMC5):c.2432G>C (p.Arg811Pro)	Likely pathogenic
1342711	NM_001105247.2(ARMC5):c.2105C>A (p.Ala702Glu)	Likely pathogenic
2632699	NM_001105247.2(ARMC5):c.1502del (p.Pro501fs)	Likely pathogenic
3346812	NM_001105247.2(ARMC5):c.1999A>T (p.Lys667Ter)	Likely pathogenic
3580272	NM_001105247.2(ARMC5):c.1197T>G (p.Tyr399Ter)	Likely pathogenic
3580273	NM_001105247.2(ARMC5):c.2497G>T (p.Glu833Ter)	Likely pathogenic
3602762	NM_001105247.2(ARMC5):c.943C>T (p.Arg315Trp)	Likely pathogenic
4526752	NM_001105247.2(ARMC5):c.476-374_1370+221del	Likely pathogenic
4532321	NM_001105247.2(ARMC5):c.170dup (p.Ile58fs)	Likely pathogenic
4823901	NM_001105247.2(ARMC5):c.1118del (p.Leu373fs)	Likely pathogenic
666958	NM_001105247.2(ARMC5):c.1767_1771dup (p.Leu591fs)	Likely pathogenic

SpliceAI

744 predictions. Top by Δscore:

Variant	Effect	Δscore
16:31459998:GG:G	donor_gain	1.0000
16:31459999:GG:G	donor_gain	1.0000
16:31461919:CAGT:C	acceptor_loss	1.0000
16:31461920:A:AG	acceptor_gain	1.0000
16:31461920:AGT:A	acceptor_gain	1.0000
16:31461921:G:GC	acceptor_gain	1.0000
16:31461921:GT:G	acceptor_gain	1.0000
16:31461921:GTG:G	acceptor_gain	1.0000
16:31462026:GCTG:G	donor_gain	1.0000
16:31462029:GGTA:G	donor_loss	1.0000
16:31462030:G:GG	donor_gain	1.0000
16:31462030:GTA:G	donor_loss	1.0000
16:31462031:T:G	donor_loss	1.0000
16:31462122:T:A	acceptor_gain	1.0000
16:31462126:CTCA:C	acceptor_loss	1.0000
16:31462127:TCA:T	acceptor_loss	1.0000
16:31462128:CAG:C	acceptor_loss	1.0000
16:31462129:A:AG	acceptor_gain	1.0000
16:31462129:AGGT:A	acceptor_gain	1.0000
16:31462130:G:GT	acceptor_gain	1.0000
16:31462130:GGT:G	acceptor_gain	1.0000
16:31462130:GGTG:G	acceptor_gain	1.0000
16:31462376:C:G	donor_gain	1.0000
16:31465848:A:AG	acceptor_gain	1.0000
16:31465849:G:GG	acceptor_gain	1.0000
16:31459995:TTTGG:T	donor_gain	0.9900
16:31459996:TTGG:T	donor_gain	0.9900
16:31460000:G:GG	donor_gain	0.9900
16:31460000:GTA:G	donor_loss	0.9900
16:31461921:GTGA:G	acceptor_gain	0.9900

AlphaMissense

5790 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:31462630:C:A	N361K	0.998
16:31462630:C:G	N361K	0.998
16:31462343:A:C	S266R	0.997
16:31462345:C:A	S266R	0.997
16:31462345:C:G	S266R	0.997
16:31462736:T:C	F397L	0.997
16:31462738:T:A	F397L	0.997
16:31462738:T:G	F397L	0.997
16:31465882:G:C	A633P	0.997
16:31466336:T:C	F752S	0.997
16:31462737:T:C	F397S	0.996
16:31464618:T:C	F532S	0.996
16:31465871:T:C	L629P	0.996
16:31465898:G:A	G638E	0.996
16:31462368:C:A	A274D	0.995
16:31462503:G:A	G319D	0.995
16:31462620:A:T	E358V	0.995
16:31462746:A:T	D400V	0.995
16:31464621:C:T	S533F	0.995
16:31465883:C:A	A633D	0.995
16:31465897:G:T	G638W	0.995
16:31464648:T:A	L542H	0.994
16:31464741:T:C	L573P	0.994
16:31465894:T:C	F637L	0.994
16:31465896:T:A	F637L	0.994
16:31465896:T:G	F637L	0.994
16:31466402:T:C	F774S	0.994
16:31466425:T:C	F782L	0.994
16:31466427:T:A	F782L	0.994
16:31466427:T:G	F782L	0.994

