BAP1

Summary

BAP1 (BRCA1 associated deubiquitinase 1, HGNC:950) is a protein-coding gene on chromosome 3p21.1, encoding Ubiquitin carboxyl-terminal hydrolase BAP1 (Q92560). Deubiquitinating enzyme that plays a key role in chromatin by mediating deubiquitination of histone H2A and HCFC1. It is a selective cancer dependency (DepMap: 51.9% of cell lines).

This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma.

Source: NCBI Gene 8314 — RefSeq curated summary.

At a glance

• Gene–disease (curated): BAP1-related tumor predisposition syndrome (Definitive, ClinGen) — +2 more curated relationships
• Clinical variants (ClinVar): 3,584 total — 312 pathogenic, 95 likely-pathogenic
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 51.9% of screened cell lines
• MANE Select transcript: NM_004656

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:950
Approved symbol	BAP1
Name	BRCA1 associated deubiquitinase 1
Location	3p21.1
Locus type	gene with protein product
Status	Approved
Aliases	hucep-6, KIAA0272, UCHL2
Ensembl gene	ENSG00000163930
Ensembl biotype	protein_coding
OMIM	603089
Entrez	8314

Gene structure

Transcript identifiers

Ensembl transcripts: 11 — 6 protein_coding, 4 retained_intron, 1 nonsense_mediated_decay

ENST00000296288, ENST00000460680, ENST00000466093, ENST00000469613, ENST00000470173, ENST00000471532, ENST00000478368, ENST00000483984, ENST00000490804, ENST00000490917, ENST00000615113

RefSeq mRNA: 2 — MANE Select: NM_004656 NM_001410772, NM_004656

CCDS: CCDS2853, CCDS93284

Canonical transcript exons

ENST00000460680 — 17 exons

Exon	Start	End
ENSE00001079716	52403416	52403894
ENSE00001079719	52405110	52405294
ENSE00001079720	52406253	52406376
ENSE00001079723	52405765	52405912
ENSE00001079726	52403138	52403298
ENSE00001079728	52401008	52402421
ENSE00001079730	52402779	52402871
ENSE00001079731	52406829	52406907
ENSE00001879355	52409842	52410008
ENSE00003483175	52409714	52409743
ENSE00003520532	52407174	52407316
ENSE00003544153	52407399	52407460
ENSE00003581470	52409554	52409608
ENSE00003584716	52402602	52402674
ENSE00003602619	52404453	52404586
ENSE00003640734	52407958	52408077
ENSE00003693210	52408474	52408606

Expression profiles

Bgee: expression breadth ubiquitous, 253 present calls, max score 98.36.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 21.8009 / max 342.1206, expressed in 1815 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
42422	20.2351	1811
42419	1.5658	674

Top tissues by expression

284 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left testis	UBERON:0004533	98.36	gold quality
right testis	UBERON:0004534	98.30	gold quality
right frontal lobe	UBERON:0002810	97.85	gold quality
cingulate cortex	UBERON:0003027	97.25	gold quality
anterior cingulate cortex	UBERON:0009835	97.25	gold quality
prefrontal cortex	UBERON:0000451	96.42	gold quality
amygdala	UBERON:0001876	96.26	gold quality
skin of abdomen	UBERON:0001416	96.21	gold quality
right hemisphere of cerebellum	UBERON:0014890	96.21	gold quality
skin of leg	UBERON:0001511	96.12	gold quality
Brodmann (1909) area 9	UBERON:0013540	96.02	gold quality
caudate nucleus	UBERON:0001873	95.90	gold quality
testis	UBERON:0000473	95.88	gold quality
cerebellar hemisphere	UBERON:0002245	95.78	gold quality
cerebellar cortex	UBERON:0002129	95.71	gold quality
apex of heart	UBERON:0002098	95.68	gold quality
putamen	UBERON:0001874	95.67	gold quality
nucleus accumbens	UBERON:0001882	95.66	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	95.50	gold quality
Brodmann (1909) area 10	UBERON:0013541	95.43	gold quality
metanephros cortex	UBERON:0010533	95.35	gold quality
neocortex	UBERON:0001950	95.28	gold quality
frontal cortex	UBERON:0001870	95.13	gold quality
right lobe of thyroid gland	UBERON:0001119	95.01	gold quality
lower esophagus mucosa	UBERON:0035834	94.90	gold quality
frontal pole	UBERON:0002795	94.89	gold quality
right adrenal gland cortex	UBERON:0035827	94.85	gold quality
left adrenal gland cortex	UBERON:0035825	94.83	gold quality
left lobe of thyroid gland	UBERON:0001120	94.76	gold quality
mucosa of stomach	UBERON:0001199	94.75	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.20

Regulation

Is transcription factor: no

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 51.9% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 40)

