ASL

Summary

ASL (argininosuccinate lyase, HGNC:746) is a protein-coding gene on chromosome 7q11.21, encoding Argininosuccinate lyase (P04424). Catalyzes the reversible cleavage of L-argininosuccinate to fumarate and L-arginine, an intermediate step reaction in the urea cycle mostly providing for hepatic nitrogen detoxification into excretable urea as well as de novo L-arginine synthesis in nonhepatic tissues.

This gene encodes a member of the lyase 1 family. The encoded protein forms a cytosolic homotetramer and primarily catalyzes the reversible hydrolytic cleavage of argininosuccinate into arginine and fumarate, an essential step in the liver in detoxifying ammonia via the urea cycle. Mutations in this gene result in the autosomal recessive disorder argininosuccinic aciduria, or argininosuccinic acid lyase deficiency. A nontranscribed pseudogene is also located on the long arm of chromosome 22. Alternatively spliced transcript variants encoding different isoforms have been described.

Source: NCBI Gene 435 — RefSeq curated summary.

At a glance

• Gene–disease (curated): argininosuccinic aciduria (Definitive, ClinGen)
• Clinical variants (ClinVar): 999 total — 77 pathogenic, 127 likely-pathogenic (top 3% of genes corpus-wide)
• GTEx eGene: eQTL in 24 tissues, sQTL in 24 (q < 0.05)
• Phenotypes (HPO): 65
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity no evidence
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.94 (unconstrained)
• MANE Select transcript: NM_000048

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:746
Approved symbol	ASL
Name	argininosuccinate lyase
Location	7q11.21
Locus type	gene with protein product
Status	Approved
Aliases	ASAL
Ensembl gene	ENSG00000126522
Ensembl biotype	protein_coding
OMIM	608310
Entrez	435

Gene structure

Transcript identifiers

Ensembl transcripts: 91 — 61 protein_coding, 21 nonsense_mediated_decay, 8 retained_intron, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000304874

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 3, TSL 2: 2, TSL 3: 3, TSL 5: 2

ENST00000304874, ENST00000362000, ENST00000380839, ENST00000395331, ENST00000395332, ENST00000464970, ENST00000487982, ENST00000488343, ENST00000493708, ENST00000496336, ENST00000671817, ENST00000672498, ENST00000672586, ENST00000672676, ENST00000673149, ENST00000673350, ENST00000673518, ENST00000673594, ENST00000906797, ENST00000906798, ENST00000906799, ENST00000906800, ENST00000906801, ENST00000906802, ENST00000906803, ENST00000906804, ENST00000906805, ENST00000906806, ENST00000906807, ENST00000906808, ENST00000906809, ENST00000906810, ENST00000906811, ENST00000906812, ENST00000906813, ENST00000906814, ENST00000906815, ENST00000906816, ENST00000906817, ENST00000906818, ENST00000906819, ENST00000906820, ENST00000906821, ENST00000906822, ENST00000906823, ENST00000906824, ENST00000906825, ENST00000906826, ENST00000906827, ENST00000906828, ENST00000906829, ENST00000906830, ENST00000906831, ENST00000930139, ENST00000930140, ENST00000930141, ENST00000952728, ENST00000952729, ENST00000952730, ENST00000952731, ENST00000952732, ENST00000952733, ENST00000952734, ENST00000952735, ENST00000984759, ENST00000984760, ENST00000984761, ENST00000984762, ENST00000984763, ENST00000984764, ENST00000984765, ENST00000984766, ENST00000984767, ENST00000984768, ENST00001013444, ENST00001013445, ENST00001013446, ENST00001013447, ENST00001013448, ENST00001013449, ENST00001013450, ENST00001069372, ENST00001069373, ENST00001104293, ENST00001104294, ENST00001104295, ENST00001104296, ENST00001104297, ENST00001129853, ENST00001129854, ENST00001140361

RefSeq mRNA: 4 — MANE Select: NM_000048 NM_000048, NM_001024943, NM_001024944, NM_001024946

CCDS: CCDS47597, CCDS47598, CCDS5531

Canonical transcript exons

ENST00000304874 — 17 exons

Exon	Start	End
ENSE00001167543	66087729	66087791
ENSE00001167550	66087334	66087386
ENSE00001167557	66086744	66086821
ENSE00001486497	66092768	66093576
ENSE00003461706	66088807	66088921
ENSE00003474820	66082368	66082451
ENSE00003483679	66082880	66082936
ENSE00003529046	66083077	66083174
ENSE00003531434	66092557	66092663
ENSE00003536992	66089276	66089335
ENSE00003552375	66089612	66089695
ENSE00003639784	66086585	66086662
ENSE00003644260	66076039	66076093
ENSE00003654446	66089091	66089175
ENSE00003666304	66092006	66092086
ENSE00003669988	66081803	66081997
ENSE00003896120	66075819	66075856

Expression profiles

Bgee: expression breadth ubiquitous, 145 present calls, max score 99.14.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 14.9997 / max 405.4219, expressed in 1805 samples.

Highest expression (Bgee): lobe of liver, liver, mucosa of transverse colon, duodenum, transverse colon.

Genetic regulation across tissues (GTEx eQTL / sQTL)

ASL is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 24 tissues and its splicing (sQTL) in 24 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 48 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Cells Cultured fibroblasts	sqtl	1.9e-41	-0.66	7:66089398:C:T
Esophagus Mucosa	sqtl	6.1e-35	-0.80	7:66095574:A:G
Thyroid	sqtl	1.5e-30	-0.70	7:66100087:C:T
Brain Cerebellar Hemisphere	sqtl	1.7e-28	+1.54	7:66100041:G:A
Brain Cerebellum	sqtl	2.5e-19	+1.39	7:66158519:T:C
Brain Frontal Cortex BA9	sqtl	1.6e-15	+1.33	7:66382625:A:G
Colon Transverse	sqtl	1.2e-14	-0.67	7:66215261:G:A
Skin Sun Exposed Lower leg	eqtl	1.4e-14	+0.19	7:66708053:A:G
Lung	sqtl	1.5e-14	-0.53	7:66109469:C:T
Skin Not Sun Exposed Suprapubic	eqtl	6.2e-13	+0.20	7:66314523:A:T
Pituitary	sqtl	8.3e-13	-0.73	7:66091949:G:C
Brain Spinal cord cervical c-1	eqtl	5.1e-11	+0.51	7:66095065:G:C
Esophagus Mucosa	eqtl	3.8e-10	-0.20	7:66610625:T:G
Testis	eqtl	2.2e-09	+0.26	7:66070046:G:A
Spleen	sqtl	7.6e-09	-0.76	7:66154117:G:A
Brain Cerebellar Hemisphere	eqtl	1.4e-07	-0.24	7:66418217:A:G
Whole Blood	eqtl	2.0e-07	+0.11	7:66081075:C:T
Cells Cultured fibroblasts	eqtl	6.3e-07	-0.20	7:66698099:G:A
Esophagus Muscularis	eqtl	3.4e-06	+0.16	7:66269610:C:CTG
Cells EBV-transformed lymphocytes	eqtl	3.6e-06	+0.24	7:66098774:CGTGGCTCATGCCTGTAAAGGAGGAAGAGGAGGAGGAAGAAACAGCCAGGCACAGTGGCTCAAGCCTGTAAAGGAGGAGGAGGAAACAGCCAGGTGTG:C