dbSNP variants (sampled 300 via entrez): RS1000315832 (16:31464458 G>C), RS1000323146 (16:31458972 T>A,C), RS1000569118 (16:31458744 C>T), RS1001186505 (16:31463591 G>A), RS1001301703 (16:31457637 TAG>T), RS1001311369 (16:31456680 CTACCCCTGGCTCTCACATACACAAAGTTATGCCA>C), RS1001713506 (16:31467267 G>A), RS1001992748 (16:31462974 G>A), RS1002080774 (16:31459015 C>A,T), RS1002107452 (16:31463358 T>C), RS1002148762 (16:31457921 C>T), RS1002622442 (16:31459991 T>A,C,G), RS1002860403 (16:31464550 C>A,T), RS1003235989 (16:31460159 C>G,T), RS1003301079 (16:31459816 T>A,C)

Disease associations

OMIM: gene MIM:615549 | disease phenotypes: MIM:615954, MIM:219080

GenCC curated gene-disease

Disease	Classification	Inheritance
ACTH-independent macronodular adrenal hyperplasia 2	Definitive	Autosomal dominant
Cushing syndrome due to macronodular adrenal hyperplasia	Supportive	Autosomal dominant

Mondo (3): ACTH-independent macronodular adrenal hyperplasia 2 (MONDO:0014416), Cushing syndrome due to macronodular adrenal hyperplasia (MONDO:0009049), hereditary neoplastic syndrome (MONDO:0015356)

Orphanet (2): Cushing syndrome due to bilateral macronodular adrenocortical disease (Orphanet:189427), Inherited cancer-predisposing syndrome (Orphanet:140162)

HPO phenotypes

45 total (30 of 45 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000311	Round face
HP:0000712	Emotional lability
HP:0000716	Depression
HP:0000725	Psychotic episodes
HP:0000787	Nephrolithiasis
HP:0000822	Hypertension
HP:0000858	Irregular menstruation
HP:0000859	Increased circulating aldosterone concentration
HP:0000939	Osteoporosis
HP:0000978	Bruising susceptibility
HP:0001007	Hirsutism
HP:0001050	Plethora
HP:0001061	Acne
HP:0001065	Striae distensae
HP:0001397	Hepatic steatosis
HP:0001442	Typified by somatic mosaicism
HP:0001596	Alopecia
HP:0001952	Glucose intolerance
HP:0002354	Memory impairment
HP:0002659	Increased susceptibility to fractures
HP:0002858	Meningioma
HP:0002893	Pituitary adenoma
HP:0002920	Decreased circulating ACTH concentration
HP:0003074	Hyperglycemia
HP:0003077	Hyperlipidemia
HP:0003118	Increased circulating cortisol level
HP:0003466	Paradoxical increased cortisol secretion on dexamethasone suppression test
HP:0003581	Adult onset
HP:0003701	Proximal muscle weakness

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
C565662	Acth-Independent Macronodular Adrenal Hyperplasia (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

21 total (human), top 21 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tobacco Smoke Pollution	increases expression	2
aristolochic acid I	increases expression	1
sodium arsenite	increases expression	1
butyraldehyde	increases expression	1
ferrous chloride	decreases expression	1
cupric chloride	increases expression	1
di-n-butylphosphoric acid	affects expression	1
ICG 001	decreases expression	1
abrine	increases expression	1
Resveratrol	decreases expression, affects cotreatment	1
Leflunomide	decreases expression	1
Air Pollutants	affects expression, increases abundance	1
Benzo(a)pyrene	increases methylation	1
Cycloheximide	affects cotreatment, increases expression	1
Ozone	increases abundance, affects expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Tetrachlorodibenzodioxin	affects cotreatment, increases expression	1
Thiram	increases expression	1
Urethane	decreases expression	1
Valproic Acid	increases methylation	1
Cadmium Chloride	increases expression	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_SD52	HAP1 ARMC5 (-) 1	Cancer cell line	Male
CVCL_SD53	HAP1 ARMC5 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