• identification of the deubiquitinating enzyme BAP1 as a tumor suppressor may lead to further understanding of how the ubiquitin proteasome system contributes to cancer and aid in the identification of new targets for cancer therapy (PMID:18757409)
• Results suggest that BAP1 and BRCA1/BARD1 coordinately regulate ubiquitination during the DNA damage response and the cell cycle. (PMID:19117993)
• Four genes encoding BRCA1-interacting proteins were analyzed in a cohort of 96 breast cancer individuals from high-risk non-BRCA1/BRCA2 French Canadian families. (PMID:19197335)
• BAP1 regulates cell proliferation by deubiquitinating HCF-1 (PMID:19815555)
• BAP1 is the catalytic subunit of the PR-DUB polycomb complex (PMID:20436459)
• HCF-1 interacts with the middle region of YY1 encompassing the glycine-lysine-rich domain and is essential for the formation of a ternary complex with YY1 and BAP1 in vivo. (PMID:20805357)
• findings implicate loss of BAP1 in uveal melanoma metastasis and suggest that the BAP1 pathway may be a valuable therapeutic target (PMID:21051595)
• Studies suggest that BAP1 influences cell proliferation at G1/S by co-regulating transcription from HCF-1/E2F-governed promoters. (PMID:21484256)
• The nuclear deubiquitinase BAP1 is commonly inactivated by somatic mutations and 3p21.1 losses in malignant pleural mesothelioma. (PMID:21642991)
• These results identify a BAP1-related cancer syndrome that is characterized by mesothelioma and uveal melanoma. (PMID:21874000)
• Loss of BAP1 is associated with a clinically and morphologically distinct type of melanocytic neoplasm. (PMID:21874003)
• Biallelic inactivation of BAP1 is observed in uveal melanoma, lung adenocarcinoma and meningioma. (PMID:21941004)
• These results suggest that the lack of the tumor suppressor BAP1 may be more specifically involved in the pathogenesis of epithelioid MM rather than non-epithelioid MM. (PMID:22321046)
• A distinct subset of atypical Spitz tumors is characterized by BRAF mutation and loss of BAP1 expression. (PMID:22367297)
• Germline BAP1 mutations are associated with a more aggressive ocular melanoma phenotype and a recurrent phenotypic complex of cutaneous/ocular melanoma. (PMID:22545102)
• BAP1 loss sensitizes RCC cells in vitro to genotoxic stress. (PMID:22683710)
• BAP1 may be a useful prognostic factor of NSCLC patients and potential target for anticancer drugs. (PMID:22863556)
• results identify a potent tumor suppressor function for BAP1 in myeloid neoplasia; a BAP1 catalytic mutation found in a myelodysplastic syndrome patient implies that BAP1 loss of function has similar consequences in mice and humans (PMID:22878500)
• These findings further support BAP1 as a melanoma susceptibility gene and extend the potential predisposition spectrum to paraganglioma. (PMID:22889334)
• Germline BAP1 mutations are associated with a novel cancer syndrome characterized by malignant mesothelioma, uveal melanoma, cutaneous melanoma and MBAITs, and possibly by other cancers (PMID:22935333)
• somatic mutation in a BAP1 TSG may be rare or absent in these carcinomas; somatic mutational events in BAP1 may not contribute to development of these carcinomas. (PMID:22958294)
• We report a series of 8 combined melanocytic lesions, in which a dominant large epithel-ioid cell proliferation with loss of BAP1 expression was associated and intimately admixed with a BAP1-positive conventional nevus. (PMID:23026932)
• BAP1 germline mutation carriers are predisposed to the development of melanocytic skin lesions, uveal and cutaneous melanoma, and mesothelioma with varying degrees of penetrance. (PMID:23032617)
• The study revealed that 2/66 (3%) unselected uveal melanoma cases had novel mutations in BAP1 that may have contributed to their disease risk. (PMID:23171164)
• If a BAP1 mutation is confirmed in a tumour, the patient’s treating physician should be informed of the possibility of a BAP1 germline mutation. (PMID:23277170)
• The median overall survival in the UTSW cohort was significantly shorter for patients with BAP1-mutant tumours (4.6 years; 95% CI 2.1-7.2), than for patients with PBRM1-mutant tumours (10.6 years; 9.8-11.5). (PMID:23333114)
• Data show that exome sequencing of germline DNA from members of the affected family indicate a loss-of-function mutation in the BAP1 gene. (PMID:23341325)
• Clumped perinuclear BAP1 expression is a frequent finding in sporadic epithelioid Spitz tumors. (PMID:23495950)
• BAP1 and SETD2 mutations (6%-12%) are associated with worse cancer-specific survival , suggesting their roles in disease progression. (PMID:23620406)
• PBRM1, KDM6A, SETD2 and BAP1 were unmethylated in all tumor and normal specimens. (PMID:23644518)
• BAP1 mutations are associated with the genetic cause of some familial nonsyndromic renal cell carcinomas. (PMID:23684012)
• Findings suggest that BAP1 is an early-onset familial Renal cell carcinoma (RCC) predisposing gene; BAP1 mutations may drive tumor development in a subset of patients with inherited renal cell cancer (PMID:23709298)
• study describes a family with a novel germline BAP1 nonsense mutation, c.723T>G, which leads to a predicted truncated protein, p.Y241*, or nonsense-mediated decay of the BAP1 mRNA; the proband had uveal melanoma and his paternal family has a remarkable history of multiple cancers (PMID:23849051)
• the evidence that implicated PBRM1 and BAP1 as renal cancer driver genes, provide an update on the function of the gene products, and speculate on how mutations in these genes may be exploited therapeutically (PMID:23867514)
• BAP1 appears to function in the uveal melanocyte lineage primarily as a regulator of differentiation, with cells deficient for BAP1 exhibiting stem-like qualities. (PMID:23915344)
• BAP1 expression was not associated with asbestos exposure. (PMID:23963927)
• BAP1 is an important uveal and cutaneous melanoma tumor suppressor gene. (PMID:23977234)
• loss of expression of BAP1 occurs in a small proportion (~5%) of cutaneous melanomas (PMID:24018818)
• Mutation frequencies among CT images of clear cell RCCs were as follows: BAP1, 6.0% (14 of 233). (PMID:24029645)
• In clear cell renal carcinoma, BAP1 loss was associated with adverse clinicopathological variables, including high Fuhrman grade, advanced pT stage, sarcomatoid dedifferentiation and necrosis. (PMID:24076305)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	bap1	ENSDARG00000063051
mus_musculus	Bap1	ENSMUSG00000021901
rattus_norvegicus	Bap1	ENSRNOG00000019097
drosophila_melanogaster	caly	FBGN0262166
caenorhabditis_elegans		WBGENE00006721
caenorhabditis_elegans		WBGENE00006722
caenorhabditis_elegans		WBGENE00006723

Paralogs (3): UCHL5 (ENSG00000116750), UCHL3 (ENSG00000118939), UCHL1 (ENSG00000154277)

Protein

Protein identifiers

Ubiquitin carboxyl-terminal hydrolase BAP1 — Q92560 (reviewed: Q92560)

Alternative names: BRCA1-associated protein 1, Cerebral protein 6

All UniProt accessions (7): C9J7L9, Q92560, F8W6N3, F8WEY5, H0Y8E8, H7C4V7, Q96TC6

UniProt curated annotations — full annotation on UniProt →

Function. Deubiquitinating enzyme that plays a key role in chromatin by mediating deubiquitination of histone H2A and HCFC1. Catalytic component of the polycomb repressive deubiquitinase (PR-DUB) complex, a complex that specifically mediates deubiquitination of histone H2A monoubiquitinated at ‘Lys-120’ (H2AK119ub1). Does not deubiquitinate monoubiquitinated histone H2B. The PR-DUB complex is an epigenetic regulator of gene expression and acts as a transcriptional coactivator, affecting genes involved in development, cell communication, signaling, cell proliferation and cell viability. Antagonizes PRC1 mediated H2AK119ub1 monoubiquitination. As part of the PR-DUB complex, associates with chromatin enriched in histone marks H3K4me1, H3K4me3, and H3K27Ac, but not in H3K27me3. Recruited to specific gene-regulatory regions by YY1. Acts as a regulator of cell growth by mediating deubiquitination of HCFC1 N-terminal and C-terminal chains, with some specificity toward ‘Lys-48’-linked polyubiquitin chains compared to ‘Lys-63’-linked polyubiquitin chains. Deubiquitination of HCFC1 does not lead to increase stability of HCFC1. Interferes with the BRCA1 and BARD1 heterodimer activity by inhibiting their ability to mediate ubiquitination and autoubiquitination. It however does not mediate deubiquitination of BRCA1 and BARD1. Able to mediate autodeubiquitination via intramolecular interactions to counteract monoubiquitination at the nuclear localization signal (NLS), thereby protecting it from cytoplasmic sequestration. Negatively regulates epithelial-mesenchymal transition (EMT) of trophoblast stem cells during placental development by regulating genes involved in epithelial cell integrity, cell adhesion and cytoskeletal organization.

