ART3

Summary

ART3 (ADP-ribosyltransferase 3 (inactive), HGNC:725) is a protein-coding gene on chromosome 4q21.1, encoding Ecto-ADP-ribosyltransferase 3 (Q13508).

This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 419 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 132 total — 1 pathogenic
• Regional missense constraint (gnomAD): 1 of 3 regions constrained (≈4% of expected missense variation)
• GTEx eGene: eQTL in 34 tissues, sQTL in 15 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.38 (unconstrained)
• MANE Select transcript: NM_001130016
• Notable: 132 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:725
Approved symbol	ART3
Name	ADP-ribosyltransferase 3 (inactive)
Location	4q21.1
Locus type	gene with protein product
Status	Approved
Aliases	ARTC3
Ensembl gene	ENSG00000156219
Ensembl biotype	protein_coding
OMIM	603086
Entrez	419

Gene structure

Transcript identifiers

Ensembl transcripts: 66 — 55 protein_coding, 6 protein_coding_CDS_not_defined, 4 nonsense_mediated_decay, 1 retained_intron

MANE Select: ENST00000355810

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 10, TSL 2: 1, TSL 3: 2, TSL 4: 2

ENST00000355810, ENST00000341029, ENST00000349321, ENST00000395688, ENST00000504112, ENST00000504914, ENST00000506313, ENST00000506667, ENST00000510423, ENST00000510669, ENST00000510863, ENST00000511188, ENST00000513122, ENST00000513353, ENST00000513494, ENST00000700440, ENST00000700441, ENST00000883925, ENST00000883926, ENST00000883927, ENST00000883928, ENST00000883929, ENST00000883930, ENST00000883931, ENST00000883932, ENST00000930906, ENST00000960237, ENST00000960238, ENST00000960239, ENST00000960240, ENST00000960241, ENST00000960242, ENST00000960243, ENST00000960244, ENST00000960245, ENST00000960246, ENST00000960247, ENST00000960248, ENST00000960249, ENST00000960250, ENST00000960251, ENST00000960252, ENST00000960253, ENST00000960254, ENST00000960255, ENST00000960256, ENST00000960257, ENST00001051700, ENST00001051701, ENST00001051702, ENST00001051703, ENST00001051704, ENST00001051705, ENST00001051706, ENST00001051707, ENST00001051708, ENST00001051710, ENST00001101563, ENST00001101564, ENST00001101565, ENST00001101566, ENST00001101567, ENST00001101568, ENST00001112774, ENST00001126766, ENST00001141380

RefSeq mRNA: 28 — MANE Select: NM_001130016 NM_001130016, NM_001130017, NM_001179, NM_001377173, NM_001377174, NM_001377175, NM_001377176, NM_001377177, NM_001377178, NM_001377179, NM_001377180, NM_001377181, NM_001377182, NM_001377183, NM_001377184, NM_001377185, NM_001437636, NM_001437637, NM_001437638, NM_001437639, NM_001437640, NM_001437641, NM_001437642, NM_001437644, NM_001437645, NM_001437646, NM_001437647, NM_001437648

CCDS: CCDS3575, CCDS47079, CCDS47080, CCDS93546

Canonical transcript exons

ENST00000355810 — 12 exons

Exon	Start	End
ENSE00003459278	76100795	76100824
ENSE00003471687	76097644	76097676
ENSE00003500894	76107761	76107793
ENSE00003541826	76100291	76100320
ENSE00003564182	76104597	76104629
ENSE00003574788	76100990	76101019
ENSE00003627369	76081824	76082535
ENSE00003632224	76103937	76103969
ENSE00003641892	76098955	76098987
ENSE00003661772	76075881	76075958
ENSE00003899244	76112386	76112786
ENSE00003904111	76074709	76074819

Expression profiles

Bgee: expression breadth ubiquitous, 199 present calls, max score 98.60.

FANTOM5 (CAGE): breadth broad, TPM avg 3.0637 / max 349.4972, expressed in 190 samples.

Highest expression (Bgee): gastrocnemius, hindlimb stylopod muscle, biceps brachii, skeletal muscle tissue of rectus abdominis, vastus lateralis.