FANTOM5 promoters

4 alternative TSS:

Promoter ID	TPM avg	Samples expressed
78851	9.4163	1782
78853	2.5168	1277
78852	1.9165	1188
78850	1.1502	818

Top tissues by expression

showing 100 of 158 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right lobe of liver	UBERON:0001114	99.14	gold quality
liver	UBERON:0002107	98.80	gold quality
mucosa of transverse colon	UBERON:0004991	97.75	gold quality
duodenum	UBERON:0002114	96.50	gold quality
transverse colon	UBERON:0001157	95.15	gold quality
adult mammalian kidney	UBERON:0000082	94.56	gold quality
small intestine Peyer’s patch	UBERON:0003454	94.19	gold quality
body of stomach	UBERON:0001161	94.03	gold quality
small intestine	UBERON:0002108	93.96	gold quality
rectum	UBERON:0001052	93.91	gold quality
bone marrow cell	CL:0002092	93.56	gold quality
metanephros cortex	UBERON:0010533	93.49	gold quality
stomach	UBERON:0000945	92.72	gold quality
body of pancreas	UBERON:0001150	92.48	gold quality
upper lobe of left lung	UBERON:0008952	92.38	gold quality
gall bladder	UBERON:0002110	92.30	gold quality
intestine	UBERON:0000160	92.04	gold quality
right lobe of thyroid gland	UBERON:0001119	92.01	gold quality
fundus of stomach	UBERON:0001160	91.91	gold quality
colon	UBERON:0001155	91.79	gold quality
apex of heart	UBERON:0002098	91.79	gold quality
spleen	UBERON:0002106	91.77	gold quality
kidney	UBERON:0002113	91.54	gold quality
right lung	UBERON:0002167	91.07	gold quality
left lobe of thyroid gland	UBERON:0001120	90.94	gold quality
tibial nerve	UBERON:0001323	90.94	gold quality
granulocyte	CL:0000094	90.89	gold quality
thyroid gland	UBERON:0002046	90.83	gold quality
esophagus mucosa	UBERON:0002469	90.83	gold quality
ascending aorta	UBERON:0001496	90.64	gold quality
thoracic aorta	UBERON:0001515	90.63	gold quality
mucosa of stomach	UBERON:0001199	90.23	gold quality
lower esophagus mucosa	UBERON:0035834	90.05	gold quality
mammary gland	UBERON:0001911	90.00	gold quality
thoracic mammary gland	UBERON:0005200	90.00	gold quality
blood	UBERON:0000178	89.98	gold quality
bone marrow	UBERON:0002371	89.94	gold quality
pituitary gland	UBERON:0000007	89.93	gold quality
bone element	UBERON:0001474	89.93	gold quality
cortex of kidney	UBERON:0001225	89.88	gold quality
pancreas	UBERON:0001264	89.80	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	89.67	gold quality
right ovary	UBERON:0002118	89.66	gold quality
left ovary	UBERON:0002119	89.65	gold quality
adenohypophysis	UBERON:0002196	89.53	gold quality
descending thoracic aorta	UBERON:0002345	89.52	gold quality
left coronary artery	UBERON:0001626	89.49	gold quality
popliteal artery	UBERON:0002250	89.46	gold quality
tibial artery	UBERON:0007610	89.45	gold quality
left uterine tube	UBERON:0001303	89.42	gold quality
vermiform appendix	UBERON:0001154	89.11	gold quality
esophagus	UBERON:0001043	89.09	gold quality
subcutaneous adipose tissue	UBERON:0002190	89.09	gold quality
sural nerve	UBERON:0015488	88.93	gold quality
stromal cell of endometrium	CL:0002255	88.83	gold quality
ectocervix	UBERON:0012249	88.81	gold quality
ovary	UBERON:0000992	88.76	gold quality
vagina	UBERON:0000996	88.57	gold quality
adipose tissue	UBERON:0001013	88.50	gold quality
urinary bladder	UBERON:0001255	88.37	gold quality
endocervix	UBERON:0000458	88.30	gold quality
myometrium	UBERON:0001296	88.27	gold quality
tonsil	UBERON:0002372	88.27	gold quality
minor salivary gland	UBERON:0001830	88.17	gold quality
muscle layer of sigmoid colon	UBERON:0035805	88.09	gold quality
sigmoid colon	UBERON:0001159	88.01	gold quality
body of uterus	UBERON:0009853	87.92	gold quality
saliva-secreting gland	UBERON:0001044	87.87	gold quality
right adrenal gland	UBERON:0001233	87.86	gold quality
omental fat pad	UBERON:0010414	87.85	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	87.82	gold quality
monocyte	CL:0000576	87.75	gold quality
leukocyte	CL:0000738	87.65	gold quality
lung	UBERON:0002048	87.54	gold quality
prostate gland	UBERON:0002367	87.46	gold quality
right coronary artery	UBERON:0001625	87.40	gold quality
uterine cervix	UBERON:0000002	87.32	gold quality
heart left ventricle	UBERON:0002084	87.19	gold quality
lower esophagus muscularis layer	UBERON:0035833	87.18	gold quality
lower esophagus	UBERON:0013473	87.17	gold quality
right adrenal gland cortex	UBERON:0035827	87.07	gold quality
colonic epithelium	UBERON:0000397	86.90	gold quality
material anatomical entity	UBERON:0000465	86.81	gold quality
multicellular organism	UBERON:0000468	86.81	gold quality
left adrenal gland	UBERON:0001234	86.80	gold quality
anatomical system	UBERON:0000467	86.79	gold quality
left adrenal gland cortex	UBERON:0035825	86.32	gold quality
skin of leg	UBERON:0001511	86.15	gold quality
heart	UBERON:0000948	86.12	gold quality
adrenal gland	UBERON:0002369	86.12	gold quality
hypothalamus	UBERON:0001898	85.98	gold quality
zone of skin	UBERON:0000014	85.64	gold quality
right atrium auricular region	UBERON:0006631	85.62	gold quality
substantia nigra	UBERON:0002038	85.31	gold quality
right uterine tube	UBERON:0001302	85.14	gold quality
fallopian tube	UBERON:0003889	85.13	gold quality
placenta	UBERON:0001987	85.03	gold quality
uterus	UBERON:0000995	84.96	gold quality
islet of Langerhans	UBERON:0000006	84.90	gold quality
skin of abdomen	UBERON:0001416	84.90	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-7303	no	41.47
E-ANND-3	no	0.00