Subunit / interactions. Core component of the polycomb repressive deubiquitinase (PR-DUB) complex, at least composed of BAP1, one of ASXL1, ASXL2 or (probably) ASXL3, and one of MBD5 or MBD6. The PR-DUB core associates with a number of accessory proteins, including FOXK1, FOXK2, KDM1B, HCFC1, YY1 and OGT; KDM1B specifically associates with ASXL2 PR-DUB complexes. The BAP1 deubiquitinase activity is not required for PR-DUB assembly. Homodimerizes (via coiled-coil hinge-region between the UCH and ULD domains) to mediate assembly of 2 copies of the BAP1-ASXL heterodimer into a bisymmetric tetramer; dimerization enhances association with nucleosomes. The PR-DUB complex associates with nucleosomes to mediate deubiquitination of ’lys-120’ of histone H2AK118ub1 substrates; the association requires the positively charged C-terminal tail of BAP1. Interacts (via ULD domain) with ASXL1 (via DEUBAD domain); the interaction is direct and forms a ubiquitin binding cleft. The interaction with ASXL1 stabilizes BAP1 but is not required for nucleosome binding. Associates (via C-terminus) with nucleosome and chromatosome complexes through direct interaction with DNA and the histone3/4 dimer; this association displaces the histone-2A C-terminal tail, extending and orienting the H2AK118ub1 substrate towards the BAP1 deubiquitinase active site. Also interacts (via arginine finger) directly with the histone H2A-H2B acidic patch; this interaction is not critical for nucleosome-chromatosome association but may play a role in orienting the H2AK118ub1 substrate towards the PR-DUB complex active site. Interacts with BRCA1 (via the RING finger). Interacts (via HBM-like motif) with HCFC1. Interacts (via a C-terminal region overlapping the ULD domain) with YY1; the interaction is direct and requires the interaction with HCFC1. Interacts (when phosphorylated at Thr-493) with FOXK1. Interacts (when phosphorylated at Thr-493) with FOXK2; leading to recruitment of the PR-DUB complex and repression of FOXK2 target genes. Interacts (via non-classical PY-NLS) with TNPO1/transportin-1 (via HEAT repeats 8-12); the interaction is direct, mediates BAP1 nuclear localization and disrupts BAP1 homodimerization. Interacts (via C-terminus) with KPNA1/importin alpha5 and KPNA2/importin alpha1; these interactions can contribute to BAP1 nuclear localization but are less important than the interaction with TNPO1/transportin-1. The interaction with TNPO1/transportin-1 disrupts homodimerization and blocks ubiquitination by UBE2O.

Subcellular location. Cytoplasm. Nucleus. Chromosome.

Tissue specificity. Highly expressed in testis, placenta and ovary. Expressed in breast. levels in the placenta increase over the course of pregnancy.

Post-translational modifications. Ubiquitinated: monoubiquitinated at multiple sites within its nuclear localization signal (NLS) BY UBE2O, leading to cytoplasmic retention. Able to mediate autodeubiquitination via intramolecular interactions to counteract cytoplasmic retention. Monoubiquitinated on at least 4 sites near or within its PY-NLS.

Disease relevance. Mesothelioma, malignant (MESOM) [MIM:156240] An aggressive neoplasm of the serosal lining of the chest. It appears as broad sheets of cells, with some regions containing spindle-shaped, sarcoma-like cells and other regions showing adenomatous patterns. Pleural mesotheliomas have been linked to exposure to asbestos. The gene represented in this entry is involved in disease pathogenesis. Tumor predisposition syndrome 1 (TPDS1) [MIM:614327] An autosomal dominant condition characterized by predisposition to develop a variety of tumors, including benign melanocytic tumors as well as several malignant tumors, including uveal melanoma, cutaneous melanoma, malignant mesothelioma on exposure to asbestos, lung adenocarcinoma and meningioma. The disease is caused by variants affecting the gene represented in this entry. Melanoma, uveal, 2 (UVM2) [MIM:606661] Most common intraocular malignancy, arising from melanocytes in the iris, ciliary body, or choroid. Metastases develop in more than 30% of case patients, almost invariably in the liver, with poor prognosis. Disease susceptibility is associated with variants affecting the gene represented in this entry. Kury-Isidor syndrome (KURIS) [MIM:619762] An autosomal dominant neurodevelopmental disorder characterized mainly by mild global developmental delay apparent from infancy or early childhood, and behavioral problems, including autism in most patients. Intellectual development may be mildly delayed, borderline, or even normal. Additional variable systemic features may include poor overall growth, hypotonia, distal skeletal anomalies, seizures, and non-specific dysmorphic facial features. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. Possesses 2 overlapping nuclear localization sequences (NLS), a classic bipartite NLS and a non-classical PY-NLS. The classical NLS probably mediates import via the importin alpha/beta system while the PY-NLS mediates nuclear import via the transportin system. The positively charged C-terminal tail stabilizes the interaction with nucleosomes/chromatosomes through interaction with the DNA backbone. Binding of ASXL1 just upstream of the positively charged C-terminal tail may stabilize its orientation to align the PR-DUB with its H2AK118ub1 substrate. The ubiquitin C-terminal hydrolase (UCH) domain, together with the DEUBAD domain of ASXL1, forms the ubiquitin binding cleft of the PR-DUB complex. The positively charged Arg-finger motif mediates interaction with the histone H2A-H2B acidic patch; this interaction is critical for nucleosomal H2AK119ub1 deubiquitination activity but not nucleosomal binding.

Miscellaneous. May act as a tumor suppressor.

Similarity. Belongs to the peptidase C12 family. BAP1 subfamily.

RefSeq proteins (2): NP_001397701, NP_004647* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001578	Peptidase_C12_UCH	Domain
IPR036959	Peptidase_C12_UCH_sf	Homologous_superfamily
IPR038765	Papain-like_cys_pep_sf	Homologous_superfamily
IPR041507	UCH_C	Domain

Pfam: PF01088, PF18031

Enzyme classification (BRENDA):

• EC 3.4.19.12 — ubiquitinyl hydrolase 1 (BRENDA: 30 organisms, 328 substrates, 173 inhibitors, 70 Km, 58 kcat entries)

Substrate kinetics (BRENDA)

29 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
UBIQUITIN-7-AMIDO-4-METHYLCOUMARIN	—	7
DABCYL-FKKKGGGDVKE-EDANS	0.0142–0.0616	6
UBIQUITIN 7-AMIDO-4-METHYLCOUMARIN	—	5
UBIQUITIN ETHYL ESTER	0.0006–0.03	5
DABCYL-FRLKGGAPIKGV-EDANS	0.0048–0.0217	3
UBIQUITIN-W-G75A	0.0001–0.0004	2
UBIQUITIN-W-G76A	0.0011–0.002	2
UBIQUITIN-W-H68A	0.0005	2
UBIQUITIN-W-I44A	0.0003–0.0004	2
UBIQUITIN-W-K11A	0.0011–0.0023	2
UBIQUITIN-W-K48A	0.0003–0.0007	2
UBIQUITIN-W-K63A	0.0004–0.0008	2
UBIQUITIN-W-K6A	0.0009–0.0014	2
UBIQUITIN-W-L71A	0.008–0.0198	2
UBIQUITIN-W-L73A	0.0058–0.0104	2