Genetic regulation across tissues (GTEx eQTL / sQTL)

ART3 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 34 tissues and its splicing (sQTL) in 15 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 49 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Nerve Tibial	eqtl	4.8e-155	-0.95	4:76059107:GTGTATGAAGAAACCTTTAGGTTATAGTTCACAA:G
Pancreas	eqtl	3.2e-85	-1.04	4:76065189:T:C
Nerve Tibial	sqtl	1.5e-68	+0.88	4:76059107:GTGTATGAAGAAACCTTTAGGTTATAGTTCACAA:G
Muscle Skeletal	sqtl	4.1e-43	+0.97	4:76104657:G:A
Pituitary	eqtl	2.1e-33	+0.79	4:76031135:A:G
Colon Sigmoid	eqtl	5.2e-29	-0.49	4:76031135:A:G
Colon Sigmoid	sqtl	3.8e-27	+0.99	4:76065189:T:C
Brain Cerebellum	eqtl	6.9e-23	-1.07	4:76076108:C:T
Brain Cerebellar Hemisphere	eqtl	8.3e-23	-1.05	4:76076108:C:T
Esophagus Muscularis	sqtl	6.7e-20	+0.67	4:76065189:T:C
Esophagus Gastroesophageal Junction	sqtl	4.1e-16	+0.67	4:76059107:GTGTATGAAGAAACCTTTAGGTTATAGTTCACAA:G
Adipose Subcutaneous	eqtl	2.7e-15	+0.45	4:76070604:C:T
Lung	eqtl	7.3e-14	+0.58	4:76067955:A:G
Artery Tibial	eqtl	4.0e-13	-0.33	4:76078456:G:A
Heart Atrial Appendage	sqtl	6.0e-13	+0.88	4:76101701:G:A
Esophagus Gastroesophageal Junction	eqtl	6.1e-12	-0.35	4:76046915:C:T
Spleen	eqtl	1.2e-10	+0.53	4:75932905:T:C
Testis	sqtl	1.8e-09	+0.44	4:76054430:T:TA
Esophagus Muscularis	eqtl	3.2e-09	-0.26	4:76052745:T:C
Brain Frontal Cortex BA9	sqtl	6.6e-09	-0.72	4:76104215:G:A

FANTOM5 promoters

4 alternative TSS:

Promoter ID	TPM avg	Samples expressed
48320	2.5570	177
48311	0.2296	6
48319	0.1793	71
48312	0.0977	4