HPA expression

RNA tissue specificity: Tissue enriched

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Liver	tissue	181.5	medium
Duodenum	tissue	57.2	not detected
Colon	tissue	50.5	low
Small intestine	tissue	42.1	not detected
Kidney	tissue	37.2	medium
Stomach 1	tissue	36.1	low
Rectum	tissue	33.5	not detected
Gallbladder	tissue	26.0	medium
Bone marrow	tissue	22.6	not detected
Pancreas	tissue	22.2	not detected
Pons	tissue	20.9
Thalamus	tissue	20.8
Hypothalamus	tissue	20.8
Esophagus	tissue	18.9	not detected
Thyroid gland	tissue	18.8	not detected
Lung	tissue	18.3	not detected
Vagina	tissue	17.5	not detected
Pituitary gland	tissue	17.4
Substantia nigra	tissue	17.2
Medulla oblongata	tissue	16.6
Periaqueductal gray	tissue	16.2
Midbrain	tissue	15.7
Appendix	tissue	15.7	low
Spinal cord	tissue	15.5
Superior colliculi	tissue	15.2
Cerebellum	tissue	15.1	not detected
Spleen	tissue	15.1	low
Septum	tissue	15.1
Parathyroid gland	tissue	14.2	not detected
Locus coeruleus	tissue	13.8
Urinary bladder	tissue	13.6	not detected
Salivary gland	tissue	13.0	not detected
Hippocampal formation	tissue	12.3
Adipose tissue	tissue	12.1	not detected
Ovary	tissue	12.0	not detected
Frontal cortex	tissue	11.6
Choroid plexus	tissue	11.4
Breast	tissue	11.2	not detected
Caudate putamen	tissue	11.1
Prefrontal cortex	tissue	10.9
Cerebral cortex	tissue	10.9	not detected
Heart muscle	tissue	10.8	not detected
Somatosensory cortex	tissue	10.7
Cervix	tissue	10.6	not detected
Amygdala	tissue	10.5
Entorhinal cortex	tissue	10.3
Temporal cortex	tissue	10.0
Prostate	tissue	9.8	not detected
Retrosplenial and cingulate cortex	tissue	9.8
Fallopian tube	tissue	9.8	not detected
Insular cortex	tissue	9.8
Motor cortex	tissue	9.7
Lymph node	tissue	9.6	not detected
Smooth muscle	tissue	9.5	not detected
Seminal vesicle	tissue	9.3	not detected
Endometrium 1	tissue	9.3	medium
Retrosplenial cortex	tissue	9.1
Adrenal gland	tissue	8.8	not detected
Corpus callosum	tissue	8.7
Placenta	tissue	8.6	not detected

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Blood vessel (23.5), Ventral spinal cord (15.5), Dorsal spinal cord (15.0), Subiculum (12.3), Ventral hippocampus (12.2).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting ASL by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

12 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1303	99.65	69.77	1662
HSA-MIR-486-3P	99.51	66.82	1901
HSA-MIR-939-3P	98.97	65.07	2347
HSA-MIR-4755-3P	98.77	65.59	1915
HSA-MIR-3652	97.71	65.43	1890
HSA-MIR-4430	97.47	65.61	1813
HSA-MIR-6869-5P	97.17	67.06	634
HSA-MIR-6886-3P	96.96	66.36	844
HSA-MIR-6805-5P	95.79	64.86	670
HSA-MIR-4278	95.28	65.49	351
HSA-MIR-6732-5P	93.97	64.65	422
HSA-MIR-1292-3P	72.98	63.40	23

Functional genomics

gnomAD constraint: pLI 2.61e-13, LOEUF 0.937, missense Z 1.4 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000304874 — one region, missense o/e 0.87. ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 26)

• Structural studies of the ASL frequently complementing allele Q286R suggest that the mutation may hinder a conformational change in the 280’s loop (residues 270-290) and domain 3 that may be important for catalysis. (PMID:11747432)
• Complementation can occur at the ASL locus between thermolabile mutants and stable mutants by stabilization of the active oligomeric form of the hybrid enzyme, which may be sufficiently stable for catalysis to occur. (PMID:11747433)
• complete sequence of the human ASL gene and a complete ASL homologue on chromosome 22 (PMID:12384776)
• argininosuccinic aciduria patients of different ethnic backgrounds who are characterized by residual activity of argininosuccinate lyase and who present with less severe clinical courses. (PMID:12408190)
• This unique mutation causes an elongation of fifty amino acids in the C-terminal region of the ASL protein, and is likely related to a milder phenotype compared with previously reported mutations. (PMID:12512996)
• a novel ASL pseudogene located in the centromeric region of chromosome 7, 14 novel mutations in the ASL gene, and a novel intronic polymorphism found in a cohort of Italian patients with argininosuccinic aciduria (PMID:17326097)
• analysis of human missense argininosuccinate lyase mutations in yeast (PMID:19703900)
• MDR analysis provided evidence of interaction between the genes for ASS1 and SLC25A13 on the risk of CL/P. (PMID:20739017)
• extent of protection of ASL and delta-crystallin at different ratios of alphaA-crystallin (PMID:20937351)
• analysis of mutant argininosuccinate lyase in argininosuccinic aciduria (PMID:21667091)
• Cox regression analysis showed that ASL is an independent prognostic marker for HCC. Therefore, reduced ASL expression may be a novel maker for poor prognosis in HCC patients (PMID:22531684)
• Our results suggest that ASL transcripts can contribute to the highly variable phenotype in ASA patients if expressed at high levels. (PMID:24136197)
• Data show that in patients with Argininosuccinate lyase deficiency, the ASl gene is subject to several mutations, the majority are missense; some more frequent then others. (PMID:24166829)
• Point mutation of ASS1, ASL and SLC25A13 is associated with citrullinemia. (PMID:24927999)
• The clinical and biochemical course in variant forms of ASL deficiency is associated with relevant residual levels of ASL activity as well as instability of mutant ASL proteins. (PMID:25778938)
• the mechanism induced by ASL shRNA which occurred in human breast cancer may be attributed to a decrease in cyclin A2 and NO. (PMID:26397737)
• ASL-targeting shRNA-induced growth inhibition is associated with decreased cyclin A2 expression and Nitric oxide content in colon cancer. (PMID:27840980)
• Overexpression of ASL may be a contributing factor in drug resistance for arginine deprivation therapy. (PMID:28035420)
• The remaining five patients were diagnosed with neonatal intrahepatic cholestasis due to citrin deficiency, and have respectively carried mutations of the SLC25A13 gene including [c.851-854delGTAT+c.851-854delGTAT], [c.851-854delGTAT+IVS6+5G>A], [c.851-854delGTAT+IVS16ins3kb], [c.851-854delGTAT+IVS6-11A>G] and [c.851-854delGTAT+c.1638-1660dup23] (PMID:28981931)
• Mechanistically, KLF7 transcriptionally activated argininosuccinate lyase (ASL), which was observed highly expressed in glioma tissues. KLF7 potentiates polyamine biosynthesis and glioma cell growth via transcriptionally activates ASL. (PMID:31018905)
• Compound heterozygous p.Lys69Arg and p.Arg213 * mutations that resulted in reduced ASL enzyme activity were found in a patient with ASLD. (PMID:31183366)
• From genotype to phenotype: Early prediction of disease severity in argininosuccinic aciduria. (PMID:31943503)
• Clinical and genetic analysis of five Chinese patients with urea cycle disorders. (PMID:32410394)
• Biomarkers for liver disease in urea cycle disorders. (PMID:33846069)
• Variants associated with urea cycle disorders in Japanese patients: Nationwide study and literature review. (PMID:33851512)
• Argininosuccinate lyase deficiency causes blood-brain barrier disruption via nitric oxide-mediated dysregulation of claudin expression. (PMID:37490345)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	asl	ENSDARG00000033361
mus_musculus	Asl	ENSMUSG00000025533
rattus_norvegicus	Asl	ENSRNOG00000000903
drosophila_melanogaster	Argl	FBGN0032076