UniProt features (112 total): mutagenesis site 31, sequence variant 20, helix 14, strand 13, region of interest 9, modified residue 8, short sequence motif 4, compositionally biased region 4, domain 2, active site 2, site 2, chain 1, turn 1, coiled-coil region 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
8H1T	ELECTRON MICROSCOPY	3
9U5U	ELECTRON MICROSCOPY	3.12
8SVF	ELECTRON MICROSCOPY	3.2
7VPW	X-RAY DIFFRACTION	3.76

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q92560-F1	63.87	0.32

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (4): 91 (nucleophile); 169 (proton donor); 85 (transition state stabilizer); 184 (important for enzyme activity)

Post-translational modifications (8): 292, 369, 395, 493, 521, 537, 585, 597

Mutagenesis-validated functional residues (31):

Position	Phenotype
56–60	probably disrupts interaction with the histone h2a-h2b acidic patch. severely attenuates deubiquitination of histone h2a
56	reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome.
59	reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome.
91	abolishes deubiquitinase activity. has no effect on interaction with hcfc1.
251	severely attenuates deubiquitination of histone h2ak119ub1 substrates, possibly due to disruption of homodimerization.
363–366	abolishes interaction with hcfc1 without affecting interaction with foxk1 and foxk2.
489	does not affect interaction with foxk1 and foxk2.
492	does not affect interaction with foxk1 and foxk2.
493	abolished interaction with foxk1 and foxk2.
495	does not affect interaction with foxk1 and foxk2.
635	severely attenuated deubiquitination of histone h2ak119ub1 substrates, possibly due to disruption of homodimerization. n
656–661	does not affect nuclear localization.
684–729	predominantly localizes to the cytosol.
691–711	abolishes ubiquitination by ube2o.
691	abolishes interaction with brca1.
697–729	abolishes deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome, probably due to disr
699–702	severely reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome but only mildl
699–701	reduced nucleosomal binding.
699–700	reduced nucleosomal binding.
699	slight or no reduction of deubiquitination efficiency towards h2ak119ub1 substrates in the context of the nucleosome.
700	slightly reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome.
701	reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome.
702	slightly reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome.
703	reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome.
708	reduces deubiquitination activity towards h2ak119ub1 substrates in the context of the nucleosome.

Function

Pathways and Gene Ontology

Reactome pathways

8 pathways

ID	Pathway
R-HSA-5689603	UCH proteinases
R-HSA-5693565	Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks
R-HSA-392499	Metabolism of proteins
R-HSA-5688426	Deubiquitination
R-HSA-5693532	DNA Double-Strand Break Repair
R-HSA-5693606	DNA Double Strand Break Response
R-HSA-597592	Post-translational protein modification
R-HSA-73894	DNA Repair

MSigDB gene sets: 550 (showing top): GOBP_MYELOID_CELL_DIFFERENTIATION, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_MYELOID_CELL_HOMEOSTASIS, GOBP_MYELOID_CELL_DEVELOPMENT, GOBP_INFLAMMATORY_RESPONSE, CMYB_01, GOBP_ERYTHROCYTE_HOMEOSTASIS, GOBP_GROWTH, GOBP_PROTEIN_TARGETING, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, BROWNE_HCMV_INFECTION_16HR_UP, GOBP_MYELOID_LEUKOCYTE_DIFFERENTIATION, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ORGANELLE, GOBP_PROTEIN_MODIFICATION_BY_SMALL_PROTEIN_REMOVAL, CAGCTG_AP4_Q5

GO Biological Process (35): mitotic cell cycle (GO:0000278), regulation of cell growth (GO:0001558), in utero embryonic development (GO:0001701), tissue homeostasis (GO:0001894), thrombocyte differentiation (GO:0002574), ubiquitin-dependent protein catabolic process (GO:0006511), negative regulation of cell population proliferation (GO:0008285), gene expression (GO:0010467), protein deubiquitination (GO:0016579), neutrophil differentiation (GO:0030223), heterochromatin formation (GO:0031507), myeloid cell apoptotic process (GO:0033028), monoubiquitinated protein deubiquitination (GO:0035520), common myeloid progenitor cell proliferation (GO:0035726), protein modification process (GO:0036211), platelet morphogenesis (GO:0036344), erythrocyte maturation (GO:0043249), nucleate erythrocyte differentiation (GO:0043363), negative regulation of DNA-templated transcription (GO:0045892), regulation of inflammatory response (GO:0050727), regulation of cell cycle (GO:0051726), hematopoietic stem cell homeostasis (GO:0061484), macrophage homeostasis (GO:0061519), neuron cellular homeostasis (GO:0070050), leukocyte proliferation (GO:0070661), protein K48-linked deubiquitination (GO:0071108), regulation of cytokine production involved in inflammatory response (GO:1900015), obsolete positive regulation of protein targeting to mitochondrion (GO:1903955), chromatin organization (GO:0006325), proteolysis (GO:0006508), cell population proliferation (GO:0008283), regulation of gene expression (GO:0010468), cell differentiation (GO:0030154), erythrocyte differentiation (GO:0030218), granulocyte differentiation (GO:0030851)

GO Molecular Function (8): chromatin binding (GO:0003682), cysteine-type deubiquitinase activity (GO:0004843), peptidase activity (GO:0008233), chromatin DNA binding (GO:0031490), histone H2A deubiquitinase activity (GO:0140950), protein binding (GO:0005515), cysteine-type peptidase activity (GO:0008234), hydrolase activity (GO:0016787)

GO Cellular Component (6): nucleus (GO:0005634), nucleoplasm (GO:0005654), chromosome (GO:0005694), cytoplasm (GO:0005737), cytosol (GO:0005829), PR-DUB complex (GO:0035517)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Deubiquitination	1
DNA Double Strand Break Response	1
Post-translational protein modification	1
DNA Repair	1
DNA Double-Strand Break Repair	1
Metabolism of proteins	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
cell population proliferation	2
binding	2
cell cycle	1
mitotic nuclear division	1
cell growth	1
regulation of growth	1
regulation of cellular component organization	1
chordate embryonic development	1
multicellular organismal-level homeostasis	1
anatomical structure homeostasis	1
myeloid cell differentiation	1
protein ubiquitination	1
modification-dependent protein catabolic process	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
macromolecule biosynthetic process	1
cysteine-type deubiquitinase activity	1
protein modification by small protein removal	1
granulocyte differentiation	1
cellular component assembly	1
heterochromatin boundary formation	1
negative regulation of gene expression, epigenetic	1
heterochromatin organization	1
apoptotic process	1
protein deubiquitination	1
protein metabolic process	1
macromolecule modification	1
cell morphogenesis	1
cell maturation	1
erythrocyte development	1
erythrocyte differentiation	1
DNA-templated transcription	1
regulation of DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
inflammatory response	1
regulation of defense response	1
regulation of response to external stimulus	1
cysteine-type peptidase activity	1
deubiquitinase activity	1