Top tissues by expression

showing 100 of 287 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
gastrocnemius	UBERON:0001388	98.60	gold quality
hindlimb stylopod muscle	UBERON:0004252	98.54	gold quality
biceps brachii	UBERON:0001507	98.28	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	98.14	gold quality
vastus lateralis	UBERON:0001379	98.10	gold quality
quadriceps femoris	UBERON:0001377	98.00	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	97.60	gold quality
right testis	UBERON:0004534	97.59	gold quality
muscle organ	UBERON:0001630	97.51	gold quality
muscle of leg	UBERON:0001383	97.40	gold quality
cardiac muscle of right atrium	UBERON:0003379	97.40	gold quality
skeletal muscle tissue	UBERON:0001134	97.39	gold quality
left testis	UBERON:0004533	97.34	gold quality
diaphragm	UBERON:0001103	97.28	gold quality
apex of heart	UBERON:0002098	96.80	gold quality
myocardium	UBERON:0002349	96.65	gold quality
left ventricle myocardium	UBERON:0006566	96.62	gold quality
heart left ventricle	UBERON:0002084	96.46	gold quality
tibialis anterior	UBERON:0001385	96.41	gold quality
deltoid	UBERON:0001476	96.30	silver quality
cardiac ventricle	UBERON:0002082	96.29	gold quality
heart right ventricle	UBERON:0002080	96.10	gold quality
right atrium auricular region	UBERON:0006631	95.84	gold quality
cardiac atrium	UBERON:0002081	95.58	gold quality
muscle tissue	UBERON:0002385	94.58	gold quality
testis	UBERON:0000473	94.56	gold quality
triceps brachii	UBERON:0001509	93.99	gold quality
gluteal muscle	UBERON:0002000	93.02	gold quality
heart	UBERON:0000948	92.69	gold quality
tibial nerve	UBERON:0001323	92.59	gold quality
cerebellar hemisphere	UBERON:0002245	90.75	gold quality
cerebellar cortex	UBERON:0002129	90.50	gold quality
right hemisphere of cerebellum	UBERON:0014890	90.47	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	87.44	gold quality
cerebellum	UBERON:0002037	87.25	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.21	gold quality
adult organism	UBERON:0007023	86.68	gold quality
body of tongue	UBERON:0011876	85.50	silver quality
Brodmann (1909) area 9	UBERON:0013540	84.69	gold quality
sural nerve	UBERON:0015488	84.37	gold quality
right frontal lobe	UBERON:0002810	84.18	gold quality
sperm	CL:0000019	83.79	silver quality
male germ cell	CL:0000015	82.54	silver quality
dorsolateral prefrontal cortex	UBERON:0009834	80.59	gold quality
corpus callosum	UBERON:0002336	80.58	gold quality
popliteal artery	UBERON:0002250	80.15	gold quality
tibial artery	UBERON:0007610	80.12	gold quality
prefrontal cortex	UBERON:0000451	80.06	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	79.83	gold quality
caudate nucleus	UBERON:0001873	79.38	gold quality
lower esophagus muscularis layer	UBERON:0035833	77.43	gold quality
body of pancreas	UBERON:0001150	77.31	gold quality
lower esophagus	UBERON:0013473	77.28	gold quality
frontal cortex	UBERON:0001870	77.18	gold quality
spinal cord	UBERON:0002240	76.19	gold quality
neocortex	UBERON:0001950	76.02	gold quality
cingulate cortex	UBERON:0003027	75.36	gold quality
muscle layer of sigmoid colon	UBERON:0035805	75.36	gold quality
anterior cingulate cortex	UBERON:0009835	75.10	gold quality
primary visual cortex	UBERON:0002436	74.93	gold quality
cerebral cortex	UBERON:0000956	74.74	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	74.55	gold quality
nucleus accumbens	UBERON:0001882	74.41	gold quality
telencephalon	UBERON:0001893	74.24	gold quality
putamen	UBERON:0001874	74.00	gold quality
central nervous system	UBERON:0001017	73.80	gold quality
brain	UBERON:0000955	73.73	gold quality
amygdala	UBERON:0001876	73.35	gold quality
forebrain	UBERON:0001890	73.14	gold quality
tongue	UBERON:0001723	73.00	silver quality
Ammon’s horn	UBERON:0001954	71.79	gold quality
endocervix	UBERON:0000458	71.70	gold quality
rectum	UBERON:0001052	70.49	gold quality
aorta	UBERON:0000947	70.01	gold quality
mucosa of stomach	UBERON:0001199	69.83	gold quality
left coronary artery	UBERON:0001626	69.59	gold quality
spleen	UBERON:0002106	69.50	gold quality
pituitary gland	UBERON:0000007	69.09	gold quality
sigmoid colon	UBERON:0001159	68.92	gold quality
ectocervix	UBERON:0012249	68.57	gold quality
coronary artery	UBERON:0001621	68.10	gold quality
temporal lobe	UBERON:0001871	67.97	gold quality
esophagus	UBERON:0001043	67.87	gold quality
trigeminal ganglion	UBERON:0001675	67.85	silver quality
transverse colon	UBERON:0001157	67.80	gold quality
hypothalamus	UBERON:0001898	67.63	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	67.61	gold quality
superior frontal gyrus	UBERON:0002661	67.58	gold quality
middle temporal gyrus	UBERON:0002771	67.58	silver quality
minor salivary gland	UBERON:0001830	66.92	gold quality
occipital lobe	UBERON:0002021	66.92	gold quality
anatomical system	UBERON:0000467	66.77	gold quality
right coronary artery	UBERON:0001625	66.52	gold quality
colon	UBERON:0001155	66.41	gold quality
material anatomical entity	UBERON:0000465	66.36	gold quality
multicellular organism	UBERON:0000468	66.36	gold quality
large intestine	UBERON:0000059	65.70	gold quality
pancreas	UBERON:0001264	65.70	gold quality
skin of leg	UBERON:0001511	65.07	gold quality
intestine	UBERON:0000160	64.78	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.48