Paralogs (2): FH (ENSG00000091483), ADSL (ENSG00000239900)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:88084) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 33 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased circulating ammonia level	2
increased circulating citrulline level	2
decreased circulating arginine level	2
abnormal myocardial fiber morphology	1
abnormal coat/ hair morphology	1
abnormal hair follicle morphology	1
small hair follicles	1
thymus cortex hypoplasia	1
epidermal atrophy	1
abnormal dermal layer morphology	1
decreased body weight	1
postnatal growth retardation	1
premature death	1
abnormal erythrocyte morphology	1
decreased circulating alanine transaminase level	1
abnormal nitric oxide homeostasis	1
decreased lymphocyte cell number	1
lethargy	1
abnormal circulating amino acid level	1
abnormal renal glomerulus morphology	1
increased macrophage cell number	1
abnormal food intake	1
decreased creatinine clearance	1
decreased vasodilation	1
decreased circulating aspartate transaminase level	1

+8 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Chloroflexus aurantiacus J-10-fl	A9WJR8	100.0%	Diamond
Xanthomonas oryzae pv. oryzae PXO99A	B2SHW2	100.0%	Diamond
Bifidobacterium longum DJO10A	B3DSY6	100.0%	Diamond
Chloroflexus aurantiacus Y-400-fl	B9LD91	100.0%	Diamond
Xanthomonas oryzae pv. oryzae MAFF 311018	Q2P2F7	100.0%	Diamond
Xanthomonas campestris pv. campestris str. 8004	Q4UVI4	100.0%	Diamond
Bifidobacterium longum NCC2705	Q8G5F3	100.0%	Diamond
Xanthomonas campestris pv. campestris str. ATCC 33913	Q8P8J9	100.0%	Diamond
Bifidobacterium longum subsp. infantis ATCC 15697 = JCM 1222 = DSM 20088	B7GTN9	99.4%	Diamond
Gallus gallus	P02521	99.4%	Diamond
Meleagris gallopavo	Q7SIE0	99.4%	Diamond
Xanthomonas campestris pv. campestris str. B100	B0RS55	99.1%	Diamond
Xanthomonas euvesicatoria pv. vesicatoria str. 85-10	Q3BSI8	98.6%	Diamond
Macaca fascicularis	Q60HH3	98.1%	Diamond
Stenotrophomonas maltophilia K279a	B2FMD6	97.9%	Diamond
Stenotrophomonas maltophilia R551-3	B4SQ92	97.9%	Diamond
Xylella fastidiosa Temecula1	P59621	97.5%	Diamond
Xylella fastidiosa 9a5c	Q9PEM5	97.5%	Diamond
Saccharomyces cerevisiae S288C	P04076	97.0%	Diamond
Anas platyrhynchos	P24057	97.0%	Diamond
Anser anser anser	P33110	97.0%	Diamond
Saccharomyces paradoxus	P41906	97.0%	Diamond
Bos taurus	Q3SZJ0	95.7%	Diamond
Streptomyces avermitilis MA-4680 = NBRC 14893	Q827Z0	93.7%	Diamond
Streptomyces coelicolor A3(2)	Q9L1B1	93.5%	Diamond
Chloroflexus aggregans DSM 9485	B8GD12	89.2%	Diamond
Streptomyces clavuligerus	P50988	88.7%	Diamond
Columba livia	Q01592	88.2%	Diamond
Roseiflexus sp. RS-1	A5UVX7	84.4%	Diamond
Roseiflexus castenholzii DSM 13941	A7NF38	84.4%	Diamond
Mycobacteroides abscessus ATCC 19977	B1MB03	80.5%	Diamond
Aquarana catesbeiana	P51464	76.5%	Diamond
Candida albicans	P43061	75.9%	Diamond
Schizosaccharomyces pombe 972h-	P40369	72.9%	Diamond
Nocardioides sp. JS614	A1SJJ4	72.0%	Diamond
Herpetosiphon aurantiacus DSM 785	A9AWL1	67.0%	Diamond
Chlamydomonas reinhardtii	P22675	57.4%	Diamond
Candidatus Solibacter usitatus Ellin6076	Q024T3	46.9%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
VKORC1L1	protein-coding	154807
GUSB	protein-coding	2990
CRCP	protein-coding	27297
LINC00174	ncRNA	285908
TPST1	protein-coding	8460

Protein

Protein identifiers

Argininosuccinate lyase — P04424 (reviewed: P04424)

Alternative names: Arginosuccinase

All UniProt accessions (8): A0A024RDL8, A0A0S2Z316, A0A0S2Z3B0, A0A5F9ZHC6, A0A5F9ZHM8, A0A5F9ZI35, P04424, F8W943

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the reversible cleavage of L-argininosuccinate to fumarate and L-arginine, an intermediate step reaction in the urea cycle mostly providing for hepatic nitrogen detoxification into excretable urea as well as de novo L-arginine synthesis in nonhepatic tissues. Essential regulator of intracellular and extracellular L-arginine pools. As part of citrulline-nitric oxide cycle, forms tissue-specific multiprotein complexes with argininosuccinate synthase ASS1, transport protein SLC7A1 and nitric oxide synthase NOS1, NOS2 or NOS3, allowing for cell-autonomous L-arginine synthesis while channeling extracellular L-arginine to nitric oxide synthesis pathway.