Protein interactions and networks

STRING

1582 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BAP1	ASXL1	Q8IXJ9	990
BAP1	BRCA1	P38398	987
BAP1	BARD1	Q99728	948
BAP1	HCFC1	P51610	846
BAP1	FOXK1	P85037	798
BAP1	GNA11	P29992	792
BAP1	OGT	O15294	760
BAP1	GNAQ	P50148	725
BAP1	ASXL2	Q76L83	724
BAP1	PBRM1	Q86U86	708
BAP1	Q08EI0	Q08EI0	687
BAP1	SETD2	Q9BYW2	627
BAP1	EIF1AX	P47813	623
BAP1	YY1	P25490	605
BAP1	NF2	P35240	600

IntAct

124 interactions, top by confidence:

A	B	Type	Score
BAP1	ASXL1	psi-mi:“MI:0915”(physical association)	0.830
ASXL1	BAP1	psi-mi:“MI:0915”(physical association)	0.830
ASXL1	BAP1	psi-mi:“MI:0914”(association)	0.830
HCFC1	BAP1	psi-mi:“MI:0915”(physical association)	0.740
BAP1	OGT	psi-mi:“MI:0914”(association)	0.730
FOXK2	DVL2	psi-mi:“MI:0914”(association)	0.640
BAP1	ITPR3	psi-mi:“MI:0915”(physical association)	0.640
BAP1	ITPR3	psi-mi:“MI:2364”(proximity)	0.640
BAP1	ITPR3	psi-mi:“MI:0403”(colocalization)	0.640
ITPR3	BAP1	psi-mi:“MI:0915”(physical association)	0.640
BAP1	ITPR3	psi-mi:“MI:0204”(deubiquitination reaction)	0.640
BAP1	BRAF	psi-mi:“MI:0915”(physical association)	0.550
BRAF	BAP1	psi-mi:“MI:2364”(proximity)	0.550
BRCA1	BAP1	psi-mi:“MI:0915”(physical association)	0.540
BAP1	BRCA1	psi-mi:“MI:0915”(physical association)	0.540
BAP1	BRCA1	psi-mi:“MI:0403”(colocalization)	0.540
FHL2	CNOT1	psi-mi:“MI:0914”(association)	0.530
ABT1	ZNF316	psi-mi:“MI:0914”(association)	0.530

BioGRID (1667): BAP1 (Affinity Capture-Western), HIST2H2AC (Affinity Capture-Western), BAP1 (Reconstituted Complex), UBE2O (Co-fractionation), BAP1 (Biochemical Activity), Ogt (Biochemical Activity), BAP1 (Affinity Capture-MS), BAP1 (Affinity Capture-MS), BAP1 (Two-hybrid), BAP1 (Two-hybrid), BAP1 (Two-hybrid), BAP1 (Two-hybrid), BAP1 (Two-hybrid), BAP1 (Two-hybrid), BAP1 (Two-hybrid)

ESM2 similar proteins: A0A0R4IXF6, A1L2G3, A2VDM8, B0W2R4, C4A0D9, D3ZHS6, E6ZGB4, O75151, P0C090, P0CH95, Q08BR4, Q1LUC3, Q24574, Q28C33, Q2V2M9, Q4VGL6, Q52L14, Q56R14, Q5F363, Q5F3N6, Q5JSH3, Q5TC82, Q5XJV7, Q62315, Q66JB6, Q6GQQ9, Q6INA9, Q6NUC6, Q6P949, Q6PDG5, Q80TJ7, Q8BLB8, Q8K2L8, Q8QG78, Q8TAQ2, Q91YE9, Q92560, Q92830, Q92831, Q92833

Diamond homologs: A1L2G3, A2VDM8, B0W2R4, B3MIV9, B3NPV7, B4GAM2, B4HST0, B4JW98, B4KT51, B4LQ24, B4P6P6, B4QHH0, C4A0D9, D3ZHS6, O04482, Q06AT3, Q09444, Q17N72, Q291J4, Q52L14, Q54N38, Q5F3N6, Q66JB6, Q7K5N4, Q8IIJ6, Q92560, Q99PU7, Q9FFF2, Q9UUB6, Q9WUP7, Q9XSJ0, Q9Y5K5, P09936, Q00981, Q9R0P9, P50103, Q60HC8, Q9GM50, P35122, Q2TBG8

SIGNOR signaling

4 interactions.

A	Effect	B	Mechanism
BAP1	“up-regulates activity”	ASXL3	binding
BAP1	“up-regulates quantity by stabilization”	KEAP1	binding
BAP1	“up-regulates quantity by expression”	CDKN2B	“transcriptional regulation”
BAP1	down-regulates	Proliferation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 114 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Formation of WDR5-containing histone-modifying complexes	6	17.9×	2e-04
UCH proteinases	8	11.2×	1e-04
Deubiquitination	7	9.8×	9e-04
Extra-nuclear estrogen signaling	5	9.6×	9e-03
Signaling by WNT	7	8.8×	2e-03
Diseases of signal transduction by growth factor receptors and second messengers	9	5.8×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of miRNA transcription	8	21.1×	1e-06
epidermal growth factor receptor signaling pathway	6	13.5×	7e-04
chromatin remodeling	13	8.6×	1e-06
transcription by RNA polymerase II	13	8.3×	1e-06
heart development	8	5.7×	7e-03
protein stabilization	9	5.5×	5e-03
positive regulation of gene expression	15	5.3×	3e-05

Disease & clinical

Clinical variants and AI predictions

ClinVar

3584 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	312
Likely pathogenic	95
Uncertain significance	1371
Likely benign	986
Benign	58