31 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02468193	PHASE2	COMPLETED	Study of Efficacy and Safety of Osilodrostat in Cushing’s Syndrome
NCT05436639	PHASE2	COMPLETED	SPI-62 as a Treatment for Hypercortisolism Related to a Benign Adrenal Tumor
NCT00001496	Not specified	COMPLETED	Establishment of Normal Breast Epithelial Cell Lines From Patients at High Risk for Breast Cancer
NCT00001898	Not specified	COMPLETED	Microarray Analysis for Human Genetic Disease
NCT00026884	Not specified	RECRUITING	Collection of Serum and Tissue Samples From Patients With Biopsy-Proved or Suspected Malignant Disease
NCT02289326	Not specified	COMPLETED	Biomarker Monitoring in TP53 Mutation Carriers
NCT02958462	Not specified	RECRUITING	Pre-myeloid Cancer and Bone Marrow Failure Clinic Study
NCT03160274	Not specified	RECRUITING	Genetic Analysis of Pheochromocytomas, Paragangliomas and Associated Conditions
NCT03426878	Not specified	COMPLETED	Cancer Health Assessments Reaching Many
NCT03857594	Not specified	ACTIVE_NOT_RECRUITING	Integrative Sequencing In Germline and Hereditary Tumours
NCT03973450	Not specified	UNKNOWN	Epidemiology of Pituitary Tumours: Prevalence of Associated Neoplasia
NCT03979612	Not specified	UNKNOWN	Evaluation of the Adhesion to the GENEPY Network
NCT04261972	Not specified	ACTIVE_NOT_RECRUITING	Cell-free DNA in Hereditary And High-Risk Malignancies 1
NCT04494945	Not specified	RECRUITING	Identifying and Caring for Individuals With Inherited Cancer Syndrome
NCT04541654	Not specified	RECRUITING	Li-Fraumeni & TP53 (LiFT UP): Understanding and Progress
NCT04763915	Not specified	ACTIVE_NOT_RECRUITING	Improving Care After Inherited Cancer Testing
NCT05562778	Not specified	RECRUITING	Chatbot to Maximize Hereditary Cancer Genetic Risk Assessment
NCT05664867	Not specified	RECRUITING	Implementation of Population Cancer Genetic Services in Federally Qualified Health Centers (FQHC)
NCT05721326	Not specified	COMPLETED	Sequential EHR Based Interventions to Increase Genetic Testing for Breast and Ovarian Cancer Predisposition
NCT06096688	Not specified	RECRUITING	Discovering New Targets for Colorectal and Endometrial Cancer Risk Reduction
NCT06654466	Not specified	RECRUITING	Closing the GAPS: Guideline Adherence, Prevention and Surveillance in Hereditary Cancer
NCT06708429	Not specified	RECRUITING	Lynch Syndrome X-Talk of Enteral Mucosa With Immune System
NCT06726642	Not specified	RECRUITING	CfDNA in Hereditary And High-risk Malignancies 2
NCT06914726	Not specified	ENROLLING_BY_INVITATION	Patient Centered Clinical Decision Support for Hereditary Cancer Syndromes
NCT06927947	Not specified	RECRUITING	Navigation Interventions to Improve Cascade Genetic Testing Among Relatives of Patients With Hereditary Cancer Syndromes
NCT06999954	Not specified	RECRUITING	Shwachman-Diamond Syndrome Global Patient Survey and Partnering Platform
NCT07052266	Not specified	RECRUITING	Trial of Combined Obstetric Carrier Screening and Hereditary Cancer Screening
NCT07195071	Not specified	RECRUITING	Feasibility Trial of Combination of Obstetrical Carrier Screening and Hereditary Cancer Screening
NCT07378423	Not specified	RECRUITING	Questionnaire on Congenital Cancer Signs Through Self-Assessment
NCT07381985	Not specified	ENROLLING_BY_INVITATION	Strategy for Management of Patients With Hereditary Cancer Syndromes (HCS) in a Rural Environment
NCT07542405	Not specified	NOT_YET_RECRUITING	A Web-Based Program (Kindred) to Improve the Understanding of Genetic Cancer Risk and Cancer Genetic Testing in African American Families