Subunit / interactions. Homotetramer. Forms tissue-specific complexes with ASS1, SLC7A1, HSP90AA1 and nitric oxide synthase NOS1, NOS2 or NOS3; the complex maintenance is independent of ASL catalytic function.

Post-translational modifications. Acetylation modifies enzyme activity in response to alterations of extracellular nutrient availability. Acetylation increased with trichostin A (TSA) or with nicotinamide (NAM). Glucose increases acetylation by about a factor of 3 with decreasing enzyme activity. Acetylation on Lys-288 is decreased on the addition of extra amino acids resulting in activation of enzyme activity.

Disease relevance. Argininosuccinic aciduria (ARGINSA) [MIM:207900] An autosomal recessive disorder of the urea cycle. The disease is characterized by mental and physical retardation, liver enlargement, skin lesions, dry and brittle hair showing trichorrhexis nodosa microscopically and fluorescing red, convulsions, and episodic unconsciousness. The disease is caused by variants affecting the gene represented in this entry. The phenotype heterogeneity among patients is associated with interallelic complementation resulting in either complete loss of activity or partial regeneration of functional active sites in the heterotetrameric mutant protein.

Activity regulation. Enzyme activity is regulated by acetylation.

Pathway. Amino-acid biosynthesis; L-arginine biosynthesis; L-arginine from L-ornithine and carbamoyl phosphate: step 3/3. Nitrogen metabolism; urea cycle; L-arginine and fumarate from (N(omega)-L-arginino)succinate: step 1/1.

Similarity. Belongs to the lyase 1 family. Argininosuccinate lyase subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
P04424-1	1	yes
P04424-2	2
P04424-3	3

RefSeq proteins (4): NP_000039, NP_001020114, NP_001020115, NP_001020117 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000362	Fumarate_lyase_fam	Family
IPR008948	L-Aspartase-like	Homologous_superfamily
IPR009049	Argininosuccinate_lyase	Family
IPR020557	Fumarate_lyase_CS	Conserved_site
IPR022761	Fumarate-Lyase-like_N	Domain
IPR024083	Fumarase/histidase_N	Homologous_superfamily
IPR029419	Arg_succ_lyase_C	Domain

Pfam: PF00206, PF14698

Enzyme classification (BRENDA)

• EC 4.3.2.1 — argininosuccinate lyase (BRENDA: 29 organisms, 29 substrates, 33 inhibitors, 73 Km, 16 kcat entries)

Substrate kinetics (BRENDA)

9 substrates with measured Km, best-characterized 9. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ARGININOSUCCINATE	0.007–3.159	46
2-(NOMEGA-L-ARGININO)SUCCINATE	0.032–1.55	13
(NOMEGA-L-ARGININO)SUCCINATE	0.2–2.6	3
FUMARATE	0.067–5.3	3
N,N’-BIS(TERT-BUTOXYCARBONYL)-5-[(3-AMINOPROPYL)	0.12	2
ARG	3	1
ARGININE	3	1
DIFLUOROFUMARATE	0.046	1
MONOFLUOROFUMARATE	1.4	1

Catalyzed reactions (Rhea)

• 2-(N(omega)-L-arginino)succinate = fumarate + L-arginine (RHEA:24020)

UniProt features (120 total): sequence variant 65, helix 24, binding site 7, strand 5, modified residue 4, turn 3, mutagenesis site 3, splice variant 2, active site 2, sequence conflict 2, initiator methionine 1, chain 1, site 1

Structure

Experimental structures (PDB)

2 structures by resolution:

PDB	Title	Method	Resolution (Å)
1K62	Crystal Structure of the Human Argininosuccinate Lyase Q286R Mutant	X-RAY DIFFRACTION	2.65
1AOS	HUMAN ARGININOSUCCINATE LYASE	X-RAY DIFFRACTION	4.2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P04424-F1	96.51	0.95

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Lyases, Metabolic proteins, Predicted intracellular proteins, Plasma proteins, Disease related genes, Potential drug targets, Human disease related genes, Congenital disorders of metabolism, Congenital disorders of amino acid metabolism

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): cytosol

Antibody reliability (HPA): IH enhanced · IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (3)

Position	Role
294	increases basicity of active site his
160	proton acceptor
281	proton donor

Ligand- & substrate-binding residues (7)

Position	Role
329	2-(N(omega)-L-arginino)succinate
27	2-(N(omega)-L-arginino)succinate
114	2-(N(omega)-L-arginino)succinate
159	2-(N(omega)-L-arginino)succinate
289	2-(N(omega)-L-arginino)succinate
321	2-(N(omega)-L-arginino)succinate
326	2-(N(omega)-L-arginino)succinate

Post-translational modifications (4)

Type	Positions
N-acetylalanine	2
N6-acetyllysine	7, 69, 288

Mutagenesis-validated functional residues (3)

Position	Phenotype
51	2-fold reduction in activity.
89	10-fold reduction in activity.
288	refractory to inhibition by tsa and nam and by addition of extra amino acids. no effect on protein structure.

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 4; 1 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

4 pathways:

ID	Pathway	Evidence
R-HSA-9956529	ASL variants cause argininosuccinate aciduria ⚕	curated
R-HSA-70635	Urea cycle	curated
R-HSA-1430728	Metabolism	—
R-HSA-71291	Metabolism of amino acids and derivatives	—

MSigDB gene sets: 308 (showing top): GOBP_GLUTAMINE_FAMILY_AMINO_ACID_BIOSYNTHETIC_PROCESS, GOBP_BEHAVIOR, GNF2_GSTM1, ENK_UV_RESPONSE_KERATINOCYTE_UP, GOBP_ALPHA_AMINO_ACID_METABOLIC_PROCESS, GNF2_HPN, GOBP_GLUTAMATE_METABOLIC_PROCESS, DACOSTA_UV_RESPONSE_VIA_ERCC3_UP, GOBP_AMINO_ACID_BIOSYNTHETIC_PROCESS, GOBP_GLUTAMINE_FAMILY_AMINO_ACID_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_BIOSYNTHETIC_PROCESS, GOBP_DICARBOXYLIC_ACID_METABOLIC_PROCESS, GOBP_GLUTAMINE_METABOLIC_PROCESS, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, UEDA_PERIFERAL_CLOCK

GO Biological Process (5): urea cycle (GO:0000050), arginine metabolic process (GO:0006525), L-arginine biosynthetic process (GO:0006526), positive regulation of nitric oxide biosynthetic process (GO:0045429), amino acid biosynthetic process (GO:0008652)