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1012196	NM_004656.4(BAP1):c.67+2T>C	Pathogenic
1013479	NM_004656.4(BAP1):c.993del (p.Lys331fs)	Pathogenic
1064792	NM_004656.4(BAP1):c.34C>A (p.Pro12Thr)	Pathogenic
1069122	NM_004656.4(BAP1):c.593dup (p.Asp199fs)	Pathogenic
1070605	NM_004656.4(BAP1):c.1883C>A (p.Ser628Ter)	Pathogenic
1070749	NM_004656.4(BAP1):c.799_800del (p.Gln267fs)	Pathogenic
1070831	NM_004656.4(BAP1):c.1470_1471insA (p.Glu491fs)	Pathogenic
1071620	NM_004656.4(BAP1):c.2017G>T (p.Glu673Ter)	Pathogenic
1071927	NM_004656.4(BAP1):c.669C>A (p.Tyr223Ter)	Pathogenic
1072297	NM_004656.4(BAP1):c.436dup (p.Arg146fs)	Pathogenic
1073043	NM_004656.4(BAP1):c.944dup (p.Ala316fs)	Pathogenic
1073050	NM_004656.4(BAP1):c.203del (p.Asp68fs)	Pathogenic
1073322	NM_004656.4(BAP1):c.581-2A>G	Pathogenic
1073405	NM_004656.4(BAP1):c.132T>G (p.Tyr44Ter)	Pathogenic
1073757	NM_004656.4(BAP1):c.830_831del (p.Gln277fs)	Pathogenic
1073906	NM_004656.4(BAP1):c.721dup (p.Tyr241fs)	Pathogenic
1074041	NM_004656.4(BAP1):c.555del (p.Gly185_Leu186insTer)	Pathogenic
1075173	NM_004656.4(BAP1):c.102_109del (p.Asp34fs)	Pathogenic
1075700	NM_004656.4(BAP1):c.1766_1770del (p.Ile589fs)	Pathogenic
1076668	NM_004656.4(BAP1):c.1383dup (p.Pro462fs)	Pathogenic
1171962	NM_004656.4(BAP1):c.1213G>T (p.Glu405Ter)	Pathogenic
1173080	NM_004656.4(BAP1):c.176G>C (p.Arg59Pro)	Pathogenic
1173081	NM_004656.4(BAP1):c.272G>C (p.Cys91Ser)	Pathogenic
1183824	NM_004656.4(BAP1):c.1514C>A (p.Ser505Ter)	Pathogenic
1216875	NM_004656.4(BAP1):c.132del (p.Val43_Tyr44insTer)	Pathogenic
1362781	NM_004656.4(BAP1):c.1778del (p.Gln593fs)	Pathogenic
1365414	NM_004656.4(BAP1):c.1139_1151del (p.Gly380fs)	Pathogenic
1386236	NM_004656.4(BAP1):c.606_607delinsTT (p.Trp202_Thr203delinsCysSer)	Pathogenic
1396376	NM_004656.4(BAP1):c.1786del (p.Ser596fs)	Pathogenic
1417901	NM_004656.4(BAP1):c.49dup (p.Leu17fs)	Pathogenic

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

4772 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:52402358:C:T	G707D	1.000
3:52402371:C:A	G703W	1.000
3:52402406:A:G	L691P	1.000
3:52402415:A:G	L688P	1.000
3:52402613:A:G	L682P	1.000
3:52402624:A:C	F678L	1.000
3:52402624:A:T	F678L	1.000
3:52402625:A:G	F678S	1.000
3:52402626:A:G	F678L	1.000
3:52402634:A:T	I675N	1.000
3:52402636:G:C	F674L	1.000
3:52402636:G:T	F674L	1.000
3:52402637:A:C	F674C	1.000
3:52402637:A:G	F674S	1.000
3:52402638:A:G	F674L	1.000
3:52402647:A:G	Y671H	1.000
3:52402657:C:A	R667S	1.000
3:52402657:C:G	R667S	1.000
3:52402658:C:A	R667M	1.000
3:52402658:C:G	R667T	1.000
3:52402660:T:A	R666S	1.000
3:52402660:T:G	R666S	1.000
3:52402661:C:G	R666T	1.000
3:52402791:C:A	R657S	1.000
3:52402791:C:G	R657S	1.000
3:52402813:A:G	L650P	1.000
3:52402855:A:G	L636P	1.000
3:52402858:A:G	L635P	1.000
3:52402864:A:G	L633P	1.000
3:52402867:A:G	L632P	1.000

dbSNP variants (sampled 300 via entrez): RS1000231934 (3:52406525 A>C,G), RS1000745082 (3:52401538 T>C), RS1001711910 (3:52409932 TGCCCCCACCGGGA>T,TGCCCCCACCGGGAGCCCCCACCGGGA), RS1002367693 (3:52401147 A>G), RS1002612084 (3:52410020 C>G,T), RS1002743687 (3:52404652 C>G), RS1003000605 (3:52410715 G>A), RS1003021301 (3:52410304 G>A,C), RS1003125689 (3:52403539 C>A,G,T), RS1003296528 (3:52411037 C>T), RS1003337297 (3:52411595 T>A,G), RS1003388088 (3:52411339 G>C), RS1003849389 (3:52404681 C>T), RS1003952085 (3:52410932 G>A), RS1003974135 (3:52404078 T>G)

Disease associations

OMIM: gene MIM:603089 | disease phenotypes: MIM:614327, MIM:619762, MIM:606661, MIM:155720, MIM:155255, MIM:612219, MIM:254500

GenCC curated gene-disease

Disease	Classification	Inheritance
BAP1-related tumor predisposition syndrome	Definitive	Autosomal dominant
Kury-Isidor syndrome	Strong	Autosomal dominant
renal cell carcinoma	Strong	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
BAP1-related tumor predisposition syndrome	Definitive	AD

Mondo (13): BAP1-related tumor predisposition syndrome (MONDO:0013692), hereditary neoplastic syndrome (MONDO:0015356), neurodevelopmental disorder (MONDO:0700092), Kury-Isidor syndrome (MONDO:0859230), melanoma, uveal, susceptibility to, 2 (MONDO:0011696), astrocytoma (excluding glioblastoma) (MONDO:0019781), uveal melanoma (MONDO:0006486), medulloblastoma (MONDO:0007959), Ewing sarcoma (MONDO:0012817), ganglioglioma (MONDO:0016733), plasma cell myeloma (MONDO:0009693), clear cell renal carcinoma (MONDO:0005005), renal cell carcinoma (MONDO:0005086)

Orphanet (10): BAP1-related tumor predisposition syndrome (Orphanet:289539), Inherited cancer-predisposing syndrome (Orphanet:140162), Uveal melanoma (Orphanet:39044), Medulloblastoma (Orphanet:616), OBSOLETE: Neuroepithelioma (Orphanet:2677), Skeletal Ewing sarcoma (Orphanet:319), Ganglioglioma (Orphanet:251949), Multiple myeloma (Orphanet:29073), AL amyloidosis (Orphanet:85443), Clear cell renal carcinoma (Orphanet:319276)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

MeSH disease descriptors (8)