HPA expression

RNA tissue specificity: Group enriched

55 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Skeletal muscle	tissue	176.3	low
Testis	tissue	86.3	high
Tongue	tissue	70.8
Heart muscle	tissue	47.1	low
Caudate putamen	tissue	16.4
Frontal cortex	tissue	11.1
Pancreas	tissue	7.4	not detected
Esophagus	tissue	2.5	not detected
Nucleus accumbens	tissue	2.5
Pituitary gland	tissue	2.4
Choroid plexus	tissue	2.3
Spleen	tissue	2.3	not detected
Rectum	tissue	2.1	not detected
Colon	tissue	1.8	not detected
Vagina	tissue	1.6	not detected
Cervix	tissue	1.5	not detected
Salivary gland	tissue	1.5	not detected
Seminal vesicle	tissue	1.4	not detected
Prostate	tissue	1.2	not detected
Postcentral gyrus	tissue	1.0
Appendix	tissue	1.0	not detected
Cerebellum	tissue	0.8	not detected
Adipose tissue	tissue	0.7	not detected
Hippocampus	tissue	0.7	not detected
Breast	tissue	0.6	not detected
Epididymis	tissue	0.5	not detected
Small intestine	tissue	0.5	not detected
Smooth muscle	tissue	0.4	not detected
Urinary bladder	tissue	0.4	not detected
Duodenum	tissue	0.4	not detected
Locus coeruleus	tissue	0.4
Thymus	tissue	0.4
Stomach 1	tissue	0.3	not detected
Adrenal gland	tissue	0.3	not detected
Lymph node	tissue	0.2	not detected
Ovary	tissue	0.2	not detected
Endometrium 1	tissue	0.2	not detected
Lung	tissue	0.2	not detected
Liver	tissue	0.2	not detected
Gallbladder	tissue	0.2	not detected
Kidney	tissue	0.2	not detected
Fallopian tube	tissue	0.2	not detected
Cerebral cortex	tissue	0.1	not detected
Retina	tissue	0.1
Pons	tissue	0.1
Parathyroid gland	tissue	0.1	not detected
Hypothalamus	tissue	0.1
Placenta	tissue	0.1	not detected
Substantia nigra	tissue	0.1
Thyroid gland	tissue	0.1	not detected
Tonsil	tissue	0.1	not detected
Hippocampal formation	tissue	0.1
Periaqueductal gray	tissue	0.1
Septum	tissue	0.1
Occipital cortex	tissue	0.1

Brain sub-regions (HPA Brain Atlas): detected in 182; highest nTPM — Blood vessel (9.4), Corpus callosum, genu (white matter) (8.4), Temporo-occipital transitional zone (7.5), Corpus callosum, splenium (white matter) (7.3), Parieto-temporal junction (white matter) (5.6).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NR3C1

miRNA regulators (miRDB)

Targeting ART3 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 42 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-548AW	99.99	72.57	3559
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-450B-5P	99.92	71.48	3175
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-1297	99.91	73.41	3162
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-4698	99.84	71.41	4303
HSA-MIR-26A-5P	99.78	73.52	2303
HSA-MIR-26B-5P	99.78	73.51	2305
HSA-MIR-4465	99.71	72.56	2096
HSA-MIR-582-5P	99.47	70.79	2635
HSA-MIR-6507-5P	99.36	70.46	2524
HSA-MIR-6882-5P	99.35	71.13	1206
HSA-MIR-422A	99.18	65.83	550
HSA-MIR-3926	98.95	69.26	1438
HSA-MIR-548S	98.50	67.17	1213
HSA-MIR-378A-3P	98.43	66.10	548