GO Molecular Function (5): argininosuccinate lyase activity (GO:0004056), identical protein binding (GO:0042802), catalytic activity (GO:0003824), protein binding (GO:0005515), lyase activity (GO:0016829)

GO Cellular Component (3): cytoplasm (GO:0005737), cytosol (GO:0005829), extracellular exosome (GO:0070062)

Reactome top-level categories

3 top-level categories:

Category	Pathways
Metabolism of amino acids and derivatives	1
Diseases of the urea cycle	1
Metabolism	1

GO top-level categories

18 GO namespaces:

Category	Terms
biosynthetic process	2
amino acid metabolic process	2
cellular anatomical structure	2
urea metabolic process	1
carboxylic acid metabolic process	1
arginine metabolic process	1
glutamate family amino acid biosynthetic process	1
nitric oxide biosynthetic process	1
positive regulation of biosynthetic process	1
regulation of nitric oxide biosynthetic process	1
amidine-lyase activity	1
protein binding	1
molecular_function	1
binding	1
catalytic activity	1
intracellular anatomical structure	1
cytoplasm	1
extracellular vesicle	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 6 of 15 annotations. The rest are phylogenetic / computational / electronic (IEA).

6 experimentally-supported GO terms:

GO term	NS	Evidence
L-arginine biosynthetic process	BP	direct assay
arginine metabolic process	BP	direct assay
positive regulation of nitric oxide biosynthetic process	BP	mutant phenotype
extracellular exosome	CC	high-throughput assay
argininosuccinate lyase activity	MF	direct assay
identical protein binding	MF	physical interaction

Protein interactions and networks

STRING

showing 15 of 1,016 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
ASL	ASS1	P00966	915
ASL	OTC	P00480	852
ASL	NAGS	Q8N159	818
ASL	HADH	Q16836	793
ASL	CPS1	P31327	779
ASL	ARG2	P78540	775
ASL	ARG1	P05089	773
ASL	OAT	P04181	719
ASL	AZIN2	Q96A70	667
ASL	ODC1	P11926	620
ASL	SRM	P19623	588
ASL	AGMAT	Q9BSE5	581
ASL	SLC25A15	Q9Y619	570
ASL	CRYGB	P07316	566
ASL	ALDH18A1	P54886	565

IntAct

Human interaction partners of ASL in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

8 partners by confidence:

Partner	Interaction type	MIscore	Records
NTAQ1	physical association	0.780	7
MCMBP	physical association	0.720	6
TRIM3	physical association	0.560	3
CSNK2A2	physical association	0.370	1
FBP1	physical association	0.370	1
HMOX1	physical association	0.370	1
OVGP1	physical association	0.370	1
QARS	physical association	0.370	1

BioGRID (42 interactions; top human partners by supporting records): MCMBP (Two-hybrid; 2 records), WDYHV1 (Two-hybrid; 2 records), ACOX1 (Co-fractionation), AMBRA1 (Proximity Label-MS), APEX1 (Affinity Capture-RNA), ARPC1B (Co-fractionation), ARPC2 (Co-fractionation), BAG3 (Affinity Capture-Luminescence), CBL (Affinity Capture-MS), CLK1 (Biochemical Activity), CSNK2A2 (Two-hybrid), FBP1 (Two-hybrid), GDI1 (Co-fractionation), GINS4 (Co-fractionation), HK1 (Co-fractionation)

Disease & clinical

Genetic variants

Variant evidence for ASL: 999 ClinVar records (204 pathogenic / likely pathogenic). Per-variant detail is on Sugi Variant.

ClinVar

999 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	77
Likely pathogenic	127
Uncertain significance	175
Likely benign	441
Benign	38

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 204 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
2402	NM_000048.4(ASL):c.532G>A (p.Val178Met)	Pathogenic	criteria provided, multiple submitters, no conflicts	20
92361	NM_000048.4(ASL):c.446+1G>A	Pathogenic	criteria provided, multiple submitters, no conflicts	19
92362	NM_000048.4(ASL):c.544C>T (p.Arg182Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	13
21253	NM_000048.4(ASL):c.1060C>T (p.Gln354Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	12
426366	NM_000048.4(ASL):c.637C>T (p.Arg213Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	10
203629	NM_000048.4(ASL):c.1045_1057del (p.Val349fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	9
203615	NM_000048.4(ASL):c.649C>T (p.Arg217Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	8
224981	NM_000048.4(ASL):c.524+2T>G	Pathogenic	criteria provided, multiple submitters, no conflicts	8
933174	NM_000048.4(ASL):c.557G>A (p.Arg186Gln)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
552393	NM_000048.4(ASL):c.631_647del (p.Val211fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
553111	NM_000048.4(ASL):c.337C>T (p.Arg113Trp)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
555191	NM_000048.4(ASL):c.338G>A (p.Arg113Gln)	Pathogenic	criteria provided, multiple submitters, no conflicts	5
954795	NM_000048.4(ASL):c.551_552del (p.Asp183_Ser184insTer)	Pathogenic	criteria provided, multiple submitters, no conflicts	5
553540	NM_000048.4(ASL):c.446+2T>C	Pathogenic	criteria provided, multiple submitters, no conflicts	4
557445	NM_000048.4(ASL):c.973_976del (p.Leu325fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	4

Per-variant reference — Sugi Variant

Explore ASL’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 33 predictions of 1,240):

Position(s)	Effect	Δscore	Sites
7:66076094–66076095	donor_loss	1.0000	3
7:66081998	donor_loss	1.0000	2
7:66082367	acceptor_loss	1.0000
7:66082452–66082453	donor_loss	1.0000	3
7:66086822	donor_loss	1.0000	2
7:66088805–66088806	acceptor_loss	1.0000	6
7:66088808	acceptor_gain	1.0000
7:66088922–66088923	donor_loss	1.0000	4
7:66089610–66089611	acceptor_loss	1.0000	6
7:66092087–66092088	donor_loss	1.0000	5

AlphaMissense

1,361 missense substitutions predicted likely pathogenic (of 3,043 scored), across 334 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M284	9	0.890	0.996
N289	8	0.986	0.997
D87	8	0.983	0.995
H160	8	0.980	0.997
D291	8	0.979	0.991
D324	8	0.979	0.991
F384	8	0.975	0.997
N114	8	0.965	0.995
S282	8	0.962	0.998
S281	8	0.960	0.997
D372	8	0.960	0.981
S112	8	0.959	0.997
H89	8	0.958	0.991
D328	8	0.955	0.992
D38	8	0.952	0.977
D183	8	0.936	0.975
D31	8	0.935	0.968
H388	8	0.929	0.994
D115	8	0.927	0.987
F13	8	0.919	0.987

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	2.48e-06

Disease associations

OMIM: gene MIM:608310 | disease phenotypes: MIM:207900, MIM:608931, MIM:253220

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
argininosuccinic aciduria	Definitive	Autosomal recessive	8