Descriptor	Name	Tree numbers
D001254	Astrocytoma	C04.557.465.625.600.380.080; C04.557.470.670.380.080; C04.557.580.625.600.380.080
D002292	Carcinoma, Renal Cell	C04.557.470.200.025.390; C04.588.945.947.535.160; C12.050.351.937.820.535.160; C12.050.351.968.419.473.160; C12.200.758.820.750.160; C12.200.777.419.473.160; C12.900.820.535.160; C12.950.419.473.160; C12.950.983.535.160
D018303	Ganglioglioma	C04.557.465.625.600.380.350; C04.557.470.670.380.350; C04.557.580.625.600.380.350
D008527	Medulloblastoma	C04.557.465.625.600.380.515; C04.557.465.625.600.590.500; C04.557.470.670.380.515; C04.557.470.670.590.500; C04.557.580.625.600.380.515; C04.557.580.625.600.590.500
D009101	Multiple Myeloma	C04.557.595.500; C14.907.454.460; C15.378.147.780.650; C15.378.463.515.460; C20.683.515.845; C20.683.780.650
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
D065886	Neurodevelopmental Disorders	F03.625
D012512	Sarcoma, Ewing	C04.557.450.565.575.650.800; C04.557.450.795.620.800

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL1293314 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — C12: Ubiquitin C-terminal hydrolase

Binding affinities (BindingDB)

18 measured of 40 human assays (42 total across all organisms); most potent 18 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
4-[[2-[(4-keto-6-methyl-1H-pyrimidin-2-yl)thio]acetyl]amino]benzoic acid ethyl ester	IC50	23 nM
2-[3-(4-chlorophenyl)-1,2,4-oxadiazol-5-yl]-N-(3-methoxyphenyl)benzamide	IC50	9000 nM
MLS000113142	IC50	14500 nM
3-[(1-tert-butyl-1,2,3,4-tetrazol-5-yl)-[4-(furan-2-ylcarbonyl)piperazin-1-yl]methyl]-8-methyl-1H-quinolin-2-one	IC50	17300 nM
1-[1-(3-piperidin-1-ylsulfonylphenyl)sulfonylpiperidin-4-yl]benzotriazole	IC50	18300 nM
4-Amino-2-[(3-cyano-4,5-dimethyl-thiophen-2-ylcarbamoyl)-methylsulfanyl]-pyrimidine-5-carboxylic acid ethyl ester	IC50	18700 nM
5-(1,3-benzodioxol-5-yl)-N-(2-furanylmethyl)-7-(trifluoromethyl)-2-pyrazolo[1,5-a]pyrimidinecarboxamide	IC50	20400 nM
5-Acetyl-4-methyl-2-[2-(5-phenyl-tetrazol-2-yl)-acetylamino]-thiophene-3-carboxylic acid ethyl ester	IC50	23100 nM
2-(2-{5-[(4-Fluoro-phenylamino)-methyl]-[1,3,4]oxadiazol-2-ylsulfanyl}-acetylamino)-4,5-dimethyl-thiophene-3-carboxylic acid ethyl ester	IC50	29100 nM
2-(3-cyclohexyl-4-oxidanylidene-quinazolin-2-yl)sulfanyl-N-[4-(dimethylamino)phenyl]ethanamide	IC50	30200 nM
4-ethyl-5-methyl-2-(2-thenoylamino)thiophene-3-carboxylic acid ethyl ester	IC50	30400 nM
4-(2,3-dimethoxyphenyl)-2-methyl-5-oxo-4,6,7,8-tetrahydro-1H-quinoline-3-carboxylic acid propyl ester	IC50	33900 nM
3-[3-(2-fluorophenyl)-1,2,4-oxadiazol-5-yl]-N-(6-methoxy-1,3-benzothiazol-2-yl)propanamide	IC50	36600 nM
MLS000066762	IC50	36700 nM
2-[[3-(4-chlorophenyl)-4-keto-6,7-dihydrothieno[3,2-d]pyrimidin-2-yl]thio]-N-(2,3-dihydro-1,4-benzodioxin-6-yl)acetamide	IC50	38600 nM
2-[5-(2-Fluoro-phenyl)-tetrazol-2-yl]-N-[4-(3-methyl-piperidine-1-sulfonyl)-phenyl]-acetamide	IC50	41600 nM
MLS000029283	IC50	44800 nM
(5Z)-5-(2-furylmethylene)-2-(4-methylphenyl)[1,3]thiazolo[3,2-b][1,2,4]triazol-6(5H)-one	IC50	50000 nM

ChEMBL bioactivities

1 potent at pChembl≥5 of 21 total, top 1 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.05	IC50	9002	nM	CHEMBL1548217

CTD chemical–gene interactions

29 total (human), top 29 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cadmium Chloride	decreases expression, increases abundance, increases expression	2
FR900359	increases phosphorylation	1
mivebresib	decreases expression	1
triphenyl phosphate	affects expression	1
afimoxifene	affects response to substance	1
coumarin	affects phosphorylation	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
monomethylarsonous acid	increases expression	1
olaparib	increases response to substance	1
eprenetapopt	affects expression	1
Resveratrol	decreases expression	1
Arsenic Trioxide	affects expression	1
Lycopene	increases expression	1
Air Pollutants	affects expression, increases abundance	1
Asbestos	increases mutagenesis	1
Aspirin	decreases expression	1
Benzene	increases expression	1
Cadmium	increases abundance, increases expression	1
Caffeine	affects phosphorylation	1
Doxorubicin	decreases expression	1
Ozone	affects expression, increases abundance	1
Selenium	increases expression	1
Smoke	decreases expression	1
Toluene	decreases expression	1
Valproic Acid	increases methylation	1
Vitamin E	increases expression	1
Cyclosporine	increases methylation	1
Lactic Acid	increases expression	1

ChEMBL screening assays

5 unique, capped per target: 4 binding, 1 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1613951	Functional	PUBCHEM_BIOASSAY: BAP1 Enzyme inhibitors Dose Response Confirmation. (Class of assay: confirmatory) [Related pubchem assays: 436 (Primary screen preceding this dose response confirmation assay.)]	PubChem BioAssay data set
CHEMBL4358859	Binding	Inhibition of His6-tagged recombinant human BAP1 assessed as reduction in cleavage of luminescent substrate Ub-AML at 100 uM	Re-Evaluating the Mechanism of Action of α,β-Unsaturated Carbonyl DUB Inhibitors b-AP15 and VLX1570: A Paradigmatic Example of Unspecific Protein Cross-linking with Michael Acceptor Motif-Containing Drugs. — J Med Chem

Cellosaurus cell lines

23 cell lines: 21 cancer cell line, 2 telomerase immortalized cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_1553	NCI-H2452	Cancer cell line	Male
CVCL_1555	NCI-H28	Cancer cell line	Male
CVCL_2658	NO36	Cancer cell line	Male
CVCL_4D11	MP38	Cancer cell line	Male
CVCL_4D14	MP65	Cancer cell line	Female
CVCL_4D15	MM28	Cancer cell line	Male
CVCL_5114	ACC-MESO-4	Cancer cell line	Male
CVCL_5179	Y-MESO-14	Cancer cell line	Male
CVCL_5182	Y-MESO-25	Cancer cell line	Male
CVCL_5190	Y-MESO-9	Cancer cell line	Male