Functional genomics

gnomAD constraint: pLI 1.87e-16, LOEUF 1.38, missense Z 0.546 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000355810 splits into 3 regions with different missense tolerance; 1 is missense-constrained (≈4% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
4:76,075,890–76,082,280	206 / 205.3	1.00	no
4:76,082,281–76,082,330	5 / 19.5	0.26	yes (p 1.0e-03)
4:76,082,331–76,112,516	227 / 229.6	0.99	no

Literature-anchored findings (GeneRIF, showing 4)

• ART3 protein is expressed in testes in particular on spermatocytes, indicating that ART3 exerts a specific function only required at a particular stage of spermatogenesis. (PMID:16625277)
• ART3 expression appears to be governed by a combination of differential splicing and tissue-preferential use of two alternative promoters. (PMID:16934346)
• genome-wide gene expression analyses were used to identify genes involved in the pathogenesis of non-obstructive azoospermia, and ART3 was subsequently identified as a susceptibility gene (PMID:18266473)
• knockdown of ART3 in breast cancer cells inhibited cell proliferation and invasion. (PMID:27374177)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	si:ch211-145b13.6	ENSDARG00000069998
mus_musculus	Art3	ENSMUSG00000034842
rattus_norvegicus	Art3	ENSRNOG00000002256

Paralogs (3): ART4 (ENSG00000111339), ART1 (ENSG00000129744), ART5 (ENSG00000167311)

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Oryctolagus cuniculus	Q03515	81.3%	Diamond
Gallus gallus	P55806	81.1%	Diamond
Bos taurus	Q0VC22	67.9%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
PPEF2-AS1	ncRNA	105377285
NAAA	protein-coding	27163
CXCL10	protein-coding	3627
CXCL9	protein-coding	4283
PPEF2	protein-coding	5470
SDAD1	protein-coding	55153
CXCL11	protein-coding	6373
FAM47E	protein-coding	100129583
FAM47E-STBD1	protein-coding	100631383
NUP54	protein-coding	53371
STBD1	protein-coding	8987
SCARB2	protein-coding	950
SDAD1-AS1	ncRNA	101928809
NUP54-DT	ncRNA	124900718

Protein

Protein identifiers

Ecto-ADP-ribosyltransferase 3 — Q13508 (reviewed: Q13508)

Alternative names: ADP-ribosyltransferase C2 and C3 toxin-like 3, Mono(ADP-ribosyl)transferase 3, NAD(P)(+)–arginine ADP-ribosyltransferase 3

All UniProt accessions (8): A0A8V8TPP7, A0A8V8TQ78, E7ER42, E7ESB3, E7EX61, E9PGR5, Q13508, H0Y8V6

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Cell membrane.

Tissue specificity. Testis specific.

Post-translational modifications. O-glycosylated with core 1 or possibly core 8 glycans.

Similarity. Belongs to the Arg-specific ADP-ribosyltransferase family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q13508-1	3	yes
Q13508-2	1
Q13508-3	2

RefSeq proteins (28): NP_001123488, NP_001123489, NP_001170, NP_001364102, NP_001364103, NP_001364104, NP_001364105, NP_001364106, NP_001364107, NP_001364108, NP_001364109, NP_001364110, NP_001364111, NP_001364112, NP_001364113, NP_001364114, NP_001424565, NP_001424566, NP_001424567, NP_001424568, NP_001424569, NP_001424570, NP_001424571, NP_001424573, NP_001424574, NP_001424575, NP_001424576, NP_001424577 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000768	ART	Family
IPR050999	ADP-ribosyltransferase_ARG	Family

Pfam: PF01129

Catalyzed reactions (Rhea)

• L-arginyl-[protein] + NAD(+) = N(omega)-(ADP-D-ribosyl)-L-arginyl-[protein] + nicotinamide + H(+) (RHEA:19149)

UniProt features (21 total): repeat 3, binding site 2, glycosylation site 2, splice variant 2, sequence variant 2, region of interest 2, signal peptide 1, chain 1, lipid moiety-binding region 1, disulfide bond 1, propeptide 1, sequence conflict 1, domain 1, compositionally biased region 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q13508-F1	74.56	0.50

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Metabolic proteins, Predicted membrane proteins, Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): end piece; principal piece

Antibody reliability (HPA): IH enhanced · IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (2)

Position	Role
101	NAD(+)
163	NAD(+)