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

1 validity classifications:

Disease	Classification	Inheritance
argininosuccinic aciduria	Definitive	AR

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (13 panels, 13 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

13 panels:

Panel	Rating
Ataxia and cerebellar anomalies - childhood onset	green
DDG2P	green
Dystonia, chorea or related movement disorder, childhood onset	green
Early onset or syndromic epilepsy	green
Hereditary ataxia and cerebellar anomalies, childhood onset	green
Hyperammonaemia	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Likely inborn error of metabolism	green
Paediatric disorders	green
Undiagnosed metabolic disorders	green
Unexplained death in infancy and sudden unexplained death in childhood	green

Mondo (4): argininosuccinic aciduria (MONDO:0008815), neurodevelopmental disorder (MONDO:0700092), congenital myasthenic syndrome 4C (MONDO:0012157), mucopolysaccharidosis type 7 (MONDO:0009662)

Orphanet (3): Argininosuccinic aciduria (Orphanet:23), Congenital myasthenic syndrome (Orphanet:590), Mucopolysaccharidosis type 7 (Orphanet:584)

HPO phenotypes

showing 60 of 65 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000083	Renal insufficiency
HP:0000670	Carious teeth
HP:0000709	Psychosis
HP:0000737	Irritability
HP:0000742	Self-mutilation
HP:0000750	Delayed speech and language development
HP:0000822	Hypertension
HP:0000964	Eczematoid dermatitis
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001254	Lethargy
HP:0001259	Coma
HP:0001263	Global developmental delay
HP:0001270	Motor delay
HP:0001324	Muscle weakness
HP:0001328	Specific learning disability
HP:0001332	Dystonia
HP:0001337	Tremor
HP:0001394	Cirrhosis
HP:0001395	Hepatic fibrosis
HP:0001399	Hepatic failure
HP:0001402	Hepatocellular carcinoma
HP:0001508	Failure to thrive
HP:0001894	Thrombocytosis
HP:0001950	Respiratory alkalosis
HP:0001951	Episodic ammonia intoxication
HP:0001987	Hyperammonemia
HP:0002013	Vomiting
HP:0002014	Diarrhea
HP:0002038	Protein avoidance
HP:0002155	Hypertriglyceridemia
HP:0002181	Cerebral edema
HP:0002232	Patchy alopecia
HP:0002240	Hepatomegaly
HP:0002283	Global brain atrophy
HP:0002299	Brittle hair
HP:0002329	Drowsiness
HP:0002353	EEG abnormality
HP:0002789	Tachypnea
HP:0002900	Hypokalemia
HP:0002910	Elevated circulating hepatic transaminase concentration
HP:0003217	Hyperglutaminemia
HP:0003218	Oroticaciduria
HP:0003355	Aminoaciduria
HP:0003623	Neonatal onset
HP:0003777	Pili torti
HP:0005961	Hypoargininemia
HP:0006280	Chronic pancreatitis
HP:0006970	Periventricular leukomalacia
HP:0007018	Attention deficit hyperactivity disorder
HP:0007183	Focal T2 hyperintense basal ganglia lesion
HP:0008872	Feeding difficulties in infancy
HP:0009886	Trichorrhexis nodosa
HP:0011359	Dry hair
HP:0011362	Abnormal hair quantity
HP:0011675	Arrhythmia
HP:0011966	Elevated circulating citrulline concentration
HP:0012758	Neurodevelopmental delay

MeSH disease descriptors

3 disease descriptors:

Descriptor	Name	Tree numbers
D056807	Argininosuccinic Aciduria	C10.228.140.163.100.937.124; C16.320.565.100.940.124; C16.320.565.189.937.124; C18.452.132.100.937.124; C18.452.648.100.940.124; C18.452.648.189.937.124
D016538	Mucopolysaccharidosis VII	C16.320.565.202.715.675; C16.320.565.595.600.675; C17.300.550.575.675; C18.452.648.202.715.675; C18.452.648.595.600.675
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

44 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression	4
bisphenol A	increases expression, affects cotreatment, decreases expression	2
cobaltous chloride	decreases expression	2
Arsenic Trioxide	increases expression, decreases response to substance	2
Benzo(a)pyrene	affects methylation, decreases expression	2
Tretinoin	increases expression	2
Cyclosporine	decreases expression, increases expression	2
Aflatoxin B1	affects expression, decreases expression	2
aristolochic acid I	decreases expression	1
bisphenol F	affects cotreatment, decreases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
beta-lapachone	decreases expression	1
4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone	increases expression	1
sodium arsenite	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
S 1 (combination)	increases response to substance	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
dorsomorphin	affects cotreatment, increases expression	1
bisphenol S	affects cotreatment, decreases expression	1
jinfukang	increases expression	1
bisphenol AF	increases expression	1
Aspirin	decreases expression	1
Boron Compounds	decreases expression	1
Carbamazepine	affects expression	1
Cisplatin	increases expression	1
Dexamethasone	affects cotreatment, decreases expression	1
Diazinon	increases methylation	1
Diclofenac	affects expression	1

Cellosaurus cell lines

13 cell lines: 6 transformed cell line, 5 cancer cell line, 2 induced pluripotent stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A2WA	GM26179	Transformed cell line	Female
CVCL_AE11	GM24028	Transformed cell line	Male
CVCL_AY70	GM23436	Transformed cell line	Female
CVCL_AY71	GM23437	Transformed cell line	Female
CVCL_AY78	GM23641	Transformed cell line	Male
CVCL_AY88	GM23823	Transformed cell line	Male
CVCL_D0N1	UCLi024-A	Induced pluripotent stem cell	Male
CVCL_D1LK	Abcam K-562 ASL KO	Cancer cell line	Female
CVCL_D2I6	Abcam Raji ASL KO	Cancer cell line	Male
CVCL_D7KL	Ubigene A-549 ASL KO	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 292 trials:

NCT	Phase	Status	Title
NCT04586348	Phase 4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	Phase 4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT00211796	Phase 4	COMPLETED	Divalproex Sodium ER in Adult Autism
NCT00391261	Phase 4	COMPLETED	An Open-label Trial of Metformin for Weight Control of Pediatric Patients on Antipsychotic Medications.
NCT00409747	Phase 4	COMPLETED	Minocycline to Treat Childhood Regressive Autism
NCT00576732	Phase 4	COMPLETED	A Study of the Effectiveness and Safety of Two Doses of Risperidone in the Treatment of Children and Adolescents With Autistic Disorder
NCT00844753	Phase 4	COMPLETED	Atomoxetine, Placebo and Parent Management Training in Autism
NCT01028820	Phase 4	COMPLETED	FMRI Brain Activation of Aripiprazole Treatment in Autism Spectrum Disorders
NCT01098383	Phase 4	UNKNOWN	Treatment With Acetyl-Choline Esterase Inhibitors in Children With Autism Spectrum Disorders
NCT01333865	Phase 4	COMPLETED	A Study of Memantine Hydrochloride (Namenda®) for Cognitive and Behavioral Impairment in Adults With Autism Spectrum Disorders
NCT01337700	Phase 4	COMPLETED	Milnacipran in Autism and the Functional Locus Coeruleus and Noradrenergic Model of Autism
NCT01695200	Phase 4	COMPLETED	Omega-3 Fatty Acids in Autism Spectrum Disorders
NCT02069977	Phase 4	UNKNOWN	Study to Evaluate the Efficacy and Safety of Aripiprazole
NCT02096952	Phase 4	COMPLETED	Methylphenidate ER Liquid Formulation in Adults With ASD and ADHD
NCT02199925	Phase 4	UNKNOWN	An Open-Label Study to Evaluate the Efficacy of High-Dose Gammaplex in Children on the Autism Spectrum
NCT02235467	Phase 4	COMPLETED	Multisite Study: Parental Training Using Video Modelling to Develop Social Skills in Children With Autism
NCT02255565	Phase 4	COMPLETED	Dose Response Effects of Quillivant XR in Children With ADHD and Autism: A Pilot Study
NCT02940574	Phase 4	COMPLETED	Neural and Behavioral Effects of Oxytocin in Autism Spectrum Disorders
NCT03333629	Phase 4	COMPLETED	Promoting Positive Outcomes for Individuals With ASD: Linking Early Detection, Treatment, and Long-term Outcomes
NCT03337646	Phase 4	COMPLETED	Evaluation of the Effect and Safety of Lisdexamfetamine in Children Aged 6-12 With ADHD and Autism
NCT03538431	Phase 4	COMPLETED	Improving Driving in Young People With Autism Spectrum Disorders
NCT03757585	Phase 4	COMPLETED	Natural Treatments for the Management of Emotional Dysregulation in Youth With Non-verbal Learning Disability (NVLD) and/or Autism Spectrum Disorders (ASD)
NCT04903353	Phase 4	COMPLETED	Pragmatic Trial Comparing Weight Gain in Children With Autism Taking Risperidone Versus Aripiprazole
NCT05063656	Phase 4	COMPLETED	Biomarker-Driven Pharmacological Treatment of Adolescents With Autism Spectrum Disorder With Gabapentin
NCT05146245	Phase 4	UNKNOWN	Safety and Pharmacokinetics of Antipsychotics in Children 2: Studying TDM in an RCT
NCT05916339	Phase 4	RECRUITING	AWARE: Management of ADHD in Autism Spectrum Disorder
NCT05954052	Phase 4	TERMINATED	A Study of Glutathione in Children With Autism Spectrum Disorder
NCT06853665	Phase 4	RECRUITING	The TEAM Study - Treatment Efficacy for Autism/Attention Using Mixed Amphetamine
NCT07054697	Phase 4	COMPLETED	Pilot-RCT With Individualized Homeopathic Treatment in the Children With Autism Spectrum Disorder
NCT07161804	Phase 4	COMPLETED	Pilot RCT Using Homeopathic Medicines in ASD
NCT07439042	Phase 4	RECRUITING	Buspirone for Anxiety in Autistic Youth
NCT07770152	Phase 4	NOT_YET_RECRUITING	Semaglutide in Youth With Autism Spectrum Disorder
NCT02559102	Phase 3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	Phase 3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	Phase 3	RECRUITING	Reducing Missed Appointments
NCT07377032	Phase 3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT00036231	Phase 3	TERMINATED	Synthetic Human Secretin in Children With Autism and Gastrointestinal Dysfunction
NCT00036244	Phase 3	COMPLETED	Synthetic Human Secretin in Children With Autism
NCT00065884	Phase 3	UNKNOWN	Valproate Response in Aggressive Autistic Adolescents
NCT00065962	Phase 3	COMPLETED	Secretin for the Treatment of Autism
NCT00252603	Phase 3	COMPLETED	Galantamine Versus Placebo in Childhood Autism
NCT00346736	Phase 3	COMPLETED	Use of Acupuncture In Children With Autistic Spectrum Disorder
NCT00352248	Phase 3	COMPLETED	Randomized Controlled Trial of Acupuncture Versus Sham Acupuncture in Autistic Spectrum Disorder
NCT00352352	Phase 3	COMPLETED	Use of Acupuncture In Children With Autistic Spectrum Disorder
NCT00355329	Phase 3	COMPLETED	Randomized Control Trial of Using Tongue Acupuncture in Autistic Spectrum Disorder Using PET Scan for Clinical Correlation
NCT00498173	Phase 3	COMPLETED	Effectiveness of Atomoxetine in Treating ADHD Symptoms in Children and Adolescents With Autism
NCT00541346	Phase 3	COMPLETED	A Pilot Study of Daytrana TM in Children With Autism Co-Morbid for Attention Deficit Hyperactivity Disorder (ADHD) Symptoms
NCT00549562	Phase 3	COMPLETED	Study of Paliperidone ER in Adolescents and Young Adults With Autism
NCT00584480	Phase 3	COMPLETED	Pilot Study of the Effect of Hyperbaric Oxygen Treatment on Behavioral and Biomarker Measures in Children With Autism
NCT00655174	Phase 3	COMPLETED	Fluvoxamine and Sertraline in Childhood Autism - Does SSRI Therapy Improve Behaviour and/or Mood?
NCT00881452	Phase 3	COMPLETED	A Trial of CM-AT in Children With Autism
NCT00912691	Phase 3	COMPLETED	A Trial of CM-AT in Children With Autism- Open Label Extension Study
NCT01302964	Phase 3	COMPLETED	Mirtazapine Treatment of Anxiety in Children and Adolescents With Pervasive Developmental Disorders
NCT01706523	Phase 3	TERMINATED	Open Label Extension Study of STX209 (Arbaclofen) in Autism Spectrum Disorders
NCT01740869	Phase 3	COMPLETED	Autologous Bone Marrow Stem Cells for Children With Autism Spectrum Disorders
NCT01825798	Phase 3	COMPLETED	Treatment of Overweight Induced by Antipsychotic Medication in Young People With Autism Spectrum Disorders (ASD)
NCT01911442	Phase 3	COMPLETED	Lurasidone Pediatric Autism Study
NCT01914393	Phase 3	COMPLETED	Pediatric Open-Label Extension Study
NCT01972074	Phase 3	COMPLETED	Behavioral and Neural Response to Memantine in Adolescents With Autism Spectrum Disorder
NCT02410902	Phase 3	COMPLETED	A Trial of CM-AT in Children With Autism With All Levels of FCT (The Blum Study)