Clinical trials (associated diseases)

531 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00414765	PHASE4	COMPLETED	Aldesleukin in Participants With Metastatic Renal Cell Carcinoma or Metastatic Melanoma
NCT00777504	PHASE4	UNKNOWN	Study to the Optimal Duration of Therapy With Oral Angiogenesis Inhibitors
NCT00930345	PHASE4	TERMINATED	Biological, Pathological and Imagery Markers in the First-line Treatment of Metastatic Clear-cell Renal Cell Carcinoma
NCT01206764	PHASE4	COMPLETED	A Trial of Everolimis in Patients With Advanced Renal Cell Carcinoma.
NCT01266837	PHASE4	COMPLETED	Open Label, Single Arm Trial to Characterize Patients With Metastatic RCC Treated With Everolimus After Failure of the First VEGF-targeted Therapy (MARC-2)
NCT02056587	PHASE4	COMPLETED	Everolimus in Patients With Metastatic Renal Cell Carcinoma Following Progression on Prior Bevacizumab Treatment
NCT02338570	PHASE4	TERMINATED	Outcome-related Factors in Patients With Metastatic Renal Cell Carcinoma Treated With Everolimus (ORCHIDEE)
NCT02596035	PHASE4	COMPLETED	An Investigational Immuno-therapy Safety Trial of Nivolumab in Patients With Advanced or Metastatic Renal Cell Carcinoma
NCT02982954	PHASE4	COMPLETED	A Study to Evaluate the Safety of Nivolumab and Ipilimumab in Subjects With Previously Untreated Advanced or Metastatic Renal Cell Cancer
NCT05949424	PHASE4	UNKNOWN	OPTI - DOSE: Optimal Dosing of Oral Anticancer Drugs in Older Adults
NCT07028125	PHASE4	RECRUITING	Digital Monitoring of Self-reported Symptoms by Patients Treated With Cabozantinib Plus Nivolumab for Advanced Clear-cell Renal Carcinoma
NCT07405086	PHASE4	RECRUITING	Morning Versus Afternoon Administration of Immunotherapy for the Treatment of Advanced or Metastatic Solid Tumors, The Knight SHIFT Study
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT00033904	PHASE3	COMPLETED	Survival Study Of Oncophage® vs. Observation In Patients With Kidney Cancer
NCT00126178	PHASE3	TERMINATED	Clinical Trial Studying a Personalized Cancer Vaccine in Patients With Non-metastatic Kidney Cancer
NCT00291369	PHASE3	COMPLETED	Cytokines in Patients With Metastatic Renal Cell Carcinoma of Intermediate Prognosis
NCT00410124	PHASE3	COMPLETED	RAD001 Plus Best Supportive Care (BSC) Versus BSC Plus Placebo in Patients With Metastatic Carcinoma of the Kidney Which Has Progressed After Treatment With Sorafenib and/or Sunitinib
NCT00474786	PHASE3	COMPLETED	Temsirolimus Versus Sorafenib As Second-Line Therapy In Patients With Advanced RCC Who Have Failed First-Line Sunitinib
NCT00478114	PHASE3	COMPLETED	Efficacy and Safety of Sorafenib in Advanced Renal Cell Carcinoma (RCC)
NCT00606632	PHASE3	COMPLETED	Pre-surgical Detection of Clear Cell Renal Cell Carcinoma (ccRCC) Using Radiolabeled G250-Antibody
NCT00606866	PHASE3	COMPLETED	MRI Study of BAY 43-9006 in Metastatic Renal Cell Carcinoma
NCT00631371	PHASE3	COMPLETED	Study Comparing Bevacizumab + Temsirolimus vs. Bevacizumab + Interferon-Alfa In Advanced Renal Cell Carcinoma Subjects
NCT00732914	PHASE3	COMPLETED	Sequential Study to Treat Renal Cell Carcinoma
NCT00869011	PHASE3	UNKNOWN	Exercise for Patients With Renal Cell Cancer Receiving Sunitinib
NCT00930033	PHASE3	COMPLETED	Clinical Trial to Assess the Importance of Nephrectomy
NCT01030783	PHASE3	COMPLETED	A Study to Compare Tivozanib (AV-951) to Sorafenib in Subjects With Advanced Renal Cell Carcinoma
NCT01076010	PHASE3	COMPLETED	An Extension Treatment Protocol for Subjects Who Have Participated in a Study of Tivozanib Versus Sorafenib in Kidney Carcinoma (Protocol AV-951-09-301).
NCT01198158	PHASE3	TERMINATED	Everolimus With or Without Bevacizumab in Treating Patients With Advanced Kidney Cancer That Progressed After First-Line Therapy
NCT01223027	PHASE3	COMPLETED	Study of Dovitinib Versus Sorafenib in Patients With Metastatic Renal Cell Carcinoma
NCT01224288	PHASE3	ACTIVE_NOT_RECRUITING	Dynamic Contrast Enhancement Computed Tomography for Evaluating Tumor Perfusion in Patients With Metastatic Renal Cell Carcinoma Receiving Targeted Therapies: Renal Cell Carcinoma (RCC) Scramble
NCT01235962	PHASE3	COMPLETED	A Study to Evaluate Pazopanib as an Adjuvant Treatment for Localized Renal Cell Carcinoma (RCC)
NCT01265810	PHASE3	COMPLETED	Caphosol in Oral Mucositis Due to Targeted Therapy
NCT01265901	PHASE3	COMPLETED	IMA901 in Patients Receiving Sunitinib for Advanced/Metastatic Renal Cell Carcinoma
NCT01481870	PHASE3	UNKNOWN	Comparison of Sequential Therapies With Sunitinib and Sorafenib in Advanced Renal Cell Carcinoma
NCT01582672	PHASE3	TERMINATED	Phase 3 Trial of Autologous Dendritic Cell Immunotherapy Plus Standard Treatment of Advanced Renal Cell Carcinoma
NCT01613846	PHASE3	COMPLETED	Phase III Sequential Open-label Study to Evaluate the Efficacy and Safety of Sorafenib Followed by Pazopanib Versus Pazopanib Followed by Sorafenib in the Treatment of Advanced / Metastatic Renal Cell Carcinoma (SWITCH-II)
NCT01762592	PHASE3	WITHDRAWN	REDECT 2: REnal Masses: Pivotal Trial to DEteCT Clear Cell Renal Cell Carcinoma With PET/CT
NCT01865747	PHASE3	COMPLETED	A Study of Cabozantinib (XL184) vs Everolimus in Subjects With Metastatic Renal Cell Carcinoma
NCT02231749	PHASE3	COMPLETED	Nivolumab Combined With Ipilimumab Versus Sunitinib in Previously Untreated Advanced or Metastatic Renal Cell Carcinoma (CheckMate 214)