Post-translational modifications (1)

Type	Positions
Gpi-anchor amidated serine	362

Disulfide bonds (1)

Type	Positions
Disulfide bond	43–256

Glycosylation sites (2)

Type	Positions
N-linked (glcnac…) asparagine	248
O-linked (galnac…) threonine	346

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 3; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

3 pathways:

ID	Pathway	Evidence
R-HSA-163125	Post-translational modification: synthesis of GPI-anchored proteins	curated
R-HSA-392499	Metabolism of proteins	—
R-HSA-597592	Post-translational protein modification	—

MSigDB gene sets: 149 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_COLON_TUMORAL_MACROPHAGE_DN, MODULE_255, MODULE_64, MODULE_317, MARTINEZ_RB1_TARGETS_UP, MORF_ZNF10, MCBRYAN_PUBERTAL_BREAST_4_5WK_DN, MCBRYAN_PUBERTAL_BREAST_5_6WK_UP, TSENG_IRS1_TARGETS_DN, MORF_EPHA7, MORF_RAB3A, MORF_BMPR2, SMID_BREAST_CANCER_RELAPSE_IN_BRAIN_UP, MORF_WNT1, CUI_TCF21_TARGETS_2_DN

GO Molecular Function (5): NAD+ poly-ADP-ribosyltransferase activity (GO:0003950), nucleotidyltransferase activity (GO:0016779), NAD+-protein-arginine ADP-ribosyltransferase activity (GO:0106274), transferase activity (GO:0016740), glycosyltransferase activity (GO:0016757)

GO Cellular Component (4): extracellular region (GO:0005576), plasma membrane (GO:0005886), extracellular exosome (GO:0070062), side of membrane (GO:0098552)

Reactome top-level categories

2 top-level categories:

Category	Pathways
Post-translational protein modification	1
Metabolism of proteins	1

GO top-level categories

10 GO namespaces:

Category	Terms
cellular anatomical structure	2
membrane	2
pentosyltransferase activity	1
transferase activity, transferring phosphorus-containing groups	1
NAD+-protein mono-ADP-ribosyltransferase activity	1
catalytic activity	1
transferase activity	1
cell periphery	1
extracellular vesicle	1
leaflet of membrane bilayer	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 1 of 9 annotations. The rest are phylogenetic / computational / electronic (IEA).

1 experimentally-supported GO terms:

GO term	NS	Evidence
extracellular exosome	CC	high-throughput assay

Protein interactions and networks

STRING

showing 16 of 954 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ART3	SEPTIN4	O43236	853
ART3	PARG	Q86W56	786
ART3	TMCO2	Q7Z6W1	510
ART3	ATP13A5	Q4VNC0	479
ART3	LYZL4	Q96KX0	457
ART3	LRRC20	Q8TCA0	447
ART3	MAP3K7CL	P57077	446
ART3	MEAK7	Q6P9B6	445
ART3	CXCL11	O14625	433
ART3	PDLIM3	Q53GG5	399
ART3	DHX32	Q7L7V1	390
ART3	CT83	Q5H943	387
ART3	ART4	Q93070	382
ART3	GPR22	Q99680	376
ART3	IFT172	Q9UG01	370
ART3	BBS5	Q8N3I7	370

IntAct

Human interaction partners of ART3 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

2 partners by confidence:

Partner	Interaction type	MIscore	Records
ALCAM	physical association	0.370	1
NCF1	association	0.350	1

BioGRID (44 interactions; top human partners by supporting records): ATP12A (Affinity Capture-MS; 3 records), CBWD3 (Affinity Capture-MS; 3 records), PAM (Affinity Capture-MS; 3 records), POGLUT1 (Affinity Capture-MS; 3 records), ARSK (Affinity Capture-MS; 2 records), CHD1L (Affinity Capture-MS; 2 records), DDX19B (Affinity Capture-MS; 2 records), HSPA12A (Affinity Capture-MS; 2 records), ITGA8 (Affinity Capture-MS; 2 records), NAGLU (Affinity Capture-MS; 2 records), RAB39B (Affinity Capture-MS; 2 records), ALCAM (Two-hybrid), DYNC2LI1 (Affinity Capture-MS), GALNT7 (Affinity Capture-MS), GPD1L (Affinity Capture-MS)

Disease & clinical

Genetic variants

Variant evidence for ART3: 132 ClinVar records (1 pathogenic / likely pathogenic); 4 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

132 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	98
Likely benign	7
Benign	2

Top pathogenic / likely-pathogenic (1)

Showing all 1 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
1456083	NC_000004.11:g.(?76481293)(77700330_?)del	Pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore ART3’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 34 predictions of 945):

Position(s)	Effect	Δscore	Sites
4:76074820–76074821	donor_loss	0.9900	5
4:76097641–76097643	acceptor_loss	0.9900	7
4:76097677–76097679	acceptor_loss	0.9900	3
4:76075879–76075880	acceptor_loss	0.9800	6
4:76097634	acceptor_loss	0.9800
4:76097677–76097679	acceptor_loss	0.9800	2
4:76097678	donor_loss	0.9800	3
4:76100062	donor_gain	0.9800
4:76100793–76100794	acceptor_loss	0.9800	5
4:76081936	donor_gain	0.9700

AlphaMissense

398 missense substitutions predicted likely pathogenic (of 2,592 scored), across 115 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D38	8	0.937	0.977
F231	8	0.932	0.986
F133	8	0.928	0.992
D37	8	0.919	0.959
F36	8	0.882	0.987
C256	7	0.980	0.994
C43	7	0.976	0.993
F135	7	0.945	0.979
F140	7	0.944	0.987
W70	7	0.935	0.987
C251	7	0.926	0.962
C267	7	0.922	0.958
W77	7	0.907	0.982
F258	7	0.904	0.964
E59	7	0.876	0.939
E229	7	0.864	0.922
H139	7	0.860	0.955
R179	7	0.860	0.952
F90	7	0.849	0.939
C206	7	0.815	0.884

HPA cancer prognostics

RNA cancer specificity: Cancer enhanced (Breast Invasive Carcinoma)

Disease associations

OMIM: gene MIM:603086 | disease phenotypes: MIM:254800

GenCC curated gene-disease

Mondo (1): progressive myoclonus epilepsy (MONDO:0020074)

Orphanet (2): Progressive myoclonic epilepsy type 1 (Orphanet:308), Progressive myoclonic epilepsy (Orphanet:98261)

GWAS associations

4 associations:

Study	Trait	p-value
GCST006585_2706	Blood protein levels	5e-21
GCST006585_2279	Blood protein levels	3e-18
GCST007009_4	Hippocampal volume	3e-7
GCST007009_3	Hippocampal volume	7e-7

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0005035	hippocampal volume

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D020191	Myoclonic Epilepsies, Progressive	C10.228.140.490.375.130.650; C10.228.140.490.493.063.650

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB variants

1 variants:

Variant	Genes	Level	Score	#Clin annots	Drugs
rs56061981	ART3, CXCL10	3	2.75	1	peginterferon alfa-2a;peginterferon alfa-2b

CTD chemical–gene interactions

15 total (human), top 15 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Estradiol	affects cotreatment, increases expression	2
Progesterone	affects cotreatment, increases expression	2
Valproic Acid	affects expression, decreases methylation	2
methyleugenol	decreases expression	1
sodium arsenite	decreases expression	1
CGP 52608	affects binding, increases reaction	1
2-palmitoylglycerol	increases expression	1
(+)-JQ1 compound	decreases expression	1
Arsenic	affects methylation	1
Benzo(a)pyrene	increases methylation	1
Doxorubicin	decreases expression	1
Sodium Dodecyl Sulfate	increases expression	1
Tretinoin	decreases expression	1
Triclosan	decreases expression	1
Cyclosporine	decreases expression	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

2 trials:

NCT	Phase	Status	Title
NCT06593951	Not specified	RECRUITING	Registry and Natural History Study for Progressive Myoclonus Epilepsy Type 1 (EPM1)
NCT06923241	Not specified	COMPLETED	Nutri-score Labelling in a UK Restaurant Setting: a Randomised Control Trial